ID: 924656586

View in Genome Browser
Species Human (GRCh38)
Location 1:245978093-245978115
Sequence TTGTAGGAGCTGAGTGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924656581_924656586 25 Left 924656581 1:245978045-245978067 CCTGTCAGCTGTCGTTTATCATC 0: 1
1: 0
2: 0
3: 8
4: 63
Right 924656586 1:245978093-245978115 TTGTAGGAGCTGAGTGAACATGG 0: 1
1: 0
2: 0
3: 23
4: 257
924656583_924656586 -6 Left 924656583 1:245978076-245978098 CCAGCACGCCTGGCTCTTTGTAG 0: 1
1: 1
2: 5
3: 86
4: 1336
Right 924656586 1:245978093-245978115 TTGTAGGAGCTGAGTGAACATGG 0: 1
1: 0
2: 0
3: 23
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924656586 Original CRISPR TTGTAGGAGCTGAGTGAACA TGG Intronic
900212351 1:1462345-1462367 CTGTGGGTGCTGAGTGGACAGGG + Intronic
900348684 1:2224618-2224640 TGGTAGGAGCTCATCGAACAAGG + Intergenic
900382149 1:2390328-2390350 TTGCAGGAGATGAGTGAGCCAGG + Intronic
903608848 1:24595170-24595192 TTGAAGGAGTTGAGTAAATATGG + Intronic
904158171 1:28502235-28502257 TTTAATGAGCTGAGTGAATATGG - Intergenic
904964455 1:34360737-34360759 TTGCAGGTGCTGTGTGGACAGGG + Intergenic
906241462 1:44244837-44244859 GTGGAGGTGCTGAGAGAACACGG - Intronic
909441283 1:75698660-75698682 TTGGACGAGCTGAGAGAAGAAGG + Intergenic
909714475 1:78691368-78691390 TTGTAGAAGCTGAGTGATGAAGG + Intergenic
910694832 1:90000956-90000978 TTGTAGTAGTGGAGTGAACAGGG + Intronic
911492740 1:98589669-98589691 TTTGACGAGCTGAGTGAAGAAGG + Intergenic
912932340 1:113975828-113975850 ATGCAGGAGCTGAGAGTACAAGG - Exonic
913058146 1:115180814-115180836 TTGTGGGGGCCGAGTGACCAGGG + Intergenic
913436624 1:118853371-118853393 TTTGACGAGCTGAGTGAAGAAGG + Intergenic
914463146 1:147903211-147903233 TTGTAGAATTTGAGTGAAAAGGG - Intergenic
915153624 1:153855971-153855993 ATGTAGGAGCTGACTGGGCACGG - Intronic
919195414 1:194278661-194278683 TTGTAGGTGCAGAGGGTACATGG - Intergenic
920838605 1:209535041-209535063 GTGTAGGGGCTGAGTGCTCAGGG + Intergenic
922967192 1:229700220-229700242 TTGTAGGAGAGGAGTGAGCTTGG + Intergenic
923308439 1:232709955-232709977 TTGAAGCATCTGAGTGAGCAGGG - Intergenic
924656586 1:245978093-245978115 TTGTAGGAGCTGAGTGAACATGG + Intronic
924938508 1:248792617-248792639 TTGTCGGAGCTTTGTTAACAAGG + Intergenic
924947002 1:248853296-248853318 TTGTGGCTGCTGTGTGAACAGGG - Intronic
1064148842 10:12846409-12846431 TTGGAGGAACTGTTTGAACATGG - Intergenic
1064383898 10:14873558-14873580 TTGTAGGGGCTGAGGCAAAATGG - Intergenic
1064761785 10:18628412-18628434 TTTGAGGAGCTGAGAGAAGAAGG + Intronic
1065457163 10:25918919-25918941 TTTTAGGATCTGTGTGATCAAGG + Intergenic
1065686912 10:28294782-28294804 GTGTAGAAGCTCAGGGAACAGGG - Intronic
1068583786 10:58773552-58773574 TTGTGGGAGCCCAGTGAAAAAGG + Intronic
1068928680 10:62566103-62566125 CTGTAGGAGATGATTGTACAGGG - Intronic
1069333258 10:67318588-67318610 TAGCTGGAGCAGAGTGAACATGG - Intronic
1074315830 10:112360816-112360838 TTGTAAGAGCTGAGAACACAAGG - Intergenic
