ID: 924657175

View in Genome Browser
Species Human (GRCh38)
Location 1:245983458-245983480
Sequence GGTCCCAGGGGGCCACGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924657175_924657180 -4 Left 924657175 1:245983458-245983480 CCAGCACGTGGCCCCCTGGGACC 0: 1
1: 0
2: 1
3: 19
4: 228
Right 924657180 1:245983477-245983499 GACCCACGACCAGATGCCCATGG 0: 1
1: 0
2: 1
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924657175 Original CRISPR GGTCCCAGGGGGCCACGTGC TGG (reversed) Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900232602 1:1568539-1568561 GGTCGCAGTGGGCCCCGTGATGG + Intronic
900414465 1:2528612-2528634 GGGTCCAGGGGGCCACTGGCAGG + Intergenic
900419680 1:2550477-2550499 GGTCCCCTGGGGCCCCATGCTGG + Intergenic
900425543 1:2576794-2576816 GGTCCCCTGGGGCCCCATGCTGG - Intergenic
900497487 1:2982643-2982665 GGCCCCAGAGGTACACGTGCAGG - Intergenic
900572293 1:3364597-3364619 TGCACCAGGGGGCCACGTGCAGG - Intronic
900600609 1:3501234-3501256 GGTCGCAGCGGGCAGCGTGCTGG + Exonic
901012644 1:6210179-6210201 GTTTCCAGGGGGCCAGGAGCAGG - Intronic
901690494 1:10970009-10970031 GATCCCAAGGAGCCACGTGGAGG - Exonic
902258497 1:15206443-15206465 AGTCCCTGGGGGCCACTTTCTGG - Intronic
902292451 1:15444423-15444445 GGTCCCAGAGGGTCAGGAGCAGG - Intronic
902671529 1:17977797-17977819 GGCCCCAGGAGGCCACCTTCAGG + Intergenic
902676122 1:18009577-18009599 GGTGCCAGGGGGACTCCTGCAGG - Intergenic
903501285 1:23801198-23801220 GGTCGCAGGGGGCCTGGTGCTGG + Intergenic
905281586 1:36852796-36852818 GCTCCCAGGGACCCACTTGCTGG + Intronic
907761773 1:57368227-57368249 GGTGCCAAGGGGCCCCCTGCAGG - Intronic
911746532 1:101447341-101447363 GGGCCCAGGTGGCCACCTTCAGG + Intergenic
912576166 1:110674623-110674645 GGTGCCCGGGGACCACCTGCTGG - Exonic
913108578 1:115638848-115638870 TGTCCCAGAGGGGCACCTGCCGG + Intergenic
914196717 1:145451607-145451629 TGTCCCACGGGGCCACATGCTGG - Intergenic
917051261 1:170926580-170926602 GATCCCAGGGGTACATGTGCAGG - Intergenic
920506867 1:206521440-206521462 GGTCACAGGAGGCCAGGAGCAGG - Intronic
921484777 1:215703189-215703211 TGTCCCAGAGGGGCACCTGCCGG + Intronic
922740964 1:228014032-228014054 GGTCCCAGGAGGCGACCAGCTGG + Intronic
924657175 1:245983458-245983480 GGTCCCAGGGGGCCACGTGCTGG - Intronic
1063387138 10:5623121-5623143 AGTCCCAGGGAGCCACGGGCTGG - Intergenic
1063543865 10:6961406-6961428 GGTCCCAGAGGGCCTCTTGGAGG + Intergenic
1063796672 10:9520213-9520235 GGACCCTGTGAGCCACGTGCGGG - Intergenic
1065876098 10:29998747-29998769 GGAGCCAGGTGGCCACGTGGTGG - Intergenic
