ID: 924655235

View in Genome Browser
Species Human (GRCh38)
Location 1:245968765-245968787
Sequence CAGAATTATTAAATGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 1, 3: 63, 4: 423}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924655235_924655241 22 Left 924655235 1:245968765-245968787 CCATATTCCATTTAATAATTCTG 0: 1
1: 0
2: 1
3: 63
4: 423
Right 924655241 1:245968810-245968832 TTGTAAATTTCAGCCTTCTCAGG 0: 1
1: 0
2: 1
3: 26
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924655235 Original CRISPR CAGAATTATTAAATGGAATA TGG (reversed) Intronic
903431766 1:23309065-23309087 CAGAATTTCTAAAGGAAATAGGG + Intronic
905759789 1:40545742-40545764 CAGAATGATTAAGAGGAAAAAGG + Intronic
907086460 1:51679779-51679801 CACCATTATTAAATAAAATAAGG - Intronic
907115619 1:51965700-51965722 AAATATTATTAAATGCAATACGG + Intronic
907691833 1:56676359-56676381 CAGAATGATAAAATGGGAGAAGG + Intronic
907727269 1:57031354-57031376 CAGTATTATCAGATGGAACATGG - Intronic
908069801 1:60446883-60446905 TAGAATTATTAAATTCAAGAGGG + Intergenic
908828318 1:68154751-68154773 CACAAATGTTAAAAGGAATAGGG - Intronic
909354230 1:74688892-74688914 CAGAGGTATTCATTGGAATATGG + Intergenic
910031232 1:82726384-82726406 CAATATTATCAAATGGAATGAGG + Intergenic
910499820 1:87877386-87877408 CAGATTTCTTAAGTGGAAAATGG - Intergenic
911992981 1:104726230-104726252 CACAATTATAAAATGGACAAAGG + Intergenic
912145842 1:106793233-106793255 CAGAATAATTAAATAAATTATGG + Intergenic
915181383 1:154063913-154063935 TAGAACCATTCAATGGAATAGGG + Intronic
916121861 1:161535526-161535548 CAGAAAGACTAAATGGAAAAGGG - Intergenic
916131456 1:161615475-161615497 CAGAAAGACTAAATGGAAAAGGG - Intronic
917315371 1:173719158-173719180 CATAACTATTAAAAGGAATAAGG - Intronic
918026272 1:180750997-180751019 CAGCATTAATATATGAAATAAGG - Intronic
918393817 1:184093992-184094014 CAGAATTAATAAAGGCAACAGGG - Intergenic
919119425 1:193320742-193320764 AGGGATTATTAAATAGAATATGG - Intergenic
921749372 1:218775153-218775175 CATAAATATCAAATGGAATTGGG + Intergenic
922180954 1:223232252-223232274 CAGTATTATTAACTGGAGTCTGG - Intronic
922438062 1:225625898-225625920 CAGAGTTCTAAAATGGAAGAAGG - Intronic
922640026 1:227220773-227220795 AAGAAATTTTTAATGGAATAAGG - Intronic
924655235 1:245968765-245968787 CAGAATTATTAAATGGAATATGG - Intronic
1063799578 10:9558068-9558090 CAGAATTTTTCAATAAAATAAGG + Intergenic
1065134008 10:22650472-22650494 CATAACTATAAAATGGAAGAAGG + Intronic
1065988686 10:30984051-30984073 AAAAATAATTAAATGCAATATGG - Intronic
1068840621 10:61609733-61609755 CAGCTTTATTGAATGGAATCAGG + Intergenic
1068939639 10:62668398-62668420 CAAACTCATTTAATGGAATAGGG + Intronic
1069017919 10:63451821-63451843 CAAAACTATTCAATGGAAAAAGG + Intronic
1069060633 10:63891096-63891118 GAGAGTAATTAAATGGAACAGGG - Intergenic
1070410485 10:76134927-76134949 GAGAATTATGAAATGGAAAAAGG + Intronic
1071767510 10:88684641-88684663 TAAAATTATTAAATGGAAGCTGG - Intergenic
1074340515 10:112624214-112624236 CAGCAATACTAAATGGAATATGG + Intronic
1075172003 10:120124269-120124291 CAGAACAAGTAAATGGAATGTGG - Intergenic
1076151942 10:128169509-128169531 CAGAATTTTTTAATGGAATGTGG + Intergenic
1076622115 10:131796905-131796927 CAGAATAACTAAATGAATTAAGG - Intergenic
1077703703 11:4464217-4464239 AAGAATTATAAAATGGAAAAGGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079119393 11:17671077-17671099 CCACATTATTAAATGGAGTAAGG + Intergenic
1080002080 11:27361714-27361736 CAGCATGAGTGAATGGAATATGG - Intronic
1080146308 11:28988480-28988502 GAGAATTAATGAATGGTATAGGG - Intergenic
1080728606 11:34923088-34923110 CAGAATTTTTAGATAGCATATGG - Intronic
1080881878 11:36328907-36328929 AAGACTGGTTAAATGGAATATGG - Intronic
1080985871 11:37464699-37464721 GAGAATTATTAAACTGAATTTGG - Intergenic
1081112805 11:39157622-39157644 CAGAAATAATTACTGGAATAGGG - Intergenic
1082995777 11:59254102-59254124 TAGAATTATGAAAAGCAATAAGG - Intergenic
1083188361 11:61031521-61031543 CAGGATGATTAAATGGGATATGG - Intergenic
1085342836 11:75744619-75744641 CAGAATGATAAAAGGGAATCTGG - Intergenic
1086604329 11:88677703-88677725 CAAAAATATTAAATGTTATAAGG + Intronic
1087212454 11:95457747-95457769 GAGAAATATTAAGTAGAATAAGG - Intergenic
1087317901 11:96625758-96625780 TAGAATTTTAAAATAGAATATGG + Intergenic
1087608142 11:100402414-100402436 CAGAATTTTTAAATGAAAAAAGG - Intergenic
1087628740 11:100625711-100625733 AAGGATTAGTAAATGTAATATGG + Intergenic
