ID: 924657337

View in Genome Browser
Species Human (GRCh38)
Location 1:245984899-245984921
Sequence CAGAGCAAGGAGAAGTCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 273}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924657337 Original CRISPR CAGAGCAAGGAGAAGTCGGA TGG (reversed) Intronic
900279845 1:1859674-1859696 GAGAGGAAGGAGAAGTGGGGTGG + Intronic
900503516 1:3017989-3018011 CAGAGCCAGAAGAAGCAGGAAGG - Intergenic
901320320 1:8335940-8335962 CAGAGCAAGACAAAGTTGGAAGG - Intronic
902228423 1:15011856-15011878 AAGAGGAAGGAGGAGTGGGAAGG + Intronic
903049217 1:20588596-20588618 TAGGGCAAAGAGAAGTTGGAAGG + Intergenic
903619657 1:24688785-24688807 GAAAGCATGGAGAAGCCGGAGGG - Intergenic
904599661 1:31666461-31666483 GAGAGGGAGGAGAAGTGGGAAGG - Intronic
904866001 1:33579421-33579443 CAGGGAAAGGAGAGGTTGGATGG + Intronic
905834792 1:41108377-41108399 CAGAGCAAGGGGAAGTCAAGTGG + Intronic
908189239 1:61684378-61684400 CACAGTGAGGAGAAGTGGGAAGG - Intronic
908854530 1:68409897-68409919 CAGAGAAAGAAGAAGTCAGTAGG - Intergenic
909456404 1:75854576-75854598 CAGAGCAGGGAGAGGACGGACGG - Intronic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
911733049 1:101309707-101309729 AAGAACAAAGGGAAGTCGGAAGG - Intergenic
912510001 1:110182922-110182944 CAGAGAAATGAGAAATGGGATGG + Intronic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
914084541 1:144440962-144440984 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914190554 1:145406228-145406250 CTGAGTAAAGAGAAGTCGGCCGG - Intergenic
914588360 1:149083102-149083124 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914682303 1:149947175-149947197 CAGAACAAGGAGATCTGGGATGG - Intronic
915982360 1:160428279-160428301 CAGAGGAAAGAGAAGACAGACGG - Exonic
916257494 1:162804599-162804621 CAGAGCAATGGGAAGCTGGAGGG + Intronic
917206956 1:172585305-172585327 TAGAGCTAGGAGAAGTCAAAAGG - Intronic
917336491 1:173928996-173929018 AAGAGCAAGGAGCAGTGAGATGG - Intergenic
918528053 1:185486578-185486600 CAGAGCCTGGAGAAGTGGAATGG + Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
920846710 1:209599420-209599442 CATAGCAATGAGAAGGCAGATGG - Intronic
920857534 1:209675310-209675332 CAGAGCCAGGGGAACTCGGAGGG - Intergenic
921256855 1:213349389-213349411 CACAGTAAGGAGAAGCAGGATGG + Intergenic
921686790 1:218098499-218098521 CACGGTAAGCAGAAGTCGGAGGG - Intergenic
922841526 1:228646847-228646869 GAGAGCAAGGAGAAGATGGATGG + Intergenic
922905006 1:229167639-229167661 AAGAGAAGGGAGAAGTGGGAGGG + Intergenic
922939821 1:229452865-229452887 CACAGCAACGAGAAATAGGAGGG + Intronic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1063367079 10:5497252-5497274 CAGAGCAAGGGGGAGAAGGACGG - Intergenic
1063407771 10:5813284-5813306 CCGAGCAAGGAAAAGGCGCAGGG + Exonic
1064448230 10:15416461-15416483 CAGATCAAGGAAAAGATGGAAGG + Intergenic
1066723943 10:38370285-38370307 CAGAGCAATGGGAAGCTGGAGGG + Intergenic
1069596661 10:69676355-69676377 GAGAGCAAGGTGGAGTGGGAAGG + Intergenic
1069819715 10:71219976-71219998 AAGAGTAAGGAGAGGTCGGCTGG - Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1073639072 10:105230793-105230815 CAGAGCAAGGCAAAGTCTGTTGG + Intronic
1075923334 10:126231550-126231572 CAGGGCAAGGAGAGGATGGAAGG - Intronic
1077238999 11:1500906-1500928 CAGAGCGAGGGGAAGTGGGGAGG - Intronic