1068951654 10:62783070-62783092 CGTCCCAGAGGGGCACCTGCCGG - Intergenic
1070775668 10:79108421-79108443 GGTCCTAGGGTGCCAATTGCTGG + Intronic
1070788677 10:79177006-79177028 GGACCCAGGGGGCCTCTTGTGGG - Intronic
1072869202 10:99099347-99099369 GGTCCCTGTGAGCCATGTGCGGG - Intronic
1073392780 10:103193102-103193124 GGTCCCTGGGGGCCGGGGGCGGG + Intronic
1074557561 10:114505883-114505905 GGTCCAAGGGGTACATGTGCAGG + Intronic
1074776811 10:116773173-116773195 GGTCCCAGGGAGGCAAGAGCAGG + Intergenic
1075069058 10:119308779-119308801 GGTTCCAGGGGGCCAGGAGGAGG + Intronic
1075657918 10:124174160-124174182 GGGCCCAGGGCAACACGTGCAGG + Intergenic
1076424563 10:130358441-130358463 GGGCCCAGAGGGCCAAGAGCAGG - Intergenic
1077234636 11:1474069-1474091 AGTCCCAGGTGGCCACATCCTGG + Intronic
1077237500 11:1488741-1488763 GTTCACTGGGGGACACGTGCAGG + Intronic
1077908948 11:6557902-6557924 GGACCAGGCGGGCCACGTGCTGG - Exonic
1077919097 11:6630080-6630102 GGTCCCGGGCTACCACGTGCAGG + Exonic
1078340263 11:10493492-10493514 GGTCGTAGGGGTCCATGTGCAGG - Exonic
1079731496 11:23940918-23940940 GGACCCAGGGGGCAACGGTCAGG + Intergenic
1080853535 11:36091878-36091900 GGTCCCATGGGGCCTGGTCCAGG - Intronic
1081527373 11:43936127-43936149 GGTCCCCGAGGGCCACGTTTGGG + Intronic
1081862180 11:46339531-46339553 TGTCCCAGAGGCCAACGTGCAGG + Intronic
1083176680 11:60954516-60954538 GGTACCAGGGGGCCAGGTGCTGG + Intergenic
1083653909 11:64219969-64219991 GGTCCCCAGGGGCCTCGTCCTGG - Exonic
1085533172 11:77203472-77203494 GGTCCCATGAGGCCAGGGGCTGG - Intronic
1087698269 11:101406407-101406429 GCTCCCAGGGTGCCTCATGCAGG + Intergenic
1089494954 11:118903151-118903173 GTTCCGAGGGAGCCCCGTGCAGG - Intronic
1089611223 11:119670512-119670534 GGTCCCAGTGGGCCCCATGCAGG - Intronic
1090264056 11:125343032-125343054 GTTCCAAGGGGGCCACAGGCTGG + Intronic
1091323523 11:134667856-134667878 GGTGCCCTGGGTCCACGTGCGGG + Intergenic
1091725625 12:2844733-2844755 TGTCCAAGGGTGCCAAGTGCAGG - Intronic
1091753469 12:3037074-3037096 GAGCCCAGGGGGCCTCCTGCTGG - Intronic
1096717415 12:53499680-53499702 CGTCCCGGGGGGCCAGGGGCGGG - Intronic
1100287916 12:93184873-93184895 GGTCATAGGGGCCCACGTGTAGG - Intergenic
1101927309 12:108983479-108983501 GGGCCCAGGGGGCCAAGGGGTGG - Intronic
1103931812 12:124454552-124454574 GGTCCCCGGGGGCCTCCTGGGGG - Intronic
1113417393 13:110138777-110138799 GTTCACAGGGTGCCACGTGCAGG + Intergenic
1113809124 13:113126915-113126937 GGTTGCAGGGAGCCACGTGTGGG + Intronic
1117299168 14:54407221-54407243 CGTCCCAGAGGGGCACCTGCCGG + Intronic