1087853574 11:103062546-103062568 AAGCACCATTAAATGGAATAAGG - Intronic
1088133926 11:106530442-106530464 AAGAACTATTAAATTGCATATGG + Intergenic
1088434878 11:109801195-109801217 AAGAATTATTAAATAAAAAAAGG - Intergenic
1088436934 11:109824226-109824248 CAGAATTGTTTAATGCCATAGGG - Intergenic
1089335276 11:117718532-117718554 TAGAATTAATCAATGGAATTAGG + Intronic
1090940449 11:131383559-131383581 CAGAATTCTGAAATCAAATATGG + Intronic
1091081707 11:132675793-132675815 AAGTATTAATAAATGGAAAATGG + Intronic
1091812634 12:3412595-3412617 GAGAATTTTTAAATAGAAAAAGG - Intronic
1092201923 12:6590259-6590281 CACAATAACTAAATGGAACACGG + Intronic
1093374297 12:18405656-18405678 AAGAAGTATTAAATAGAATTAGG + Intronic
1094207136 12:27852470-27852492 CAGACTTTTTAAATGGCAAAAGG + Intergenic
1094465137 12:30745122-30745144 CAGATGTATTAAATGTAACAAGG + Intronic
1097624855 12:61987721-61987743 CAGAATTGGTAAATTAAATAAGG + Intronic
1098280429 12:68856888-68856910 AAGAATTACAAAATGAAATAAGG + Intronic
1098367228 12:69717176-69717198 AGGAATTATTACATGGATTAAGG - Intergenic
1099246277 12:80196918-80196940 CTGAATTATAAAATGGAGGAGGG - Intergenic
1099552122 12:84059432-84059454 CAGAATTATGAGATAAAATAAGG + Intergenic
1099682135 12:85843486-85843508 CAGAATTTTTCAATGAATTAAGG + Intergenic
1099702316 12:86102496-86102518 AAAAATTAATGAATGGAATATGG + Intronic
1099739499 12:86614409-86614431 CAGAATAATTAAAGGGATTATGG + Intronic
1099797174 12:87413660-87413682 CAGAATTCTGAAATAAAATATGG + Intergenic
1100141971 12:91630269-91630291 CAGCATGATTAACTGTAATAGGG - Intergenic
1100439616 12:94604503-94604525 CAGAATTAAAAAATGTAACAAGG + Intronic
1101021524 12:100558950-100558972 TAGAACTATTAAATGAATTATGG + Intronic
1102966196 12:117128741-117128763 CATAAGTATTAAATGGCACATGG + Intergenic
1105309257 13:19191697-19191719 AAGAATTATTTAAAGAAATATGG + Intergenic
1106238315 13:27885160-27885182 AAAAATAATTAAATGGAAAAAGG + Intergenic
1106968289 13:35101526-35101548 CACAATTATTAAATGGGCAAAGG - Intronic
1107342629 13:39424810-39424832 CAGAAGTCTTAAAAGTAATAGGG + Intronic
1107763480 13:43707849-43707871 AAGATCAATTAAATGGAATAAGG + Intronic
1107883438 13:44854096-44854118 CAGATTCATTGAATGGCATAAGG + Intergenic
1108178841 13:47821387-47821409 AAGAATTATTAACTAAAATAGGG + Intergenic
1108301251 13:49078572-49078594 CAAAATTACAAGATGGAATATGG + Intronic
1108616850 13:52141665-52141687 CAGAATAATGAAATGGAACAGGG - Intronic
1108813353 13:54258954-54258976 GTCAATTTTTAAATGGAATATGG + Intergenic
1109036865 13:57274290-57274312 CAGAACTACTAAATGTAATGTGG + Intergenic
1109483467 13:62987368-62987390 CAGGCTTATTAAACTGAATAGGG + Intergenic
1110089575 13:71428845-71428867 CAGAAAAATTACATAGAATAAGG + Intergenic
1110282622 13:73712897-73712919 CACAACTTTTAAATGTAATAGGG + Intronic
1110817588 13:79879205-79879227 CTTAATTGTTAAATGTAATAAGG + Intergenic
1111466571 13:88620383-88620405 CAAAAATATTAAATGGCATGAGG - Intergenic
1112188791 13:97154772-97154794 CTGAATAAATAAATGGTATAAGG + Intergenic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1112540820 13:100310923-100310945 CATAATTATTAAATGGCGTCAGG - Intronic
1112924476 13:104657074-104657096 CAGAATTTGTATATGAAATAAGG - Intergenic
1113344299 13:109459100-109459122 CATAATTTTTAAATACAATACGG + Intergenic
1114503405 14:23189254-23189276 CAGATTTAGTAAATGGAGCATGG - Intronic
1114985422 14:28221395-28221417 CAGAATTATTGAAATGAAGATGG - Intergenic
1115092290 14:29592216-29592238 CATAATGATGAAATGAAATATGG + Intronic
1115626734 14:35200926-35200948 CAAAATGATTAAATGTAATATGG - Intronic
1115825818 14:37273162-37273184 CATAACTATTAAGTGAAATAGGG + Intronic
1115947596 14:38679693-38679715 CAGAATGATAAAATGAACTATGG - Intergenic
1116401114 14:44508383-44508405 CATAATTATTATTTGGCATATGG - Intergenic
1116515866 14:45804326-45804348 CAGAATTTTCAAGTAGAATAGGG + Intergenic
1116601006 14:46922542-46922564 CATATTTATTAAAAAGAATAAGG + Intronic
1116732545 14:48642776-48642798 AAGAAAAATTAAATTGAATATGG + Intergenic
1117105672 14:52395073-52395095 CATAAATATAAAATGAAATAAGG - Intergenic
1120028825 14:79616505-79616527 AAGAATTTAAAAATGGAATAAGG + Intronic
1120118237 14:80645443-80645465 GATAATTATTATATGGAGTAGGG + Intronic
1121116985 14:91350778-91350800 CAGAATTACTCTATGGAATATGG - Intronic
1121710898 14:96038828-96038850 CCGAATAATTAAATGAGATAGGG - Intergenic
1122163744 14:99805438-99805460 GAGAATAAGTAAATAGAATATGG - Intronic
