ID: 924657944

View in Genome Browser
Species Human (GRCh38)
Location 1:245990432-245990454
Sequence GACCAAAAGGAAGTAGGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 303}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924657944_924657947 11 Left 924657944 1:245990432-245990454 CCTACTCCTACTTCCTTTTGGTC 0: 1
1: 1
2: 1
3: 32
4: 303
Right 924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 123
924657944_924657949 22 Left 924657944 1:245990432-245990454 CCTACTCCTACTTCCTTTTGGTC 0: 1
1: 1
2: 1
3: 32
4: 303
Right 924657949 1:245990477-245990499 TAAAATTTCTGGATCTGACATGG 0: 1
1: 0
2: 3
3: 20
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924657944 Original CRISPR GACCAAAAGGAAGTAGGAGT AGG (reversed) Intronic
902830760 1:19010770-19010792 GGCCAAAAGAAAGGAGGAGTGGG + Intergenic
903557474 1:24204197-24204219 GACCAAGAGGCAGTAAGAGGTGG + Intergenic
904171629 1:28595368-28595390 GAAGAAAAGGAAGCAGGATTGGG - Exonic
905602823 1:39268908-39268930 CTCCAAAAGGAAGACGGAGTGGG + Intronic
906483726 1:46218900-46218922 GGCCAAAAGGAGGCAGGAGCTGG - Intronic
907325485 1:53635711-53635733 GACCACAAGAAAGAAGGAGGAGG + Intronic
907561493 1:55393956-55393978 AACCAAAAGGGAATAGGAGTGGG - Intergenic
910339658 1:86171495-86171517 GAACAAAGGGAAGCTGGAGTAGG + Intergenic
910857868 1:91714080-91714102 GACCAGAAGTGAGTAGGAGAAGG + Intronic
911231345 1:95364781-95364803 GACCAGAGGGCAGGAGGAGTGGG + Intergenic
911406672 1:97449393-97449415 GAGAAAGAGGAAGAAGGAGTAGG + Intronic
912222251 1:107691346-107691368 TACCAAAAGGAAGTAAAAATGGG - Intronic
912503600 1:110139673-110139695 GACCCAAAGGAAATAGAAGGAGG - Intergenic
913524804 1:119680471-119680493 GACCAAATGGATCTAGTAGTGGG + Intronic
914349304 1:146826592-146826614 GGCAGAAAGAAAGTAGGAGTAGG - Intergenic
915886374 1:159726382-159726404 GACCAACAGGAGGTAGTAGGGGG - Intergenic
916903031 1:169251289-169251311 AACCAAAAGTGAGCAGGAGTAGG - Intronic
917641859 1:176990523-176990545 GGGCAAAAGGAAGTAAGAGGGGG + Intronic
918326495 1:183416340-183416362 AACCAAGAGAAAGGAGGAGTAGG - Intronic
918718457 1:187822208-187822230 AACCAAAAGCAAGCAGGAGTAGG - Intergenic
919345184 1:196366645-196366667 GAGCACAAGGATGTAGCAGTGGG - Intronic
920749219 1:208658356-208658378 GACCAACAGGAGGAAGGGGTTGG + Intergenic
920895760 1:210048262-210048284 GATCAAAAAGATGTGGGAGTCGG - Intronic
920967274 1:210711568-210711590 GACCTGAAGGAAGTAAGAGCTGG - Intronic
921333307 1:214062143-214062165 GACCAGAAGGAAGTAGGCAACGG - Intergenic
922403270 1:225283358-225283380 TACCACAAGAAAGTTGGAGTGGG + Intronic
924124789 1:240839111-240839133 GCTCAAAAGGCATTAGGAGTTGG - Intronic
924195427 1:241602260-241602282 CACCACAAGAAAGTAGAAGTTGG + Intronic
924657944 1:245990432-245990454 GACCAAAAGGAAGTAGGAGTAGG - Intronic
1064166504 10:12991213-12991235 GATCAAAAGCAAATAGGAATGGG - Intronic
1064708419 10:18096775-18096797 AACAAAAAAGAAGTAGGGGTTGG + Intergenic
1065038728 10:21668285-21668307 GACCAGAAGGAGGTGGGAGATGG - Intronic
1066009490 10:31181348-31181370 GAAGAAAAGGAAGCAGGACTGGG + Intergenic
1067130791 10:43563679-43563701 GACAAAAATGAAATAGGAGATGG - Intronic
1067437782 10:46290446-46290468 TACCAAAAAGAAGTGAGAGTAGG - Intronic
1068506965 10:57913206-57913228 GAGGAAATGGAAGTAGGATTTGG - Intergenic
1068972631 10:62975448-62975470 GAGTAAAAGGAGCTAGGAGTAGG + Intergenic
1069616286 10:69808362-69808384 GAGCAACAGGAAGTTGGAGCAGG - Intronic