1074703291 10:116110721-116110743 TTGTGGGTGCTTAGTGATCATGG - Intronic
1075879575 10:125839274-125839296 TTGTAGGAGAGGAGAGCACAGGG - Intronic
1075896217 10:125997360-125997382 TTGTGGGTTCTGAGTGATCAAGG + Intronic
1079782411 11:24624148-24624170 TTATACTAGCTGAGTGAACCTGG - Intronic
1081194315 11:40142583-40142605 TTGTAGGAGCCAAGTGCAAAAGG - Intronic
1082227585 11:49726306-49726328 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1082775099 11:57238447-57238469 ATGTAGGAGGTGAGTGAAAAGGG + Intergenic
1082776816 11:57251682-57251704 TTGCTGGAACTAAGTGAACATGG + Intergenic
1084100483 11:66944871-66944893 TTGTAGGTGGTGAGTGGACCTGG - Intronic
1085206558 11:74736870-74736892 GTGGAGGAGGTGAGAGAACAAGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087657413 11:100941212-100941234 TAGCTGGAGCTGAGTGCACAAGG + Intronic
1090358014 11:126153591-126153613 ATGTATGAGCTGAGTGAACTGGG + Intergenic
1090520058 11:127469540-127469562 TTGTAGGACCTTTGGGAACAAGG + Intergenic
1091563813 12:1633428-1633450 TTGAAAGAGATGTGTGAACATGG + Intronic
1092833491 12:12466805-12466827 TTGCAGGAACTTAGGGAACAGGG - Exonic
1092968430 12:13668548-13668570 CTCTTGGAGCTCAGTGAACAAGG + Intronic
1093375027 12:18415487-18415509 TTGTAGGGTCTCAGGGAACAGGG - Intronic
1094769843 12:33642626-33642648 TTGGATAAGCTGAGTGAAGATGG + Intergenic
1097358029 12:58623983-58624005 ATGTAAAAGCTAAGTGAACAAGG - Intronic
1097393231 12:59041061-59041083 TTGTAGGAGGTGAGGGAAACTGG - Intergenic
1098186442 12:67901224-67901246 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1098400538 12:70070687-70070709 TTTTAGCAGCTGAGTGGTCAGGG + Intergenic
1098767457 12:74508506-74508528 TTTGAGGAGCTGAGAGAAGAAGG - Intergenic
1099219463 12:79895898-79895920 TTGTAGGAGCTCAGAGATTAGGG + Intronic
1102247945 12:111367087-111367109 TGGCTGGAGCTGAGTGAACAAGG - Intronic
1104690389 12:130821301-130821323 TTGTAAGAGCAGAGTGAAATAGG - Intronic
1105744563 13:23364728-23364750 TTGAAGGAGAGGAGAGAACAAGG - Intronic
1106916825 13:34524711-34524733 TTGTAGGAGTTGGGTGAGGAGGG - Intergenic
1108586188 13:51871875-51871897 TTCTGGGAGCTGAGTGAGGAAGG - Intergenic
1113521975 13:110947733-110947755 GTGGTGGAGCTGTGTGAACAGGG + Intergenic
1113864217 13:113510595-113510617 TTGGAGGAGCTGAGTTCACAGGG - Intronic
1117279220 14:54220841-54220863 TTGTAGGTGTTCAATGAACAAGG + Intergenic
1117328406 14:54689528-54689550 TTGAATGAGCTGTGTGAACTTGG - Intronic
1117936707 14:60914848-60914870 TTGGGAGAGCAGAGTGAACATGG + Intronic
1118431681 14:65725427-65725449 TTATAGGATCTGAGTAAACCTGG + Intronic
1119110450 14:71968711-71968733 TTGTTGGAGCTGAGTAGCCATGG + Intronic
1119364610 14:74080946-74080968 TTGCAGGAGCATAGAGAACAGGG - Intronic
1120571564 14:86124163-86124185 TTGTAGAAGCTGAGTGAGAAAGG + Intergenic
1122575081 14:102737055-102737077 GTGTAGGAGCTGAGTGACCCTGG - Intergenic
1123083927 14:105708763-105708785 GTGCAGGAGCTGTGTGACCATGG - Intergenic
1125546893 15:40512476-40512498 CTGAAGGAGCTGAGTGATCCTGG - Intergenic