1202844700 14_GL000009v2_random:157969-157991 CAGAAATATTAATTGGAAAAAGG - Intergenic
1202845191 14_GL000009v2_random:165363-165385 CAGAAATATAAAATGTTATAGGG + Intergenic
1202914097 14_GL000194v1_random:148214-148236 CAGAAATATTAATTGGAAAAAGG - Intergenic
1202914589 14_GL000194v1_random:155632-155654 CAGAAATATAAAATGTTATAGGG + Intergenic
1202875601 14_GL000225v1_random:205861-205883 CAGAAATATAAAATGTTATAGGG - Intergenic
1202878079 14_KI270722v1_random:27079-27101 CAGAAATATAAAATGTTATACGG - Intergenic
1202878572 14_KI270722v1_random:34485-34507 CAGAAATATTAATTGGAAAAAGG + Intergenic
1126962497 15:54013286-54013308 CAGAATCATTAAATGAACTAAGG + Exonic
1127803642 15:62498829-62498851 AAAAATTATTAAAAGGAATTTGG + Intronic
1127887696 15:63217319-63217341 TAAAAATATTGAATGGAATATGG + Intronic
1128001904 15:64200706-64200728 CAAAATTATTAACAGAAATAGGG - Intronic
1128332807 15:66766852-66766874 CAGAATTATGAACTGGATCATGG + Intronic
1129085996 15:73092971-73092993 CATAACAATTAAATGTAATATGG - Intronic
1130230037 15:82089814-82089836 CGGAATGATTAAATAAAATATGG - Intergenic
1131932578 15:97460723-97460745 TACAATTATTAAATGTAAGATGG - Intergenic
1133576676 16:7098115-7098137 CACAATTAGTTAATGGAAGATGG + Intronic
1134126239 16:11618165-11618187 CAGAATAAATAAATGGGTTATGG - Intronic
1135507845 16:23054248-23054270 CAGGATAATTAAATGCAATGTGG + Intergenic
1138801946 16:60043500-60043522 CACAATTATTGAGTGGAAGAGGG + Intergenic
1139763992 16:69211338-69211360 AAGAATTATTAAATGGTATTAGG - Intronic
1143467759 17:7149354-7149376 GTGAGTTATTAAATGTAATAGGG - Intergenic
1143735197 17:8906899-8906921 AAGATTTATTAAATGGCTTAGGG - Intronic
1144179698 17:12740345-12740367 AAGAATTATGTAATGGAATTTGG - Intronic
1144509833 17:15866574-15866596 AAGAATTCTTAAAAGCAATAAGG - Intergenic
1145173943 17:20684217-20684239 AAGAATTCTTAAAAGCAATAAGG - Intergenic
1146736281 17:35242018-35242040 CAGAATTGTAAACTGGAAGAAGG + Intergenic
1146840339 17:36148225-36148247 AAGAATTAGTAAATAAAATATGG - Intergenic
1146917932 17:36690068-36690090 CAGGATTTATAAATGGAATGAGG + Intergenic
1147355219 17:39890389-39890411 AGGAATTATTAAATGTAACAAGG + Intergenic
1148288904 17:46423656-46423678 CAGAACAACTAAATGCAATATGG - Intergenic
1148311073 17:46641233-46641255 CAGAACAACTAAATGCAATATGG - Intronic
1148884108 17:50759113-50759135 CAGAGTTATTAACTAGAATTTGG + Intergenic
1149455239 17:56782456-56782478 CAGAATTTGTAAATGGATAAAGG + Intergenic
1150214284 17:63457986-63458008 TAGAATAAATAAATGGACTAGGG + Intergenic
1151084251 17:71363015-71363037 AACAATTGTTAAATGGAATGAGG - Intergenic
1203169496 17_GL000205v2_random:135017-135039 CAGGATTGTTAGATGGAACAAGG + Intergenic
1153105917 18:1526462-1526484 CTGAATGATAAAATTGAATATGG + Intergenic
1155069389 18:22300510-22300532 CAGTATTTTCAAATGGAATTTGG + Intergenic
1155843137 18:30670657-30670679 CAGATTTACTCAATGGAATTTGG + Intergenic
1156203094 18:34856370-34856392 CAGAGTCATTAAATGAAATGAGG - Intronic
1156819105 18:41350106-41350128 CACCATTATTAAATGAAAGACGG + Intergenic
1157096736 18:44692373-44692395 CACAATTACTAAGTGGAAAAGGG + Intronic
1158791076 18:60781362-60781384 CAGAATATTTAAATGACATATGG - Intergenic
1159270493 18:66143023-66143045 AAGAAATATTAAATTGAAAATGG + Intergenic
1159647754 18:70939879-70939901 CAGTCTTATCAAATGGAATACGG + Intergenic
1159747361 18:72254518-72254540 CAGGATTTTTAAATTGAAGAAGG + Intergenic
1160253432 18:77224814-77224836 CAGTTTAATAAAATGGAATACGG - Intergenic
1160334199 18:78022777-78022799 CAAAATTATAAAATGGGATTTGG + Intergenic
1162132078 19:8532490-8532512 TAGAATGATTAACTGGAATAGGG + Intronic
1165109877 19:33496060-33496082 GAGACTTATTAAAAGGAACAGGG + Intronic
1202654194 1_KI270708v1_random:3533-3555 CAGAAATATTAATTGGAAAAAGG + Intergenic
1202672599 1_KI270710v1_random:5850-5872 CAGAAATATAAAATGTTATAGGG + Intergenic
925495043 2:4437963-4437985 AAGAAATATTAAAGAGAATATGG - Intergenic
925659381 2:6186128-6186150 CAGAATATTAAAATTGAATAAGG + Intergenic
925835101 2:7937030-7937052 CAGAATTAATAAACAGTATATGG + Intergenic
925957896 2:8986272-8986294 CACAATGACTAAATGTAATATGG + Intronic
926687092 2:15706403-15706425 CAGACTTATTAAATAGATTACGG + Intronic
926787507 2:16532616-16532638 CAGACTTGTGAAAGGGAATAAGG + Intergenic
927038277 2:19203295-19203317 CAGGATTATGAAATGGGAAAAGG - Intergenic
927628145 2:24745785-24745807 CAGAACTATAAAAGGGAACATGG - Intronic