1078079950 11:8196847-8196869 TAAAGCCAGGAGAAGTCTGAAGG - Intergenic
1078108945 11:8376391-8376413 CAAAGCCAGGAGAAGGCAGACGG + Intergenic
1078323369 11:10357345-10357367 CAGAGGAAAGAGAAGACAGAAGG + Intronic
1079264794 11:18920943-18920965 GAGAGCAAGGAGAAGCAGGGTGG + Intergenic
1079266969 11:18943090-18943112 GAGAGCAAGGAGAAGCAGGGTGG + Intergenic
1079633173 11:22702818-22702840 CAGAGCAAGGAGAAGAGATAGGG + Intronic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1083618846 11:64039146-64039168 CAGAGCAAGGGGGAGCTGGAGGG + Intronic
1084215371 11:67644573-67644595 CAGGGCCAGGGGAAGTGGGATGG + Intronic
1084697804 11:70766427-70766449 GGGAGGAAGGAGAAGTCAGAGGG + Intronic
1085349242 11:75787981-75788003 CAGAGTAAGGACAAGTGGGTAGG + Intronic
1085470035 11:76752123-76752145 CAGAGAAAGGAAAAATGGGATGG - Intergenic
1086062914 11:82718607-82718629 CAGAGCATGGGGAAGTCCGTTGG + Intergenic
1086166373 11:83783819-83783841 CAGAGAAAGGATAAGCCTGAAGG - Intronic
1087267372 11:96075647-96075669 CTGAGCTAGGGGAAGTCGGGTGG + Intronic
1089622595 11:119730126-119730148 CAGAGTAAGGGGAAGAGGGAAGG - Intergenic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090591475 11:128274862-128274884 CAGAGAATGGAGAAGCGGGAAGG - Intergenic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1091328089 11:134707243-134707265 CAGAGCATGGAGAAATCACAAGG + Intergenic
1092111906 12:5970178-5970200 CAGAGGAGGGAGAAGTCTGGAGG - Intronic
1092860063 12:12712609-12712631 CAAAGCAAGGAGAAAGAGGAAGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1095775855 12:46009265-46009287 TTGAGGAGGGAGAAGTCGGAAGG + Intergenic
1097078880 12:56414890-56414912 CAGAATAAGGAGAAATCAGACGG + Intergenic
1098201908 12:68064678-68064700 GAGAGCAAGGAAAAGTAGGGTGG - Intergenic
1099158513 12:79209784-79209806 CAGATCAAGGAAAACTTGGATGG + Intronic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102904450 12:116663332-116663354 CAGAGCAGGGAGAGGTGGGGAGG - Intergenic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1104661820 12:130616827-130616849 CACAGGAAGGAGAAGTCAGAGGG + Intronic
1104917882 12:132275354-132275376 CAGAGCCAGGAGAGGTTGGCTGG + Intronic
1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG + Intergenic
1107726930 13:43308274-43308296 CAAAGAAAGGAGAAGTGAGAGGG - Intronic
1109024576 13:57142030-57142052 CAGAGAAAGGAAAAGTCACATGG - Intronic
1109025563 13:57148600-57148622 CAGAGAAAGGAAAAGTCACATGG - Intronic
1109026553 13:57155173-57155195 CAGAGAAAGGAAAAGTCACATGG - Intronic
1109027545 13:57161744-57161766 CAGAGAAAGGAAAAGTCACATGG - Intronic
1109028531 13:57168309-57168331 CAGAGAAAGGAAAAGTCACATGG - Intronic
1109501279 13:63238917-63238939 TAGAGAAAGAAGAACTCGGATGG + Intergenic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119321121 14:73731080-73731102 CCTAGCAGGGAGAAGTAGGAGGG - Intronic
1119702150 14:76762467-76762489 CAGAGCGGAGAAAAGTCGGAGGG - Exonic
1121477021 14:94218223-94218245 AAGAGAAAGGAGAAATGGGAAGG + Intronic
1121706684 14:96001704-96001726 GAGAGCAAAGAGAAGCAGGATGG + Intergenic
1121786596 14:96666180-96666202 GAGAGCAAAGGGAAGACGGAGGG - Intergenic
1121991545 14:98562527-98562549 CAGAGCAAGGAAGAGGCTGAAGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1128688025 15:69701358-69701380 CAGAGCTTGGAGAACTGGGATGG + Intergenic