1126265054 15:46744470-46744492 TTTGAGGAGCTGAGGGAAGAAGG - Intergenic
1126661319 15:51036610-51036632 TTTAAGGAGCTGAGAGAAGAAGG - Intergenic
1129435472 15:75536639-75536661 TGGTGGGAGATGTGTGAACAGGG + Intronic
1129607753 15:77033032-77033054 TAGTAGGTGCTCAGTGAACGAGG - Intronic
1130198031 15:81798951-81798973 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1130205567 15:81871688-81871710 TTTTACGAGCTGAGAGAAGAAGG + Intergenic
1130300473 15:82676644-82676666 TTGTGGGAGAGGAGTGAAGATGG + Intronic
1131702720 15:94956977-94956999 TTGTAGTAGCTTAGGGTACAAGG - Intergenic
1131702968 15:94959728-94959750 TTGTAGTAGCTTAGGGTACAGGG - Intergenic
1131962306 15:97802601-97802623 TTGTACCAGCTGAATAAACATGG - Intergenic
1132508075 16:322468-322490 GTGCAGGAGCTGAGTTAGCATGG + Intronic
1133108104 16:3527331-3527353 ATATAGGAGCTGAGGGGACATGG + Intronic
1133853863 16:9531197-9531219 TTTTAGAAGCTCAGTGAAGATGG + Intergenic
1135828653 16:25753854-25753876 TTGTAGGTGCTGAATAAATACGG - Intronic
1135856532 16:26016355-26016377 TTTTAGAAGCTACGTGAACAGGG + Intronic
1137669994 16:50273265-50273287 TTGGAGGAGCTGTGTGACCTTGG - Intronic
1141222267 16:82082061-82082083 TTGAAGGAGCTCAGGGAAAAAGG - Intronic
1141678313 16:85529364-85529386 GTGTAGGAGCTAAGAAAACATGG - Intergenic
1143057951 17:4176414-4176436 GTGTTTGAGCTGAGAGAACAAGG - Intronic
1143636133 17:8164500-8164522 CTGTGGGAGGTGAGTGAGCAGGG + Intergenic
1146146183 17:30418740-30418762 TTGTAAGTGCTGAATTAACATGG + Intronic
1146146274 17:30419840-30419862 TTGTAAGTGCTGAATTAACATGG + Intronic
1146224369 17:31052804-31052826 TTGTAGGAGCTGAGCACAGACGG + Intergenic
1146377367 17:32303718-32303740 TTGAAGGAGCTCAGTGAGTAGGG + Intronic
1146634513 17:34494233-34494255 TAGTGGAAGCAGAGTGAACATGG + Intergenic
1148085256 17:44990102-44990124 TTTTAGGAGCTCATTAAACAGGG - Intergenic
1151190560 17:72394891-72394913 TTGTAGGACCTGAGTGGCCCAGG - Intergenic
1151256069 17:72877673-72877695 TATTAGGAGCTGGCTGAACATGG + Intronic
1153649959 18:7231068-7231090 TTTTAGCAGCTGAGAGGACACGG + Intergenic
1153733239 18:8036738-8036760 TTGCAGGAGCTCAGGTAACAGGG - Intronic
1160424958 18:78773325-78773347 CTGTGGGAGCTGAGTGTGCAGGG - Intergenic
1162370201 19:10274099-10274121 TGGCTGGAGCTGAGTGAGCAAGG - Intronic
1163181316 19:15605952-15605974 ATATGGGAGCTGAGTGAACAAGG + Intergenic
1163462303 19:17446486-17446508 TGGTGGGAGCTGAGTGAGGATGG - Intronic
1163914838 19:20231979-20232001 TGGTAGCAGCTGTGTGAAAAGGG + Intergenic
1165398605 19:35582963-35582985 TAGTAGGTGCTCAGTAAACATGG - Intergenic
1166663211 19:44660991-44661013 CTTTAGGAGCTGTGTGAACTTGG - Intronic
1167702061 19:51054648-51054670 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1168369927 19:55823420-55823442 TTTGAGGAGCTGAGAGAAGAAGG + Intronic
925439358 2:3870536-3870558 TTGTCAGAGCTGAGAGAAGAAGG - Intergenic
928138531 2:28707371-28707393 TTCTAGCAGCTGTGTGATCATGG - Intergenic