930361112 2:50381120-50381142 CAGAATGAATGAATGGAACATGG + Intronic
932020617 2:68082402-68082424 CATAATTAATAAATTGATTAGGG - Intronic
932603608 2:73147802-73147824 CATAATTACTAAATGCAATATGG + Intronic
932831017 2:74990423-74990445 CAGAATTAAGGAATGCAATAGGG + Intergenic
932981203 2:76669562-76669584 CAGAATTATTACATTGATTACGG - Intergenic
933017758 2:77151351-77151373 TAGAATTAGTAAATACAATAGGG - Intronic
936266063 2:111008041-111008063 CACATTTACTAACTGGAATACGG + Intronic
938016251 2:127869830-127869852 CATGTTTATTTAATGGAATAGGG - Intronic
938952534 2:136268503-136268525 CTAGCTTATTAAATGGAATAAGG + Intergenic
939115061 2:138051150-138051172 CAGAATTATTAAAAGAAAGTTGG - Intergenic
939708532 2:145485357-145485379 CAAAATTATTCAATTGATTAAGG - Intergenic
939715037 2:145573043-145573065 CAGAATTTTTTAATGTAATAAGG - Intergenic
940815490 2:158293170-158293192 CAGATATAATAAATGTAATATGG + Intronic
940843874 2:158618460-158618482 CATAATATTTAAAAGGAATATGG + Intronic
941112913 2:161436476-161436498 CAGAATTAAAATATGGTATATGG - Intronic
941318852 2:164029905-164029927 CAGAATACTTAAATGGAACTGGG - Intergenic
941372850 2:164688395-164688417 AATATTTCTTAAATGGAATATGG + Intronic
941571696 2:167177932-167177954 GAGACTAACTAAATGGAATATGG + Intronic
941878177 2:170456043-170456065 CAGATGTATTAACGGGAATAGGG + Intronic
941885927 2:170527259-170527281 AAGAACTATTACAGGGAATAAGG + Intronic
942012500 2:171776874-171776896 AAGAAATATTAAATGCTATAGGG + Intergenic
942383526 2:175418600-175418622 CAGAATGACTAAATGAAATTTGG - Intergenic
942835576 2:180293136-180293158 CAGAACAATTAAATGTAATGTGG - Intergenic
943269427 2:185779745-185779767 AAGAAGTATTAAATGCAAGAAGG - Intronic
943774399 2:191749866-191749888 CAGAATTTTGAACTAGAATATGG + Intergenic
943809476 2:192166398-192166420 CAGAATTATGTAATGGAAAATGG + Intronic
944191611 2:197009943-197009965 CAGTATGATTATATGGAATTGGG - Intronic
944359617 2:198837788-198837810 CTGAATTATTGAATGCAAGAAGG + Intergenic
944377639 2:199065838-199065860 CTGAATTATTAAATGGTTCATGG - Intergenic
944477479 2:200122367-200122389 CAGAATCAAAAAATGGAATGAGG - Intergenic
945130690 2:206568498-206568520 CAGGACTATTATATAGAATATGG + Intronic
945394681 2:209304199-209304221 CTGAAAAACTAAATGGAATAAGG - Intergenic
945909228 2:215628270-215628292 CACAATAATTAAATGTAATGTGG + Intergenic
948233281 2:236367335-236367357 CAGAAGTAGTAAATGGAATTTGG - Intronic
1169167843 20:3439900-3439922 CAGGATGAATAAATGCAATATGG + Intergenic
1169764919 20:9138744-9138766 TAGAATAATTAGAAGGAATAAGG - Intronic
1170466265 20:16625211-16625233 GAGAATTATTAATTGTATTAAGG - Intergenic
1171159900 20:22912066-22912088 GATAATTATTAAATGCAATAGGG - Intergenic
1172359823 20:34304131-34304153 CAGAACTATTTAATGATATACGG - Intronic
1174512506 20:51064800-51064822 CAGACTGATTGAATGAAATATGG - Intergenic
1174714175 20:52739094-52739116 CAGAATTTTTAATTTGTATAAGG + Intergenic
1176402259 21:6324132-6324154 CAGGATTGTTAGATGGAACAAGG - Intergenic
1176434898 21:6664972-6664994 CAGGATTGTTAGATGGAACAAGG + Intergenic
1176459160 21:6992042-6992064 CAGGATTGTTAGATGGAACAAGG + Intergenic
1176633451 21:9162888-9162910 CAGAAATATTAATTGGAAAAAGG - Intergenic
1176633942 21:9170277-9170299 CAGAAATATAAAATGTTATAGGG + Intergenic
1176639374 21:9284544-9284566 CAGAAGTATAAAATGTTATAGGG - Intergenic
1176639876 21:9291926-9291948 CAGAAATATTAATTGGAAAAAGG + Intergenic
1177097088 21:16849378-16849400 CAGAATTCTGAATTGAAATAGGG - Intergenic
1177209055 21:18047169-18047191 CATAATAATTAAATGGAGAAGGG - Intronic
1178392583 21:32211344-32211366 CAGGATTATTAATTGGAGAAAGG + Intergenic
1178630342 21:34254048-34254070 CACAATAATTAAATGCAATGTGG - Intergenic
1179361335 21:40712139-40712161 AATAATTATTACATTGAATAAGG + Intronic
1180348890 22:11781299-11781321 CAGAAATATTAATTGGAAAAAGG + Intergenic
1180372679 22:12057374-12057396 CAGAAATATAAAATGTTATAGGG - Intergenic
1180373177 22:12064753-12064775 CAGAAATATTAATTGGAAAAAGG + Intergenic
1180389304 22:12210900-12210922 CAGAAATATTAATTGGAAAAAGG - Intergenic
1180389800 22:12218292-12218314 CAGAAATATAAAATGTTATAGGG + Intergenic
1180416634 22:12723576-12723598 CAGAAATATTAATTGGAAAAAGG + Intergenic
1180423420 22:12892033-12892055 CAGAAGTATAAAATGTTATAGGG - Intergenic
1180423923 22:12899393-12899415 CAGAAATATTAATTGGAAAAAGG + Intergenic
1182928357 22:34148951-34148973 GAGAATTATTAAATAAATTAAGG + Intergenic