1119669468 14:76507596-76507618 GGTCCCAGAGGGGCACATCCTGG - Intergenic
1119815516 14:77563359-77563381 GGTCCCACAGGGCCAACTGCAGG - Intronic
1120723903 14:87916686-87916708 GGTCCCAGGGGCCGCCCTGCTGG + Intronic
1122934166 14:104948274-104948296 ACTCCCAGAGGGCCCCGTGCCGG - Exonic
1123018492 14:105386692-105386714 GGTCCCTGGGGCCCCCTTGCTGG + Intronic
1124100564 15:26689178-26689200 GGTCGCAGGAAGCCAGGTGCAGG - Intronic
1125956221 15:43792745-43792767 GGTCCCAAGGGGCCAGCTGGAGG - Intronic
1127845255 15:62865236-62865258 GGTTCGAGGGGTACACGTGCAGG - Intergenic
1128654883 15:69453198-69453220 GGGCCCCCGGGACCACGTGCGGG + Intronic
1128836240 15:70811222-70811244 GGCCCCTGGGGTCCATGTGCAGG - Intergenic
1129206020 15:74037384-74037406 GCTCCCAGGGGGTCAAGGGCTGG - Intronic
1130555291 15:84918344-84918366 AGTCCCAGGGTTCCACATGCAGG - Intronic
1132289065 15:100686618-100686640 GCTCCCCGAGGGCCACATGCTGG + Intergenic
1132516536 16:368646-368668 GCTCACATGGGGCCAGGTGCTGG + Intronic
1132696430 16:1204209-1204231 GGTCCCAGCGGTCACCGTGCCGG - Exonic
1132723041 16:1326300-1326322 GGTCCCCGTGGCCCAAGTGCAGG + Exonic
1132981061 16:2738881-2738903 GGAACCAGGGGGACACGTGGAGG + Intergenic
1136186685 16:28592561-28592583 GGTCCCAGGGGTCGAGGAGCTGG - Intronic
1137732295 16:50697777-50697799 GGGCACAGGGGGCCCTGTGCTGG - Intronic
1137767851 16:50991642-50991664 GAGCTCAGGGGGCCACGTGTGGG - Intergenic
1139548859 16:67662499-67662521 TGTCTCAGGGGCCCCCGTGCTGG + Exonic
1141697796 16:85628342-85628364 GGTCCCTGGGGGTCCCCTGCGGG - Intronic
1141720522 16:85752809-85752831 GGTCCCAAGGGGCCATTTCCTGG + Intergenic
1141840070 16:86568394-86568416 GGTCCGAGAGGGCCTCGTCCAGG - Exonic
1142238081 16:88932076-88932098 GTTGCCAGGGGCGCACGTGCAGG - Intronic
1142737746 17:1912254-1912276 GGTCCCAGGGCGCCAGCAGCTGG - Intergenic
1142855063 17:2724593-2724615 GGTCCCAGGCGGCCCAGTCCCGG + Intergenic
1143538848 17:7557928-7557950 GGTAGCTGGGGGCCACGTGAAGG + Intronic
1145780062 17:27557009-27557031 TGTCCCATGGGGCCACTGGCAGG - Intronic
1145939892 17:28737812-28737834 GGTCCCCGGGGGATACCTGCAGG - Exonic
1148186599 17:45649062-45649084 GTTCCTAGGGGGCCAAGTGGGGG - Intergenic
1148671041 17:49410351-49410373 GATCCCAGAGGGCAAGGTGCAGG + Intronic
1151546736 17:74797895-74797917 GGGCCCAAGGGGCCACTTGATGG - Intronic
1152031447 17:77845916-77845938 CCACCCAGGGGGCCACCTGCGGG - Intergenic
1153461379 18:5337238-5337260 GGTCCTAGGTGGCCATGTGTTGG - Intergenic
1161119588 19:2518082-2518104 GGTGCCAAGGTGCCACGTGCTGG - Intronic
1161477765 19:4495903-4495925 AGTGCCTGGGGCCCACGTGCTGG + Intronic