931632407 2:64312786-64312808 ACGTAGGAGCTGAGTGGAGAAGG - Intergenic
932980023 2:76652980-76653002 TTTGAGGAGCTGAGAGAAGAAGG - Intergenic
934905296 2:98195626-98195648 TAGTAGGCTCTGAGTTAACAAGG - Intronic
935179314 2:100675881-100675903 TTGCAGGAGCTGGCTGAGCAGGG + Intergenic
939014467 2:136886107-136886129 ATGCAGGAGCAGAGTGAACATGG + Intronic
939212527 2:139195048-139195070 TTGTAGGGTCTGAGTCAAAAAGG - Intergenic
939477610 2:142706755-142706777 TGGTAGGAGCTGGATGAACAAGG - Intergenic
939678322 2:145099459-145099481 ATGTACTAGCTGAGTGAACCAGG + Intergenic
941194342 2:162429050-162429072 TTGTAGGAAATAAGTGAAAAGGG - Intronic
942244834 2:173998360-173998382 TTGAAGGAGGTGAGAGAAGATGG - Intergenic
943385664 2:187201546-187201568 TTGTCTGAGCTGACTGACCAGGG - Intergenic
943457392 2:188124527-188124549 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
943610421 2:190026752-190026774 ATGTAGGAGCTGAGTGTCAATGG + Intronic
943775673 2:191762869-191762891 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
946364681 2:219241623-219241645 TGGCTGGAGCAGAGTGAACATGG + Intronic
946721691 2:222615568-222615590 ATGTAGGAGCAGAGTAAGCATGG - Intronic
947235725 2:227938760-227938782 TGGTAGGACCTGATTGAAAAGGG - Intergenic
947718960 2:232356258-232356280 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1170482568 20:16781398-16781420 TGGTAGGTGGTGAGAGAACAAGG + Intergenic
1171989489 20:31684748-31684770 TTTGAGGGGCTTAGTGAACACGG + Intronic
1177042936 21:16135083-16135105 TTGAAGGAGTTAAGTGAACCAGG + Intergenic
1178721544 21:35014983-35015005 TGGTAGGAACTGAGGAAACAAGG + Intronic
1180127331 21:45801325-45801347 TTGTAGGAGGTGGGTAGACAAGG - Intronic
1184191136 22:42895349-42895371 TAGGAGGAGCTGAGGTAACACGG + Intronic
950179725 3:10902679-10902701 TTGCAGGAGCTTAATGAAAAGGG - Intronic
952461925 3:33536527-33536549 TGGCAGGAGCAGAGTGAACAAGG + Intronic
952742006 3:36742974-36742996 TTGCTGGAGCTGAGTGGACTCGG - Intergenic
953549444 3:43890001-43890023 TTGGAGGAGCTGAAGGAAGAAGG - Intergenic
954115575 3:48465348-48465370 TTGCAGTAGCTGAGGGAGCAGGG + Intronic
954176951 3:48852262-48852284 TTGTAGGAACTAAGTGAGCTGGG - Intergenic
955641196 3:61086938-61086960 TGGTGGGAGAGGAGTGAACAAGG - Intronic
956576692 3:70760047-70760069 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
958205605 3:90387413-90387435 TTTGAGGAGCTGAGAGAAGAAGG - Intergenic
958886964 3:99738209-99738231 TTTGAGGAGCTGAGAGAAGAAGG - Intronic
959333490 3:105035794-105035816 TTTTAGAAGCTGAGAGAGCAAGG - Intergenic
960694252 3:120380532-120380554 TTGAAGGAGGTGAGGGAACTGGG + Intergenic
961389625 3:126544616-126544638 GTGTGGGAGCTGAGTGAGCTGGG - Intronic
962682097 3:137810916-137810938 TTGTAGGGGCTGAGTAAATTGGG - Intergenic
962714070 3:138112217-138112239 ATTTAGTAGCTGAGTGAGCAGGG - Intronic
964704984 3:159608706-159608728 TTTTAGGACCTGAATGACCATGG + Intronic
966627480 3:182033878-182033900 TGCCAGGAGCTTAGTGAACAAGG - Intergenic
967437166 3:189461339-189461361 TTGTAAGAGCTGAGGAAACCAGG + Intergenic