949177398 3:1081747-1081769 AAGAATTATAAGATGAAATAAGG - Intergenic
949186321 3:1196244-1196266 CAGAAATATCACATGAAATATGG + Intronic
951105662 3:18739158-18739180 GAGAATTTTTAAATGGCAAAGGG - Intergenic
951332751 3:21386088-21386110 CAAAAATATGAGATGGAATATGG - Intergenic
951439003 3:22700920-22700942 CCCAATTATTAAATGGGAAAAGG + Intergenic
952357911 3:32601723-32601745 GAGAATTAATGAATGGAAAAGGG - Intergenic
952367077 3:32684560-32684582 CATAATGAATAAATGCAATATGG + Intergenic
952650387 3:35719666-35719688 CAGAATTAGTAATGGGAACAAGG + Intronic
953848590 3:46448629-46448651 CAGGATTATTATAAGGAATTTGG - Intronic
957100322 3:75818817-75818839 CAGAAATCTTAATTGGAACAAGG - Intergenic
957710257 3:83848191-83848213 GAGAATTATTACAAGGAATTGGG - Intergenic
957901007 3:86489700-86489722 CATAATTAATAAATGGATCATGG + Intergenic
959135708 3:102417210-102417232 CATCATTATTAAATGGCAGACGG + Intronic
959160145 3:102713636-102713658 CAGATTAATTAAGTAGAATAAGG - Intergenic
961224479 3:125228439-125228461 AATCATTATTAAATGAAATAAGG + Exonic
961425883 3:126847540-126847562 CATTATTAATAAATAGAATATGG - Intronic
961857715 3:129889378-129889400 CATAATTACTAAATGTAATGTGG + Intronic
962674226 3:137742135-137742157 CAGATTTATTAAATGTTACAAGG - Intergenic
963681269 3:148380626-148380648 AAATATCATTAAATGGAATATGG - Intergenic
965573720 3:170196904-170196926 CAAAAATATTAAATGGAAAATGG + Intergenic
965681136 3:171252886-171252908 CAGAAAATTTAAATGGAGTAGGG + Intronic
965689031 3:171335660-171335682 CATACTTATCAAATGGAAAATGG - Intronic
965719441 3:171645573-171645595 CAGAATTCTTAAAGGGCCTAGGG - Intronic
967079656 3:186037712-186037734 AAGAATTATTAACTGTAAGAGGG + Intergenic
967370409 3:188738473-188738495 CCTAATTGTTTAATGGAATATGG + Intronic
967437900 3:189471913-189471935 ATGAATTAATAAATAGAATATGG - Intergenic
967648563 3:191956941-191956963 CAGAATTTTAAAATGTAAAACGG + Intergenic
967671089 3:192236367-192236389 CACACTTATCAAATGGAATTCGG - Intronic
1202747017 3_GL000221v1_random:113103-113125 CAGAAATATTAATTGGAAAAAGG - Intergenic
1202747520 3_GL000221v1_random:120483-120505 CAGAAGTATAAAATGTTATAGGG + Intergenic
969141821 4:5081500-5081522 CAGAAATAATAGATGGACTATGG - Intronic
969337371 4:6519561-6519583 CAGAATTATCAAATGGGCAAGGG - Intronic
970255091 4:14159623-14159645 GATAATTGTTAAATGGAAAAAGG - Intergenic
970731390 4:19107803-19107825 AAGAGTTATTAAATAGAAGAGGG + Intergenic
970775187 4:19666108-19666130 CAAAATTATTAAATGCAGTCAGG + Intergenic
970780065 4:19726476-19726498 AAGAATTAAGATATGGAATAAGG + Intergenic
971142872 4:23944002-23944024 CATAATGATTAAATGAAATGTGG + Intergenic
971372757 4:26031444-26031466 AATAATAATTAAATCGAATATGG + Intergenic
971527152 4:27635228-27635250 TAAAATTATAAAATGGAATATGG + Intergenic
971658570 4:29382728-29382750 CAGATTTAATAAATGGCTTAAGG - Intergenic
971861980 4:32119623-32119645 GAGTATTATTAAATGGTTTAAGG + Intergenic
973268074 4:48231332-48231354 CAAAATTTTAATATGGAATAAGG - Intronic
973588793 4:52419698-52419720 CCCAATTATTAAATGGTAAAAGG - Intergenic
973688075 4:53395239-53395261 CAGAATTGTTTAATAGAATGAGG + Intronic
975526653 4:75358213-75358235 CAGAATAAGTAAATGGAAGTTGG - Intergenic
977347736 4:95839294-95839316 CAGAATTATTAAACAGAGTAAGG + Intergenic
977361370 4:96010603-96010625 GAGAATGATTAGATGGAAGAAGG + Intergenic
977436660 4:97005307-97005329 CACAATGATTAAATGCAATGTGG - Intergenic
977447655 4:97151405-97151427 CACAATTTTTAAAAGGAAGAAGG + Intergenic
977447708 4:97152084-97152106 CACAATTTTTAAAAGGAAGAAGG - Intergenic
977870639 4:102086355-102086377 GAGAATTTTTAAATGAAATAAGG - Intergenic
979225280 4:118278062-118278084 CATAATGATTAAATGTAATGTGG - Intergenic
979602523 4:122602224-122602246 CACAAAGATAAAATGGAATAAGG - Intergenic
980179151 4:129383057-129383079 CAGCCATGTTAAATGGAATATGG - Intergenic
980446170 4:132910846-132910868 CAGAATTATTTAATGTACCATGG + Intergenic
981744784 4:148042154-148042176 TAGAATCATTAACTGAAATAGGG - Intronic
981899253 4:149843079-149843101 GAGGATTAGTACATGGAATATGG - Intergenic
982240733 4:153296856-153296878 CTGCATTGTTAAATGGAAGAGGG - Intronic
982844904 4:160238574-160238596 CAGAATAATTTACTGAAATAGGG - Intergenic
983151235 4:164283944-164283966 GAGAATTATTAAATGTCAAATGG + Intronic
983702909 4:170620936-170620958 GAAAATTATTAATTGAAATATGG - Intergenic
984181584 4:176489639-176489661 CACAAATATTAAATGCAAAATGG - Intergenic
984332260 4:178339329-178339351 CACCATAATTCAATGGAATAAGG - Intergenic