1161802886 19:6425626-6425648 GCTTCAAGCGGGCCACGTGCCGG - Intergenic
1162071532 19:8155213-8155235 GGTCCCAGTGGGCGATGTGGTGG - Intronic
1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG + Exonic
1166357659 19:42236578-42236600 GGTCCCAGCAGCCCACCTGCTGG + Intronic
1166558836 19:43718870-43718892 GGTCCCAGAGGGTCACGTCAGGG - Exonic
1167156577 19:47742702-47742724 GCTTCCAGGGGGCCAGGAGCAGG - Exonic
1167636623 19:50659415-50659437 GGACCCAGGCGTCCACGTACAGG - Intronic
1168584781 19:57583620-57583642 TGTCCCGGGAGGCCACGTGGGGG - Intronic
925026523 2:611795-611817 GGGCTCAGGGGGCCTCATGCAGG + Intergenic
926238644 2:11068662-11068684 GGTCCACTGGGGCCTCGTGCAGG + Intergenic
926309179 2:11662162-11662184 GGTCACAGTGAGCCACCTGCTGG - Exonic
927204734 2:20600007-20600029 GGTCCCAGGGGGACCCCTGGGGG + Intronic
927994156 2:27471005-27471027 GGTCCCAGGAAGTGACGTGCTGG - Exonic
928215553 2:29358517-29358539 GCTTCCTGGGGGCCACATGCTGG - Intronic
929943483 2:46352753-46352775 GGTCCCTGGGGCCAACCTGCTGG + Intronic
935229240 2:101081556-101081578 GGTCCCAGGGGGCCCACTTCAGG - Intronic
938342089 2:130542373-130542395 GGTCCCAGGAGGACTCCTGCAGG - Intronic
938347743 2:130578338-130578360 GGTCCCAGGAGGACTCCTGCAGG + Intronic
940541388 2:155024851-155024873 GGTCCAAGGGATCCATGTGCAGG + Intergenic
941666230 2:168246782-168246804 GGGCCCCGGGGGCCGCGTCCTGG - Intronic
942146419 2:173031557-173031579 GGTCCAAGGAGGCCAGGTGTGGG + Intronic
944090826 2:195909211-195909233 GGTTCCAGGGGTACAGGTGCAGG - Intronic
945174107 2:207023995-207024017 GGCCCCAGGGGGCCACACTCAGG - Intergenic
945240747 2:207674607-207674629 GGTCCCAGGCTGCCATGTGGAGG - Intergenic
945533682 2:210986594-210986616 CGTCCCAGAGGGGCACCTGCCGG + Intergenic
946859712 2:223989387-223989409 GGGCCCAGGGTGCCACCTGTCGG - Intronic
947145390 2:227059482-227059504 GGTCCCAGGTGACCAAATGCAGG + Exonic
947915948 2:233831568-233831590 CGTCCCAGGTGGCCACACGCTGG + Intronic
948133658 2:235620061-235620083 GGTCCCTGGGGGCCGAGGGCAGG - Intronic
948654105 2:239466083-239466105 GGTCCCAGGCAGACACCTGCTGG + Intergenic
948725524 2:239931467-239931489 AGTCCCAGGTGGACACGTTCTGG + Intronic
948764776 2:240213699-240213721 GGCTCCATGGGGCCAGGTGCTGG - Intergenic
949046868 2:241876469-241876491 GGTCTCAGGGGCCCAACTGCAGG + Intergenic
949046901 2:241876573-241876595 GGTCTCAGGGGCCCAACTGCAGG + Intergenic
949046917 2:241876627-241876649 GGTCCCAGGGGCCGAAATGCAGG + Intergenic
1169143443 20:3238508-3238530 CGTCCCGGCGGCCCACGTGCAGG + Intronic