967558039 3:190882740-190882762 GTGTAGGAGGTGAGTGAATAAGG - Intronic
969059837 4:4425832-4425854 TTCTTGGAGCTGAGTGAGCTTGG + Intronic
969185619 4:5472083-5472105 AAGTAGGAGCTGAGAGGACATGG + Intronic
970327083 4:14936990-14937012 TTCTGGGAGTTGAGTGAAAAAGG - Intergenic
970474318 4:16407377-16407399 TTTGAGGAGCTGAGAGAAGAAGG - Intergenic
970696304 4:18681527-18681549 GATTAGGAGCTGAGTGAAAATGG - Intergenic
970912220 4:21290664-21290686 TTGCCCGAGCTGAGTGAACTTGG + Intronic
971067823 4:23054564-23054586 TTGTAGCAGCTTTGTGAAGATGG + Intergenic
973871775 4:55173697-55173719 TTGTACTAGCTGTGTGAACTTGG - Intergenic
974493998 4:62603297-62603319 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
974695120 4:65357655-65357677 TTCCAGGAGCTGTGGGAACAGGG + Intronic
976249708 4:83037704-83037726 TTTTAGGAGCTGAGTAACAAAGG + Intronic
978436891 4:108695249-108695271 GTGGTGGAGTTGAGTGAACAAGG + Intergenic
980137500 4:128872856-128872878 TTGAAGAAGCTGAGGGGACAGGG + Exonic
980563292 4:134504485-134504507 TAATAGGAGCAGAATGAACAAGG + Intergenic
981331191 4:143512686-143512708 TTGTAGGCGATGAATGCACAAGG + Intergenic
981425163 4:144594630-144594652 TTGTAGGATCTGAGGGATTAAGG + Intergenic
983341346 4:166464336-166464358 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
983687893 4:170432442-170432464 TTTGACGAGCTGAGTGAAGAAGG + Intergenic
983716498 4:170787971-170787993 TTGGACGAGCTGAGAGAAGAAGG - Intergenic
983879852 4:172921014-172921036 TTGAAGGAGATGAGGGAACTAGG + Intronic
984304200 4:177966030-177966052 TTGTATGAGCTTAGTGAAAGTGG + Intronic
984307705 4:178016054-178016076 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
984910397 4:184668964-184668986 TGATAGGAGCTGAATGAAAAGGG - Intronic
985084351 4:186297588-186297610 GTGAAGGAGCTGAGTGAGCAGGG - Intergenic
985487589 5:160224-160246 GTGTGGGAGCCGTGTGAACATGG - Intronic
985744640 5:1639098-1639120 GTTTAGGAGCTGAGTGAAGCTGG + Intergenic
986253658 5:6083617-6083639 TGGCAGGAGCTGAGTGAGCCAGG - Intergenic
989312328 5:40034541-40034563 TGGTAGTAGCTGAGCGAACTTGG - Intergenic
992541734 5:77772259-77772281 TTGTTGGGGCTGAATGATCATGG - Intronic
994300002 5:98135993-98136015 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
995545982 5:113231548-113231570 CTGTAGGAACAAAGTGAACATGG - Intronic
996751633 5:126895294-126895316 TTTGAGGAGCTGAGAGAAGAAGG - Intronic
996753031 5:126908805-126908827 TTTGAGGAGCTGAGAGAAGAAGG - Intronic
997134545 5:131311928-131311950 TTTGACGAGCTGAGTGAAGAAGG - Intronic
997392532 5:133528711-133528733 TGGAAGGAGCTGTGTGGACAAGG - Intronic
998104717 5:139461289-139461311 TTGGAGGATTTGAGAGAACAGGG - Intronic
999309425 5:150542442-150542464 TGGTAGGAGCTCAGGGAAAAGGG - Intronic
999555930 5:152741957-152741979 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
999849737 5:155525072-155525094 TGGGAAGAGCTGAGTGAACAGGG + Intergenic
1000475229 5:161698770-161698792 TTCTAGGAGTTAAGAGAACAAGG - Intronic