984487008 4:180383273-180383295 TAGTTTTATTAAATGGAAAATGG + Intergenic
984687461 4:182686959-182686981 CAGGACTATTAACTGGAAGAGGG - Intronic
984949747 4:184998498-184998520 CTGAATTAGAAAATGGAAAAAGG - Intergenic
1202754266 4_GL000008v2_random:42935-42957 CAGAAATATAAAATGTTATAGGG - Intergenic
1202754768 4_GL000008v2_random:50315-50337 CAGAAATATTAATTGGAAAAAGG + Intergenic
986880920 5:12170211-12170233 CAGAAATATTAATTAGAAAATGG - Intergenic
987214505 5:15719562-15719584 CACAATTCTTAAATGGATGATGG - Intronic
987841185 5:23224553-23224575 CAGATTTATTATATGTAATTTGG - Intergenic
988017837 5:25582386-25582408 CAGAATTATATAATGGACTTTGG - Intergenic
988335321 5:29900066-29900088 CAGAATCATAAAATGAAATATGG - Intergenic
988383907 5:30536966-30536988 CAGAATTATTAACAGAAAGAGGG - Intergenic
989182190 5:38589602-38589624 TACTATTATTTAATGGAATAAGG - Intronic
992064468 5:73093171-73093193 CAATATTATTAAATGGTAAAAGG + Intergenic
992671341 5:79063979-79064001 CAGAATCATTATATGGAATGGGG - Intronic
992917593 5:81474249-81474271 TAGAATTATTAATTAAAATATGG + Intronic
992975713 5:82117256-82117278 AAGAATTAGGAAATGGAATGAGG + Intronic
993076454 5:83238151-83238173 CAGAATTATTGAATACCATAAGG - Intronic
993230547 5:85229786-85229808 CAGAAATGATAAAAGGAATAGGG - Intergenic
994732044 5:103503731-103503753 CTGAATTTTTAAAAGGAATCTGG - Intergenic
995514384 5:112939521-112939543 CAGGAATTTTAAATGAAATATGG + Intergenic
995579945 5:113588103-113588125 TAGAATTAATAAATGAAATAAGG - Intronic
995868539 5:116719586-116719608 CACAGTTAAGAAATGGAATATGG + Intergenic
996211085 5:120811552-120811574 TAGAATTATTTAATGTACTATGG + Intergenic
996679045 5:126210250-126210272 CAAAAATTTTAAATGCAATAAGG + Intergenic
997047586 5:130337466-130337488 CTGTATTATTAAACAGAATAAGG + Intergenic
997152256 5:131510713-131510735 CAGAATCAGTAAATGTAAAATGG + Intronic
998569237 5:143242614-143242636 CATAACTATTTAAGGGAATAGGG + Intergenic
998578721 5:143346892-143346914 CAGAAATAGTGAATGGTATAAGG + Intronic
998603271 5:143606606-143606628 CTGAAGTATGAAAGGGAATATGG - Intergenic
998993632 5:147846731-147846753 AAGAAATGATAAATGGAATATGG + Intergenic
999052300 5:148535688-148535710 CAAAATAATTAAAAGGAATAAGG + Intronic
1000961332 5:167604814-167604836 CAGAACTATTAAGTGGTATAAGG + Intronic
1001868423 5:175126976-175126998 AATAATTATCAAAGGGAATATGG + Intergenic
1002404138 5:179015950-179015972 CACAATAACTAAATGGAATGTGG - Intergenic
1003401277 6:5793167-5793189 CAGACTTATTAAAATGGATAAGG - Intergenic
1003809209 6:9760876-9760898 CAGAATTATTTTGTGCAATACGG - Intronic
1003819475 6:9879749-9879771 AAGAAGTATTAAAAAGAATAAGG + Intronic
1005519538 6:26587246-26587268 CAAAATAATTCAATGGAAAAAGG - Intergenic
1006318229 6:33303598-33303620 CAGAATTATTAGATTAAATAAGG + Exonic
1006568483 6:34980337-34980359 AAAAATTTTTAAATGAAATAAGG - Intronic
1006968789 6:38018464-38018486 CAGAATTTTTAAAAGGTATAAGG + Intronic
1008648436 6:53540154-53540176 TTAAAATATTAAATGGAATAGGG - Intronic
1009491372 6:64296460-64296482 AAGAATTAATAAAGGAAATAAGG + Intronic
1010068925 6:71720239-71720261 CAGGATCACTAAATGTAATATGG + Intergenic
1010130722 6:72490522-72490544 CAAAATAATTAAAAGAAATATGG + Intergenic
1010445509 6:75944434-75944456 CAGAATTAGTAAGTCAAATATGG - Intronic
1011800895 6:91015248-91015270 AAAAATTATTAAATGAAATAAGG - Intergenic
1015122817 6:129719693-129719715 CCAAATTATTAAATAGAATTAGG - Intergenic
1016180884 6:141147052-141147074 CATGATAACTAAATGGAATATGG - Intergenic
1016539311 6:145145633-145145655 CAGAATTTTTATATGTATTAGGG + Intergenic
1016694007 6:146971885-146971907 CAGAAATATCAAATCTAATAAGG - Intergenic
1016707579 6:147129473-147129495 CAAAATGATTAAATGAATTATGG + Intergenic
1016790888 6:148065501-148065523 AAGAATTATTAAATTGAAATGGG - Intergenic
1019098052 6:169602453-169602475 GAGAATTATTAAATGGTTAATGG + Intronic
1020028846 7:4919152-4919174 CAGAATTATTAGAAAGATTAGGG + Intronic
1021029313 7:15710357-15710379 CAGAATTTTGAAATGGTCTACGG - Intergenic
1021034160 7:15775966-15775988 GGAAATTATTAAATGGAAAAAGG - Intergenic
1022972018 7:35527222-35527244 AGGCATTATTAAATGAAATAAGG + Intergenic
1023422253 7:39993265-39993287 TAGAATGATTAAATGGGATATGG - Intronic
1024439650 7:49401686-49401708 CAGGAAGATTAAATGCAATATGG + Intergenic
1024809791 7:53195283-53195305 CAAAATGTTTACATGGAATATGG + Intergenic
1024894077 7:54237002-54237024 CAGAATGATAAAATGGACTTTGG + Intergenic