1129000854 15:72332641-72332663 CAGAGCAAGGAAAATTATGAAGG - Intronic
1129268666 15:74408290-74408312 CAGAGCAAACTGAAGTGGGAGGG + Intergenic
1129283626 15:74506030-74506052 CAGGGCAGGGAGCAGTGGGACGG - Intergenic
1129797255 15:78387227-78387249 CAGACCTAGGAGAAGTGGGAAGG + Intergenic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130255185 15:82322691-82322713 CAGTGCCAGGAGAACTCGGGCGG - Intergenic
1130599789 15:85267315-85267337 CAGTGCCAGGAGAACTCGGGCGG + Intergenic
1130766855 15:86879503-86879525 GAGGGCAAGGAGGAGTGGGAGGG - Intronic
1130954372 15:88616488-88616510 CACAGCTAGCAGAAGTTGGAGGG + Intergenic
1132314630 15:100880565-100880587 CAGAACGAGGAGGAGTAGGAAGG + Intronic
1133275796 16:4637787-4637809 CACAGGAGGGAGAATTCGGATGG + Intronic
1133926937 16:10200875-10200897 CAGAGGAGGGAGAAGCCTGATGG + Intergenic
1135890968 16:26356872-26356894 CAAAGCAAGGAGCAGTCACATGG + Intergenic
1137518412 16:49170851-49170873 CAGAGCAAGGAGAAAGTTGAAGG - Intergenic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1138738444 16:59279853-59279875 CAGAGCAAGATGCAGTCTGATGG - Intergenic
1140980112 16:80100419-80100441 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1143651285 17:8265530-8265552 TAGAGCAAGGAGGAGTCCAAAGG - Intronic
1145262420 17:21362432-21362454 CAGATAAAGGAGAAGATGGATGG + Intergenic
1146320069 17:31840075-31840097 GAGAGAGAGGAGAAGACGGAGGG + Intergenic
1151345844 17:73500702-73500724 CAGAGGATGGAGGAGACGGAAGG - Intronic
1151930378 17:77228255-77228277 CAGAGCAAGGAGGGCTCGGGGGG + Intergenic
1152098402 17:78286537-78286559 CAAGGCAAGGAGAAGCCAGAGGG - Intergenic
1152681421 17:81670302-81670324 CAGAGGAAGGGGGAGTCTGACGG + Exonic
1152896469 17:82914217-82914239 CAGAGCACCGAGAACCCGGATGG - Intronic
1155450415 18:25957520-25957542 CAGGGCAAAGAGAAATAGGAAGG - Intergenic
1156409318 18:36812541-36812563 CAGAGCAAGGTGTGGTGGGAGGG - Intronic
1157115611 18:44860012-44860034 CAGAGAATGGAAAAGTCAGAAGG - Intronic
1158345827 18:56516098-56516120 CGAAGCAAGGAGAAGTCTGTTGG - Intergenic
1158865859 18:61637005-61637027 CAAAGCAGGAAGAAGTAGGATGG + Intergenic
1159085485 18:63784914-63784936 CAGGGCAAGGAGACTTCAGAAGG - Intronic
1159837666 18:73358792-73358814 CTGACCAAGGAGAAGGCAGAAGG - Intergenic
1164393102 19:27842649-27842671 CAGTGCAAGAATAAGTAGGAAGG + Intergenic
1164541942 19:29128024-29128046 AAGAGCAAGGGGAAAGCGGAGGG + Intergenic
1164726954 19:30472147-30472169 AATAGCAAGGAGAAGCCGGTTGG - Intronic
1165984109 19:39752300-39752322 AAGAGCAAGGAAGAGTGGGAAGG + Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167405120 19:49301698-49301720 CAGAGGAAGGAGAAATTAGAGGG - Intronic
925668646 2:6289027-6289049 CAGAGAAAGGAGATGCAGGAAGG - Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
930641769 2:53860208-53860230 CAGAGCAAGGTGGAGTGGTAAGG + Intergenic
930970255 2:57386225-57386247 AAGAGGAAGGAGTAGTTGGAAGG + Intergenic
931799767 2:65747434-65747456 CAAAGCAAGGGGGAGTGGGACGG - Intergenic
931884377 2:66599769-66599791 AAGAGCAAGGAGAGGGTGGAAGG - Intergenic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
932813330 2:74842629-74842651 CAGAGGACAGAGAAGTCAGAAGG + Intronic
934126275 2:88894523-88894545 CAGAGCAAGGAAAAGTATCAAGG - Intergenic
934166182 2:89296382-89296404 CAGGGCAAGGAGAACTGGGTGGG - Intergenic