1000581068 5:163035790-163035812 TTGGTGGAGCTGTGTGAAGAGGG + Intergenic
1004122721 6:12840168-12840190 TTGTAGGGACTGACTGATCAAGG + Intronic
1004726049 6:18312246-18312268 ATTTGGGAGCTGAATGAACAGGG + Intergenic
1007478862 6:42136915-42136937 GGGGAGGAGCAGAGTGAACAGGG + Intronic
1007630216 6:43269365-43269387 TCGGAGGAGGTGAGTGACCATGG + Intronic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1011315442 6:86026473-86026495 TTTGAGGAGCTGAGAGAAGAAGG - Intergenic
1011888265 6:92125113-92125135 TTGTAGCAGGTAAGGGAACAAGG + Intergenic
1012799848 6:103811908-103811930 TTGTAGCTGCTGACTGATCAGGG + Intergenic
1013251262 6:108335738-108335760 AGGTAGGAGCAAAGTGAACATGG + Intronic
1014807716 6:125849170-125849192 TTGTAGTAGCTGAATGAAAACGG - Intronic
1015152328 6:130053852-130053874 TTCTAGGAGCTGAGAATACAGGG + Intronic
1018543502 6:164910431-164910453 CTGTAGGACCTCAGTGGACATGG + Intergenic
1018721795 6:166578421-166578443 ATGTAGGAGCTGGGTGACCAGGG + Intronic
1021138445 7:16993861-16993883 TTGTAGGAGAGGAATGCACATGG + Intergenic
1022694065 7:32687675-32687697 TTTGAGGAGCTGAGAGAAGAAGG - Intergenic
1022827365 7:34029514-34029536 GTCAAGGAGCTGAGTAAACAAGG - Intronic
1023093671 7:36639469-36639491 TAGTAGGTGCTCAGTAAACATGG + Intronic
1024739112 7:52336330-52336352 TTGTAGCAGGTGAGTGATAATGG + Intergenic
1025650976 7:63468664-63468686 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1027357344 7:77370880-77370902 TTGTAGTAGCTGAAGGCACAGGG - Intronic
1028746830 7:94336908-94336930 TTGTGGGAGCAGAGAGAACAAGG - Intergenic
1029948921 7:104562666-104562688 TTTGAGGAGCTGAGAGAAGAAGG - Intronic
1030109239 7:106012486-106012508 TGGCAGGAGGAGAGTGAACAAGG + Intronic
1032390705 7:131553757-131553779 TTTCAGTAGCTGAGGGAACACGG + Intronic
1032445138 7:131975889-131975911 TGGATGGAGCAGAGTGAACAAGG - Intergenic
1032643240 7:133793156-133793178 TTGAAAGGGCAGAGTGAACAGGG + Intronic
1033506407 7:142006611-142006633 TTGTAGCAGGTGATGGAACATGG - Intronic
1033933007 7:146547494-146547516 TTCCAGGAGCTGAGGGAAGAGGG - Intronic
1035761993 8:2075331-2075353 TTGCTGGTGCTGAGTGAGCAAGG - Intronic
1035869124 8:3118026-3118048 TTGTAGGACCAGAGGGAAAAAGG - Intronic
1037609031 8:20460899-20460921 TAGAAAGAGCAGAGTGAACAAGG - Intergenic
1038724355 8:30067175-30067197 TTCTAGTAGCTGATTGAGCAGGG - Intronic
1039095571 8:33881022-33881044 GTGTAGGAGCTGAGTGAAGCCGG - Intergenic
1039368609 8:36960544-36960566 TGCCAGGAGCTGAGGGAACAGGG - Intergenic
1039812938 8:41065927-41065949 TTGCATGAGCTGAGTGAAAGGGG - Intergenic
1040849283 8:51881973-51881995 TAGTGGCATCTGAGTGAACAGGG - Intronic
1041789376 8:61675889-61675911 TTGGGGGAGCTGAGCGAGCAAGG + Intronic
1042309413 8:67365598-67365620 TAGTAGCAGTTGAGTGACCACGG - Intergenic
1042877136 8:73449710-73449732 GTGTAGGAGCTTAGTCAAGAGGG - Intronic
1043241628 8:77941525-77941547 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1046509194 8:115178027-115178049 TTTTAGTAGCAGACTGAACATGG + Intergenic