1025159520 7:56642451-56642473 GAAAATTATTAAATTGAAAAGGG - Intergenic
1025269159 7:57492889-57492911 CGGAATCATTGAATGGAATCGGG + Intergenic
1026436710 7:70405620-70405642 CAAAAGTGTGAAATGGAATAAGG + Intronic
1026641003 7:72125568-72125590 CAGAATTATAGGATGGACTAAGG + Intronic
1027561562 7:79738490-79738512 CATAAATTTTAAATGGAAAATGG + Intergenic
1027659378 7:80970823-80970845 AAGAATTATTAAATATAATGAGG + Intergenic
1027743487 7:82042387-82042409 CAGAACTTTGAAATGGTATATGG + Intronic
1028363995 7:90005759-90005781 CAATATTATTAAATGAAATAGGG - Intergenic
1028729178 7:94125670-94125692 CAGGAAGATTAAATGGAATCTGG - Intergenic
1029013153 7:97283659-97283681 CAGAATTATTCACTGTAACAGGG - Intergenic
1029369530 7:100139627-100139649 CAGACTTATTAGATGAACTAAGG - Intergenic
1029885056 7:103860338-103860360 GCCAATTATTATATGGAATAAGG + Intronic
1029887585 7:103889461-103889483 CAGAAGTATAAAATTGTATATGG - Intronic
1029938050 7:104449532-104449554 CAGAGTTACTAAATGCAACAAGG - Intronic
1030711295 7:112753062-112753084 CATAACTATTAAATGAAATTAGG - Intergenic
1031189950 7:118536037-118536059 AATAAATATTAAATAGAATAAGG - Intergenic
1031232019 7:119119849-119119871 AAGAATGATAAAATGGAATTTGG - Intergenic
1031766857 7:125789595-125789617 CAGCCTCATTACATGGAATAAGG + Intergenic
1031822904 7:126526981-126527003 CAGAACTATTTAATGTATTACGG - Intronic
1032241908 7:130168510-130168532 CATATATATTAGATGGAATATGG - Intronic
1032512906 7:132486312-132486334 CAGAATTATTACAAGGAAAGGGG + Intronic
1032567816 7:132966210-132966232 CAGAATTACCAAATGAAGTAAGG - Intronic
1033333584 7:140434612-140434634 TAGAATTTTTAAATGGAATAAGG - Intergenic
1033466786 7:141598552-141598574 AAAAATTATTATGTGGAATAGGG + Intronic
1036916126 8:12805795-12805817 AAAAAATATTAAATGGAAAAGGG - Intergenic
1037155459 8:15694110-15694132 CAGAAATACAATATGGAATATGG - Intronic
1037202972 8:16280769-16280791 CATATTTATGAAATAGAATATGG - Intronic
1037564342 8:20104901-20104923 AAGAATTATTCATTGGAAAAAGG - Intergenic
1037781286 8:21870951-21870973 AAGAATGATTAAAAGCAATAAGG + Intergenic
1038597834 8:28905708-28905730 CAGAGTTGTTAAATAGGATAAGG - Intronic
1038651351 8:29406732-29406754 CAGAATTATTATGTGGAAGAGGG - Intergenic
1038988328 8:32837776-32837798 AAGGATTTTAAAATGGAATAAGG - Intergenic
1039737687 8:40350083-40350105 TAGCATTATTAAATAAAATAAGG + Intergenic
1040662447 8:49590795-49590817 CTGATTTATAAAATGTAATATGG + Intergenic
1040960744 8:53029764-53029786 CAGAATGATATAATGGAATTTGG - Intergenic
1041185716 8:55298872-55298894 CTGAATTATTAAAGGGTAAATGG - Intronic
1041616693 8:59915618-59915640 CAGAAATATTCATTGCAATAGGG - Intergenic
1041811137 8:61911528-61911550 TAGGGTTATTAAATGTAATATGG + Intergenic
1042170772 8:65988938-65988960 CAAAAATATTAAATGAGATAAGG + Intergenic
1042435440 8:68759122-68759144 TAGAATGATTAAGAGGAATATGG - Intronic
1042603260 8:70520493-70520515 CATAACTATTAAATGCTATATGG + Intergenic
1042749472 8:72142331-72142353 CAGAATTTTTAAACTGAAAATGG + Intergenic
1043089501 8:75879914-75879936 CAAAACTATTAAATGGAATGGGG + Intergenic
1043242636 8:77955024-77955046 TATAATTATTAAAAAGAATATGG - Intergenic
1043262732 8:78222120-78222142 TAGAAAAATTAAAAGGAATAGGG + Intergenic
1043293632 8:78636687-78636709 CAGAGTGACTAAATGGTATATGG - Intergenic
1044036265 8:87307388-87307410 CAGATTTGTAAAATGGAATCTGG + Intronic
1045614672 8:103895940-103895962 CACAAACATTAAATGGCATAAGG - Intronic
1046118553 8:109815473-109815495 CAGAAGTTTTGGATGGAATAAGG + Intergenic
1046183126 8:110678570-110678592 GAGAATTTTTAAATGTAATTGGG - Intergenic
1046755858 8:117972193-117972215 CAGAAAAATGAAATGGAATTGGG + Intronic
1047194508 8:122709291-122709313 CACAATTATCATATAGAATATGG - Intergenic
1047988560 8:130261934-130261956 CAGAATGAACAAAAGGAATATGG + Intronic
1048487487 8:134862194-134862216 CAGACTTATTAATGGGAAGATGG + Intergenic
1049515880 8:143055128-143055150 CAGCACTATTAAAGGGAGTAGGG - Intronic
1050912854 9:11095852-11095874 CAGCATCATTAATTGAAATAAGG - Intergenic
1050963020 9:11761508-11761530 CATAATTATTAAATAAATTAGGG - Intergenic
1050985892 9:12081565-12081587 CATGATAATTAAATGCAATATGG + Intergenic
1051610247 9:18954645-18954667 CAGAATTTTTAAATTGAAAGGGG + Intronic
1051774182 9:20616680-20616702 AAGAATAATTAAGTGAAATAAGG - Intronic
1051859253 9:21605874-21605896 CAGAATGATTTAATGCCATATGG + Intergenic
1052015973 9:23467500-23467522 CAAAATTCTTAAATAGAAGATGG - Intergenic