934201093 2:89886074-89886096 CAGGGCAAGGAGAACTGGGTGGG + Intergenic
935786028 2:106549679-106549701 CAGGGCAAGGAGAGGTGGGAGGG + Intergenic
936934021 2:117820471-117820493 CAGAGCTAGGAGCAGTCTGCTGG + Intronic
937469539 2:122163401-122163423 TAGAGCAAGGGGATGTCGGTGGG + Intergenic
939144257 2:138393906-138393928 CAGAGGAAGGTGAATGCGGAAGG - Intergenic
939379181 2:141412992-141413014 CAGAGCAAGGGGAAGACTTAAGG + Intronic
940413281 2:153390946-153390968 CAGGGTAAGGAGAATTGGGAGGG + Intergenic
940887462 2:159001964-159001986 CAAAGGAATGAGAAGTCGGATGG + Intronic
941081630 2:161067962-161067984 GAAAGCAAAGAGAAGCCGGAGGG + Intergenic
941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG + Intronic
942453057 2:176120586-176120608 GAGATCAAGGCGAAGTGGGATGG - Intergenic
943712445 2:191111975-191111997 CAGAGCACGGAGAGGTAGGAGGG + Intronic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG + Intergenic
947623277 2:231604387-231604409 CAGAGCACGGGGCAGTCAGATGG + Intergenic
947772586 2:232682354-232682376 CGGAGCAAGGTGAAGAGGGAGGG - Exonic
948654344 2:239467154-239467176 CAGAGGAAGGTAAAGCCGGAGGG + Intergenic
1168826896 20:820007-820029 AAGAGGAAGGAGAAGGCTGAGGG - Intergenic
1172063677 20:32204754-32204776 CTGAGGAAGGACAAGTCTGAAGG - Intronic
1172617732 20:36300278-36300300 AAGAGCAAGGGGAAGACAGAGGG - Intergenic
1172639262 20:36431224-36431246 CAGAGCTAGGAGATGTGGGCTGG + Intronic
1172765982 20:37351129-37351151 CAGAGCAAGGAGTAGGGAGATGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1180162713 21:46005514-46005536 CAGAGCAAGAAGAGGGCGGAGGG + Intergenic
1180175191 21:46083846-46083868 CAGAGCAGGCAGGAGTGGGAGGG + Intergenic
1181467709 22:23118986-23119008 CAGAGCATGGACAGGTCAGAGGG + Intronic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
949356600 3:3187055-3187077 CAGAGCAATGAGCAGTTGGTAGG + Intergenic
949862479 3:8518809-8518831 CAGAGAAAGGGGTAGTCAGAGGG + Intronic
950486437 3:13276659-13276681 CAGAGCAAGGCCAAGGCTGATGG + Intergenic
951344952 3:21536857-21536879 CAAAGCACGCAGAAATCGGAGGG + Intronic
951830566 3:26921778-26921800 CAGAGCTCGGAGAAGTTGAAAGG + Intergenic
952043078 3:29283122-29283144 CAGAGCAAGGACAAGTTAAAAGG + Intronic
952685923 3:36148369-36148391 CAAAGCAAGCAGAAGACGGTGGG + Intergenic
953381520 3:42476236-42476258 CAGAGGATGGAGAAGTCAGGAGG + Intergenic
953452767 3:43017771-43017793 AAGGGCAAGGAGAAGTCTCAGGG + Intronic
953830541 3:46294107-46294129 CAGAGCAAGGGGGAGTCCCAGGG + Intergenic
955393289 3:58536597-58536619 CAGAGCAAGGAAAAGAGGTAAGG - Intronic
955812515 3:62806007-62806029 CAGAGCAAGGAAAAGCCATAAGG - Intronic
956468723 3:69542893-69542915 CAGAGCTTGGAGGAGTCGGAGGG - Intergenic
956686956 3:71838638-71838660 CAGGGCAACTAGAAGTGGGAGGG - Intergenic
959118445 3:102205804-102205826 AAGAGGAAGGAGGAGTGGGAAGG - Intronic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
961022367 3:123519022-123519044 CAGAGCAAGAGGAAGTGAGAGGG + Intronic
961696375 3:128708079-128708101 CAGAGGAAGAAAAAGTTGGAGGG + Intergenic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
961935780 3:130582072-130582094 CTGAGTATGGAGAAGTGGGAAGG + Intronic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
966473606 3:180319813-180319835 CTGGGCAAGGAGGAGTGGGAAGG + Intergenic
