ID: 924654590

View in Genome Browser
Species Human (GRCh38)
Location 1:245962067-245962089
Sequence ACGTGGGAGGCTGTGTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8025
Summary {0: 1, 1: 0, 2: 7, 3: 339, 4: 7678}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924654590_924654595 15 Left 924654590 1:245962067-245962089 CCACATGACACAGCCTCCCACGT 0: 1
1: 0
2: 7
3: 339
4: 7678
Right 924654595 1:245962105-245962127 TTTCATCTGTTTTACATGTGAGG 0: 1
1: 0
2: 7
3: 48
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924654590 Original CRISPR ACGTGGGAGGCTGTGTCATG TGG (reversed) Intronic
Too many off-targets to display for this crispr