1169177321 20:3528690-3528712 GGTTCAAGGGGTCCATGTGCAGG - Intronic
1169867072 20:10213689-10213711 GCTCCCAGGGGGGCTTGTGCAGG + Intergenic
1170695276 20:18652152-18652174 GGGCCCAGGGGGCAGCATGCAGG + Intronic
1170868993 20:20187317-20187339 GGGCCCAGGGTGCCAGGGGCAGG + Intronic
1173248781 20:41353710-41353732 GCTCCCAGAGGGGCAGGTGCAGG - Intronic
1175654007 20:60753053-60753075 GGGCTCAGGAGGCCACGTGTAGG + Intergenic
1175818868 20:61897776-61897798 GGTTCCAGGGGGCCTCAGGCAGG + Intronic
1175826691 20:61940135-61940157 GGACCCACGGCGCCACGAGCTGG - Exonic
1175971546 20:62689136-62689158 GGGCACAGCTGGCCACGTGCAGG - Intergenic
1175991006 20:62789119-62789141 ACTCCCAGGGGGCCACGGGAAGG + Intergenic
1176928446 21:14779225-14779247 GGACCCACTGAGCCACGTGCAGG - Intergenic
1179909989 21:44442476-44442498 ACTCCCTGGGAGCCACGTGCTGG + Exonic
1179940963 21:44638700-44638722 TGGGCCGGGGGGCCACGTGCTGG - Intronic
1180979284 22:19871226-19871248 GGTCCCACGGGGCCGGCTGCAGG - Intergenic
1181591051 22:23884794-23884816 GGGCCCAGGGCCCCACGTGGAGG + Exonic
1182419295 22:30241179-30241201 GGTCCCATGGGGCCAAGTCCAGG + Exonic
1183507768 22:38219004-38219026 GGTCCATGGGGCCCACATGCTGG - Intergenic
1184235161 22:43179390-43179412 GATCCCAGGGTGCCTGGTGCTGG - Intronic
1184425334 22:44405938-44405960 GGTCCCAGGGGGGCACAGGGAGG - Intergenic
1184671249 22:46013236-46013258 GTTCACTGGGGGCCCCGTGCAGG - Intergenic
1184693649 22:46128404-46128426 GGTCACAGGGGGCCACGGCCAGG - Intergenic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
1184860611 22:47171421-47171443 GCCCCCAGGGGGCCACCTGCAGG - Intronic
1185271135 22:49929699-49929721 GGTCCCACAGCGCCACCTGCTGG - Intergenic
950366461 3:12488663-12488685 GGCCCCAGAGGGACACGTACTGG + Intronic
950882670 3:16335872-16335894 GGTCTCAGGAGGCCACAGGCAGG + Intronic
952241328 3:31533335-31533357 GTTCCCCGCGGGCCACGGGCGGG - Intronic
956639370 3:71401193-71401215 GTACCCAGGGGGCAATGTGCAGG - Intronic
957344563 3:78944867-78944889 GGACCCTGTGAGCCACGTGCGGG - Intronic
958818023 3:98938754-98938776 TGTTCCAGGGGTACACGTGCAGG - Intergenic
959308278 3:104696768-104696790 GGACCCAGTGAGCCAGGTGCGGG + Intergenic
960786129 3:121374016-121374038 GTTCCCTGGGGGGCACATGCAGG - Intronic
960994419 3:123331612-123331634 GGTGCCACAGGGCCACCTGCAGG + Intronic
961358842 3:126355349-126355371 AGTCCCAAGGGCCCAGGTGCTGG - Intronic
967847373 3:194054922-194054944 GGTCCAAGAAGGCCACGTGGTGG + Intergenic
968085329 3:195871539-195871561 GGTCACAGGGGGCCACAGGGGGG + Intronic
968462765 4:733512-733534 GGTCCCAGGCTCCCATGTGCAGG - Intronic