1052122008 9:24729716-24729738 CAGAATTTTATAATGGAATAAGG + Intergenic
1052617979 9:30867529-30867551 TAGAATGAATAAATGTAATAGGG - Intergenic
1053603883 9:39637412-39637434 CAGAACAATTAAAAGGACTAAGG + Intergenic
1053861700 9:42393459-42393481 CAGAACAATTAAAAGGACTAAGG + Intergenic
1054249658 9:62705002-62705024 CAGAACAATTAAAAGGACTAAGG - Intergenic
1054563768 9:66739534-66739556 CAGAACAATTAAAAGGACTAAGG - Intergenic
1055944989 9:81685701-81685723 CAGTATTATGAAATGTCATATGG - Exonic
1056010102 9:82320011-82320033 AAGAATCACTACATGGAATAAGG - Intergenic
1057332824 9:94131568-94131590 CAGAATGAATAAATGTAATGTGG + Intergenic
1057593109 9:96391102-96391124 AAGAATTATATAATGGAATCTGG - Intronic
1058290073 9:103229753-103229775 CAGAACTATTAAATAGATTAAGG + Intergenic
1058501468 9:105622998-105623020 CAATATTTTTAAATGGAATTTGG - Intronic
1059369767 9:113818128-113818150 CAGAATTTTAAAATGCAGTAGGG + Intergenic
1059609706 9:115879244-115879266 GAGAATTATTAAAAGGAAAAAGG + Intergenic
1060687854 9:125627942-125627964 GAGAATTATAAAATGGTACAAGG - Intronic
1203436638 Un_GL000195v1:143675-143697 CAGGATTGTTAGATGGAACAAGG - Intergenic
1203756291 Un_GL000218v1:130514-130536 CAGAAATATTAATTGGAAAAAGG - Intergenic
1203715653 Un_KI270742v1:143190-143212 CAGAAATATTAATTGGAAAAAGG - Intergenic
1203716156 Un_KI270742v1:150574-150596 CAGAAGTATAAAATGTTATAGGG + Intergenic
1203535058 Un_KI270743v1:27662-27684 CAGAAATATAAAATGTTATAGGG - Intergenic
1203535562 Un_KI270743v1:35036-35058 CAGAAATATTAATTGGAAAAAGG + Intergenic
1203649907 Un_KI270751v1:106754-106776 CAGAAATATTAATTGGAAAAAGG - Intergenic
1203650393 Un_KI270751v1:114144-114166 CAGAAATATAAAATGTTATAGGG + Intergenic
1185713409 X:2322145-2322167 AAGAATGATAAAATGGAATTTGG - Intronic
1185878732 X:3721537-3721559 CAGAAGTATTAAATTGAAATTGG + Intergenic
1186503993 X:10075434-10075456 CAGAGCTATTAAATAGCATATGG - Intronic
1186930179 X:14380673-14380695 CAGAAGTAATAAATGCCATATGG - Intergenic
1187323233 X:18260771-18260793 CAGAATTATTGTATGTAATATGG - Intronic
1187444571 X:19349921-19349943 CACATTTCTGAAATGGAATAAGG - Exonic
1187751352 X:22469102-22469124 CAGCTTTAATAAATGGAATGAGG + Intergenic
1188141239 X:26554521-26554543 CAGAATTATCCTATAGAATATGG - Intergenic
1188316949 X:28687181-28687203 AAGAAAAATAAAATGGAATATGG - Intronic
1188363152 X:29281738-29281760 AATAATTATTAAATGTAACAGGG + Intronic
1189059145 X:37734207-37734229 CACAATTGTTAACTGGAGTATGG - Intronic
1189460070 X:41233909-41233931 CAAAATATTTAAATAGAATAGGG - Exonic
1189595203 X:42557352-42557374 CACAATTTTTAAGTGGCATATGG + Intergenic
1189711618 X:43818882-43818904 CATAATTATAACATGGCATATGG + Intronic
1190468116 X:50747698-50747720 CAAAGAGATTAAATGGAATAGGG + Intronic
1191674614 X:63781817-63781839 AAGAATTAGTACATGGAAGAAGG - Intronic
1192600560 X:72459270-72459292 CATAATTGTTAAATGAAACAAGG + Intronic
1193958132 X:87888110-87888132 CACAATTATTAAATGCAATGTGG + Intergenic
1194178024 X:90676148-90676170 CAAAATGATTAAAGTGAATATGG + Intergenic
1194411896 X:93567780-93567802 AAGAATAATGAAATGGAATTTGG - Intergenic
1194579727 X:95657026-95657048 CAGAGTGATTAAATGGTATGTGG - Intergenic
1196024958 X:111032505-111032527 AAGAATGGTTAAATGCAATATGG - Intronic
1197163577 X:123350918-123350940 CAGATATATTAAATGTAATAAGG - Intronic
1197307025 X:124855230-124855252 CATAATTCTTAATTGAAATAAGG + Intronic
1198749624 X:139925789-139925811 CATATGTATTTAATGGAATATGG - Intronic
1199096990 X:143755209-143755231 CAGAATTGTTGAATGAAAGATGG + Intergenic
1199484554 X:148333715-148333737 CACCATTATTTATTGGAATAGGG + Intergenic
1199835484 X:151585969-151585991 CAGAATTCTTACATGGCTTAGGG + Intronic
1200524691 Y:4258305-4258327 CAAAATGATTAAAGTGAATATGG + Intergenic
1200898902 Y:8407632-8407654 CAGAGTTAATAAATGGGATATGG + Intergenic
1201169880 Y:11248138-11248160 CAGAAATATTAATTGGAAAAAGG - Intergenic
1201170361 Y:11255535-11255557 CAGAAATATAAAATGTTATAGGG + Intergenic
1201950073 Y:19554111-19554133 AAGAAATATTTAAAGGAATATGG - Intergenic
1202246782 Y:22828435-22828457 CACAATTATTAACTGGGATTGGG + Intergenic
1202249118 Y:22851709-22851731 CAGAATCAGTAAATAGGATATGG + Intergenic
1202399771 Y:24462183-24462205 CACAATTATTAACTGGGATTGGG + Intergenic
1202402106 Y:24485457-24485479 CAGAATCAGTAAATAGGATATGG + Intergenic
1202468676 Y:25184626-25184648 CAGAATCAGTAAATAGGATATGG - Intergenic
1202471009 Y:25207903-25207925 CACAATTATTAACTGGGATTGGG - Intergenic