1046600715 8:116314535-116314557 TGGTAGGAGGTAATTGAACATGG - Intergenic
1047232159 8:123006862-123006884 TTCAAGGAGCTGAGAGAAGATGG + Intergenic
1047840439 8:128745629-128745651 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1048240087 8:132732663-132732685 TTCTAGGAGCTGAGTGACTATGG + Intronic
1050095788 9:2064726-2064748 TTGTAGGAGTTGGGGGAACAGGG - Intronic
1051284520 9:15482579-15482601 TTGAAGGAACTGACTTAACAAGG - Intronic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1054345896 9:63914400-63914422 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1054971780 9:71096330-71096352 TTCTAGGACCTGAAGGAACAAGG + Intronic
1055410311 9:76021900-76021922 TTGTTGGAGCTTAGAGAACAGGG - Intronic
1055913617 9:81377962-81377984 TTGCAGGAGCTCAGAGAAAAGGG + Intergenic
1056093457 9:83227918-83227940 TTGGACGAGCTGAGAGAAGAAGG - Intergenic
1056284706 9:85076646-85076668 TTGGACGAGCTGAGAGAAGAAGG - Intergenic
1057125054 9:92610367-92610389 TTTTAAGAACTGAGAGAACAGGG + Intronic
1058118049 9:101107133-101107155 TTTGAGGAGCTGAGAGAAGAAGG - Intronic
1058387876 9:104460180-104460202 TGCCTGGAGCTGAGTGAACAAGG + Intergenic
1058462578 9:105196812-105196834 TTATAGAAGCTGAGAGAAGATGG + Intergenic
1059660260 9:116393138-116393160 TTGGAGAAGCTGATTGAACTGGG + Intronic
1060675852 9:125513942-125513964 TTGTAGGACCTGAGAGACTAGGG - Intronic
1062515651 9:136933887-136933909 TTGCAGGAGCTGTGGGGACATGG + Intronic
1186000557 X:5004830-5004852 TTGTAGGAGCTAAGTAAGCTTGG + Intergenic
1186288821 X:8074335-8074357 TTCTTGGGGCTGAGTGAACGAGG + Intergenic
1187776729 X:22768707-22768729 TTGTACTAGCTGAGTGCTCATGG - Intergenic
1189388676 X:40557876-40557898 ATGTAGGAGCTGAGGGACAAAGG + Intergenic
1189403031 X:40690238-40690260 TTCTAGGAGCTGGGTCATCAAGG + Intronic
1189556804 X:42153505-42153527 TTGTAGCAACTGAGTCAACAGGG - Intergenic
1190217468 X:48489446-48489468 GGGCAGGAGCAGAGTGAACAAGG + Intergenic
1190384267 X:49869209-49869231 TTGTTGAAGCTGAGTAAACGGGG - Intergenic
1191135997 X:57066327-57066349 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1191141036 X:57117178-57117200 TGTCTGGAGCTGAGTGAACAAGG - Intergenic
1191142636 X:57132894-57132916 TGACTGGAGCTGAGTGAACAAGG - Intergenic
1191935969 X:66427274-66427296 TTTGAGGAGCTGAGAGAAGAAGG + Intergenic
1192322081 X:70098119-70098141 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
1192871374 X:75188007-75188029 TTGGACGAGCTGAGAGAAGAAGG - Intergenic
1194951860 X:100135959-100135981 TTGGACGAGCTGAGAGAAGAAGG + Intergenic
1194991461 X:100551283-100551305 TTGGACGAGCTGAGAGAAGAAGG + Intergenic
1196086299 X:111685911-111685933 TTGCAGGAGCATAGTGAGCAAGG + Intronic
1196558386 X:117118772-117118794 ATGGAGGAGATGAGTGAAAACGG - Intergenic
1198566518 X:137910755-137910777 AGGTAAGAGATGAGTGAACAAGG - Intergenic
1200574189 Y:4867509-4867531 TTGGATGAGCTGAGAGAAGAAGG + Intergenic
1201600840 Y:15727304-15727326 TTTCAGGAGCTGAGAGAAGAAGG - Intergenic