969511869 4:7622653-7622675 AGTCCCAGGGGGCTTCATGCAGG + Intronic
969584128 4:8082229-8082251 GGCCCCAGGGCCCGACGTGCTGG + Intronic
983919841 4:173333901-173333923 GGGCCCCGGGAGCCACTTGCTGG - Intronic
985993045 5:3578951-3578973 GGTCCCAGAAGCCCATGTGCTGG + Intergenic
989187083 5:38636072-38636094 GGACCCAGGTGGCCACCTCCAGG - Intergenic
990492590 5:56317102-56317124 GATCCAAGGGGTACACGTGCAGG - Intergenic
992013731 5:72556081-72556103 GGCCCCAGGGGGAAACCTGCTGG - Intergenic
997381415 5:133440890-133440912 AGACCCAGGAGGCCAAGTGCAGG - Intronic
1000041212 5:157486480-157486502 AGTCCCAGGGGTGCAGGTGCAGG + Intronic
1000431469 5:161157603-161157625 GGTCCAGGGGGTACACGTGCAGG - Intergenic
1001446766 5:171791218-171791240 TGTTCCAGGGGGCCACGTCATGG - Intronic
1002043391 5:176529709-176529731 GGTCCCATGGAGCCCCATGCTGG - Exonic
1002197785 5:177510430-177510452 GGTCCCAGGGGGCCCCGGAGAGG + Intronic
1002311277 5:178315349-178315371 GAGCCCAGCAGGCCACGTGCTGG + Intronic
1002373542 5:178772883-178772905 TGTACCAGGGGGCCAGGTGTGGG + Intergenic
1003633595 6:7811016-7811038 GGGCCCTGGGGGCCACATGGGGG - Intronic
1006840677 6:37026260-37026282 AGTCCCAGGGTGCCAAGAGCTGG + Intronic
1007176864 6:39903096-39903118 GGTTCCAAGTGGCCACCTGCAGG - Exonic
1007248878 6:40482382-40482404 GGCCCCTGGGGACCACGTGGAGG + Intronic
1010273937 6:73948069-73948091 GGTCCCAGGGTGACATATGCTGG + Intergenic
1014729849 6:125020005-125020027 TGTCTCAAGGGGCCAGGTGCTGG + Intronic
1015838054 6:137444021-137444043 GGCCCCAGGGTCCCATGTGCTGG + Intergenic
1017946986 6:159103987-159104009 GGCCCGAGGGGGCCATTTGCAGG - Intergenic
1019490768 7:1312231-1312253 GCTCCCGGGGGGCCACATGCCGG + Intergenic
1019706616 7:2500003-2500025 GTGGCCAGGGGGCCAGGTGCTGG - Intergenic
1021522867 7:21554461-21554483 GATCCCAAGGGGCCAGGTGCAGG - Intronic
1022493301 7:30837219-30837241 GGTCACAGGGGACCAGGAGCAGG + Intronic
1023867346 7:44244474-44244496 GGCCCCAGGGAGCCCCCTGCTGG - Intronic
1024476444 7:49816967-49816989 AGTCCCAGGGGGCCAATGGCAGG - Intronic
1027184680 7:75963743-75963765 GTTCCAAGGGAGCCACATGCTGG + Intronic
1027515453 7:79136934-79136956 GGTCCCAGGGGTCCACCAGTAGG + Intronic
1029448576 7:100628034-100628056 GACCCCAGGGGGCCAGGTGGTGG + Intronic
1032392333 7:131563609-131563631 GGTCCCAAGGGCCCACGTTCAGG - Intergenic
1032637624 7:133727357-133727379 GGGCTCAGTGGGCCACCTGCTGG + Intronic
1033133942 7:138769035-138769057 GGTCCCAGAGGCCCACCTGGAGG - Intronic
1034335970 7:150323620-150323642 GGCCCCGGGGGGCCACCTGCTGG + Intronic
1034533452 7:151712173-151712195 GGTGCCAGGAGGGCACGTGAGGG - Intronic