966592828 3:181700555-181700577 CAGAGCATGGCGAAGCTGGAAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967363646 3:188660970-188660992 CAGAGCAAGGATAATTCTTAGGG - Intronic
968268680 3:197382671-197382693 CACATCAAGGAGAAGATGGAAGG - Intergenic
968858753 4:3149712-3149734 CAGAGAAGGGAGAAGACTGATGG - Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971511378 4:27429511-27429533 CATAGGAAGGAGCAGTCTGAGGG - Intergenic
973932667 4:55808724-55808746 CAAAGCAAGGAAAAGAAGGATGG + Intergenic
976267185 4:83195446-83195468 AAGAGCAAGGAGAAGAGGGCGGG - Intergenic
977026401 4:91823654-91823676 TAGAGCAGGTAGAAGTTGGAAGG - Intergenic
977603511 4:98959060-98959082 CTGAGGAAGGAGAACTCGGGAGG - Intergenic
978653117 4:111031999-111032021 CAAAGCACGGAGAAGAAGGAGGG + Intergenic
978858339 4:113418789-113418811 TAGAGCAAGGAAAAATAGGAAGG + Intergenic
979010716 4:115365553-115365575 TAGAGCAAGGAGAGGCCAGATGG - Intergenic
979712972 4:123802653-123802675 GAGAGCAAGGAGAAGTATGTAGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981131233 4:141160729-141160751 TAGAGCAGGAAGAAGTGGGAGGG - Intronic
982663961 4:158238318-158238340 CAGATAAAGGAGAATTTGGAGGG + Intronic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
988110406 5:26812712-26812734 CAGAGCAAGGAAAAGCAGGGTGG + Intergenic
989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG + Intergenic
989682674 5:44047104-44047126 GAGAGCAAGGAAAAGCAGGATGG - Intergenic
990830504 5:59951928-59951950 CAGAGAAAGGAGAAGTGAGGAGG - Intronic
991650286 5:68845635-68845657 CAAAGCAAGGAGGAGAGGGAAGG + Intergenic
992732862 5:79689986-79690008 GAGACCGAGGAGGAGTCGGAGGG + Exonic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
997506539 5:134422019-134422041 AAGAGAAAGGAGAAGAAGGAAGG - Intergenic
998205499 5:140154335-140154357 CAGAGCAAGCAGGAGTGGGGAGG - Intergenic
1001007675 5:168068152-168068174 CAGAGCAAGGAGAAATCTCATGG + Intronic
1001834737 5:174822481-174822503 CAGAGTAAGGAGAACATGGACGG + Intergenic
1004021774 6:11782489-11782511 CATATCCAGGAGAAGTGGGAAGG + Intronic
1008294905 6:49763674-49763696 TAGGGCAAGGAGAAGTTGAAGGG - Intergenic
1009707206 6:67266774-67266796 GAGAGCAAGGAGAAGCAGGGTGG - Intergenic
1012231718 6:96768259-96768281 CAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1013189630 6:107791156-107791178 CAGAGCAAGAAGAACAGGGATGG + Intronic
1014682388 6:124447863-124447885 CAGAGAAAGGTGAAGACAGAGGG - Intronic
1015111454 6:129596449-129596471 CAGAACAAGGGGAATTGGGAAGG - Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1018195489 6:161353200-161353222 GAGGGCAAGGAAAGGTCGGAGGG - Intronic
1018476234 6:164144882-164144904 CAGAAGGAGGAGATGTCGGATGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020853338 7:13385257-13385279 CAGAGCAAGGAAATGAGGGAAGG + Intergenic
1022099953 7:27163516-27163538 GAGAGAAGGGAGAAGGCGGAAGG + Exonic
1022140204 7:27487055-27487077 CAGAGCAGGTAGATGTGGGAGGG - Intergenic
1023940358 7:44765405-44765427 CACATCAAGGAGGAGCCGGATGG + Exonic
1029460176 7:100689717-100689739 CAGAGGAAGGAGAGGTCCCAGGG - Intergenic
1030107695 7:106000382-106000404 CAGAGGAAGGAGAAATGGCAGGG - Intronic
1031124281 7:117756039-117756061 CTGAGGAAGGAGAAGTGGCAGGG - Intronic
1032738494 7:134714366-134714388 CAGAGGAAGGACAAGTCGGCTGG - Intergenic