1035281954 7:157784257-157784279 GGTCTCAGGAGGCCAAGTGGGGG + Intronic
1035282798 7:157787951-157787973 GTTCCCAGGGGACCCGGTGCTGG - Intronic
1037382590 8:18303201-18303223 AGTACCAGGGGTACACGTGCAGG + Intergenic
1039657909 8:39430301-39430323 GGTCCGAGGGGCACATGTGCAGG + Intergenic
1042990341 8:74632309-74632331 GGTCTCAGGGTGCCACCAGCAGG + Intronic
1047927209 8:129693459-129693481 GGGTCTAGGGGGCCATGTGCAGG - Intergenic
1048282658 8:133116511-133116533 GGGCCCAGGGGGCCCCTTGCTGG + Intronic
1048451926 8:134541030-134541052 GGGCCCTGGGTTCCACGTGCTGG + Intronic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049671403 8:143871717-143871739 GCTCCCAGAGGGACACGGGCCGG + Exonic
1049710191 8:144059939-144059961 GTGCCCAGGGGGGCACGTGCGGG - Exonic
1051414894 9:16829039-16829061 GGTCCCCTGGTGCCTCGTGCCGG - Intronic
1053426516 9:38013807-38013829 GGTCCCATGGAGCCACAGGCAGG - Intronic
1056965734 9:91161668-91161690 GGTCCCAGGTGGCCCCTGGCCGG + Intergenic
1057792276 9:98132187-98132209 GGTCCCACAAGGCCACCTGCCGG + Exonic
1058870268 9:109195314-109195336 GTTCCCACGTGGCCCCGTGCTGG - Intronic
1060176281 9:121499603-121499625 GGTCCCCGGAGGCCACGAGCAGG - Intergenic
1060405371 9:123370413-123370435 AGACCCAGGGGGCCACCAGCTGG - Exonic
1061666479 9:132163287-132163309 GGTCCCGGCGGGCCGCGGGCGGG - Intronic
1061678542 9:132231476-132231498 GGACCCAGGGGGCCCCTGGCTGG + Intronic
1061680411 9:132240259-132240281 CGTCACAGGGGGCCAGCTGCAGG + Intronic
1061779980 9:132989703-132989725 GGCCCCGGGGGGTCAGGTGCAGG - Intronic
1062375592 9:136260470-136260492 AGTCTCAAGGGGCCACATGCTGG - Intergenic
1062414324 9:136439979-136440001 GGTCCCAGCGAGGCAGGTGCAGG + Intergenic
1062540264 9:137038928-137038950 GGACCCAGGGGGCCAGGTGAGGG - Intergenic
1062598725 9:137310747-137310769 GGTCCCAGGCAGGCACCTGCAGG + Intronic
1062698015 9:137885227-137885249 TGTCCCACGGGGCCACATGCTGG + Intronic
1185468689 X:370035-370057 GGTCCCTGGGAGTCAAGTGCTGG - Intronic
1185785184 X:2884872-2884894 GGTCTAAGGGGTACACGTGCCGG - Intergenic
1194746461 X:97633993-97634015 GGTAGCAGGAAGCCACGTGCAGG + Intergenic
1194904276 X:99554272-99554294 GGTTCAAGGGGTACACGTGCAGG + Intergenic
1199541140 X:148959154-148959176 GGTGCCAGGAGGCCTCCTGCTGG - Intronic
1200047486 X:153410514-153410536 GCCCCCAGGGGGCCCAGTGCAGG - Intergenic
1200089198 X:153626452-153626474 GCCCCCAGGGGGCCCAGTGCAGG + Intergenic
1200951825 Y:8905197-8905219 GGGCCCCGAGGGCCACGTGGTGG + Intergenic
1201288675 Y:12401281-12401303 GGTCTAAGGGGTACACGTGCCGG + Intergenic