1032855569 7:135830761-135830783 CAGAGAAAGGAGAAAGCAGAAGG + Intergenic
1033046487 7:137967098-137967120 CAGGGCAAAGAGGAGTGGGAAGG - Intronic
1033449148 7:141447537-141447559 CAGAGCAAGCAGAATGCGGATGG - Intronic
1033790791 7:144790570-144790592 CAGAGCAGGAAGAAGTGGCAGGG + Intronic
1034337749 7:150334332-150334354 CAGAGGGAGGAGAACACGGAAGG - Intronic
1035368531 7:158363716-158363738 GAGAGCCAGGAGAGGTCGGGAGG + Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1037763937 8:21760139-21760161 TAGAGGAAGTAGAAGTCAGAGGG + Intronic
1037915555 8:22770708-22770730 CTGATCAAGGAGAGGTGGGATGG - Intronic
1042596804 8:70458171-70458193 CAGAGCCAGGAGAACACAGAGGG - Intergenic
1042719517 8:71812276-71812298 GAGAGAAAGGAGAAGGCTGAAGG - Intergenic
1042759581 8:72256761-72256783 GAGAGCAAGGAAAAGTAGGGTGG + Intergenic
1045105388 8:98887760-98887782 CAGAGCAAGGAGCAGTCAGCAGG + Intronic
1045885538 8:107093458-107093480 CCAAGCAAGGACAAATCGGATGG + Intergenic
1046537309 8:115531840-115531862 CAGAGCATGAAGACGTCTGATGG + Intronic
1047254838 8:123207149-123207171 CAGAGCCAGGTGAAGCTGGAGGG - Exonic
1049537494 8:143189098-143189120 CACAGCAGGGAGAGGTAGGAGGG - Intergenic
1050488665 9:6163729-6163751 GTGAGCAAGGATAAGTAGGAAGG + Intergenic
1051189118 9:14492559-14492581 CAGAGCAGGAAGAAGAGGGAGGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1053278556 9:36801476-36801498 AAGAGCAAAGAGAAGATGGAAGG + Intergenic
1055177685 9:73340260-73340282 CAGAGAAAGGAAAGGTCAGAGGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056737187 9:89219971-89219993 CAGAGCAATGAAAAGCCAGAGGG + Intergenic
1057508406 9:95656186-95656208 CAGAGCATGGAGAATTCTTAGGG - Intergenic
1059588813 9:115635251-115635273 CAGAGGAAGGAGCAGTAGGTGGG - Intergenic
1061208406 9:129177304-129177326 CAGTGCAAGCCGAAGTCCGAAGG + Exonic
1061482324 9:130903249-130903271 CAGAGGCAGGAGAAATGGGATGG + Exonic
1062123625 9:134847875-134847897 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1062497923 9:136840361-136840383 AAGAGCAAGGACAAGGAGGAGGG + Exonic
1186497638 X:10024586-10024608 CAGAGCAAGGACATCTCGAAAGG + Intronic
1189554041 X:42123767-42123789 CTGAGCAAGTAAAAGTCGAAGGG + Intergenic
1190009406 X:46771058-46771080 TAGAGCAGGGAAAAGTGGGAAGG + Intergenic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190417447 X:50193988-50194010 GAAATCAAGGAGAAGTTGGAAGG - Exonic
1191840368 X:65509461-65509483 CAGAACAAGGAGTAGAAGGAAGG - Intergenic
1192240298 X:69323064-69323086 CAGAGCAAGGAAAGGCAGGAGGG + Intergenic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192829426 X:74735754-74735776 CAGAGTAACAAGAAGTCAGAAGG + Exonic
1193190456 X:78564041-78564063 TAGAGCAAGGAAAAGCAGGATGG - Intergenic
1193547427 X:82846920-82846942 CAGAGCAGGAGGAAGTGGGAGGG - Intergenic
1194177145 X:90664990-90665012 GAGAGCAAGGAAAAGCAGGATGG + Intergenic
1194995648 X:100588935-100588957 CAGAGCAATGAGGAGTGGTAGGG + Intronic
1195353759 X:104018890-104018912 CTGATCCAGGAGAAGTCGAACGG - Intergenic
1195435996 X:104843688-104843710 GAGAGCAAGCAGAAGCAGGATGG - Intronic
1196011046 X:110888374-110888396 AAGAGCAAGGAATAATCGGAAGG - Intergenic
1199785640 X:151102563-151102585 CAGAGCAAGCAGAGGTCAGGTGG - Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1201595196 Y:15660488-15660510 CAAAGCAAGAAGAAGGGGGAAGG - Intergenic