1070152344 10:73812400-73812422 TACCCAAAGGGAGTAGGAGGAGG + Intergenic
1071417849 10:85457871-85457893 GACCACAATGAAGTAGAAGTAGG - Intergenic
1071761488 10:88612561-88612583 CACCAAAAGCTAGCAGGAGTAGG + Intergenic
1072009177 10:91288513-91288535 GACCAAAAGGAAAGAAGAATTGG - Intergenic
1072113548 10:92346777-92346799 AACAAAAAGGAAGTAGGGGTTGG - Intronic
1073907512 10:108300140-108300162 GACCAGAAAGAGGTTGGAGTAGG + Intergenic
1074007295 10:109440104-109440126 GACAAAAGGGAACAAGGAGTAGG + Intergenic
1074635528 10:115311920-115311942 AACCAAAAGCAAGCAGGAGTAGG - Intronic
1075990066 10:126828584-126828606 AACCAAAAGTAAGCAGAAGTAGG + Intergenic
1077318874 11:1932002-1932024 GGCCCAAAGGAAGGAGGAGAGGG - Intronic
1077813080 11:5658329-5658351 GGCCAGAAGGAAGATGGAGTAGG - Intergenic
1081586106 11:44384908-44384930 GCCCAGAAGGAAGGAAGAGTTGG - Intergenic
1082762101 11:57136938-57136960 GAGGAAAAGGAAGGAGGAGGAGG + Intergenic
1083067332 11:59938750-59938772 GATCAAAAGGAAAGGGGAGTTGG - Intergenic
1088286849 11:108198988-108199010 ACCCAACAGGAAGCAGGAGTGGG + Intronic
1089205017 11:116753105-116753127 GACCAAAAGTAAGTATGAACTGG + Intronic
1089793592 11:120962424-120962446 GAACAAAAGGAAGCAGGATTGGG - Intronic
1090377883 11:126304156-126304178 GAGGAAAAGGAGGCAGGAGTTGG + Exonic
1090565722 11:127989948-127989970 GACCAAAAGGAAGGCTGAGAAGG - Intergenic
1092092525 12:5814500-5814522 GATGAAAATGAAGTGGGAGTGGG - Intronic
1095930002 12:47615873-47615895 GACCATGAGGAAGGAGGACTGGG + Intergenic
1098495924 12:71135492-71135514 GAAGAAAAGGAAGAAGGAGGAGG + Intronic
1098790308 12:74814695-74814717 GAACAAAAGGGAGTAGAAGCAGG + Intergenic
1099914908 12:88880866-88880888 AACCAAAAAGAAGGAGGAGGAGG + Intergenic
1099915021 12:88882307-88882329 AACCAAAAAGAAGGAGGAGGAGG + Intergenic
1100420773 12:94430937-94430959 AACTAAAAGGGAGCAGGAGTAGG + Intronic
1100987205 12:100213653-100213675 GACCAAACAGAAGTAGAATTTGG - Intronic
1101192705 12:102351679-102351701 GACCCAAGGGCAGGAGGAGTTGG - Intergenic
1102574696 12:113849044-113849066 GGCCAAAAGGAAGAAGGAGAAGG - Intronic
1102727901 12:115081676-115081698 GAAAGAAAGGAAGCAGGAGTGGG + Intergenic
1102936036 12:116897863-116897885 GAAGAAAAGGAAGGAGGATTTGG - Intergenic
1103466232 12:121144038-121144060 CACCAGGAGGAAGTGGGAGTGGG - Intronic
1104124596 12:125834298-125834320 GACAAAAAGGAAATAGAATTGGG - Intergenic
1104130643 12:125890578-125890600 CACCAGAAGAAAGTAGGAGCTGG - Intergenic
1104159085 12:126161506-126161528 GAAGAAAAGGAAGCAGGAGTGGG + Intergenic
1105666773 13:22568018-22568040 AACCAAAAGGAAGCTGAAGTAGG - Intergenic
1106281671 13:28279420-28279442 GACTAAAAGGGGGTAGGTGTGGG - Intronic
1106977948 13:35245110-35245132 CACCAAAAGTGAGCAGGAGTAGG - Intronic
1107888818 13:44896335-44896357 GAACAAAAGGGAGGAGGAATTGG - Intergenic
1108352138 13:49597334-49597356 GAACAAAAGGAAATAGGATTGGG - Intergenic
1114803416 14:25805530-25805552 GAATAAAATGAAGTAGCAGTAGG - Intergenic
1115095385 14:29629956-29629978 GAGGAAAAGGAAGAAGGAGAAGG - Intronic
1115900968 14:38147957-38147979 GACAAAAAAGAAGTAGGGGTTGG - Intergenic
1116621459 14:47209401-47209423 GACCTAAAGGCAGTAGGAACAGG + Intronic
1118461466 14:65990979-65991001 GACCAATAGGAGGTAGGAAGAGG - Intronic
1118971335 14:70641144-70641166 GACCAAAAGAAGGAAGGAATGGG + Intergenic
1119911156 14:78350429-78350451 CAACAAAAGCATGTAGGAGTTGG + Intronic
1120308070 14:82795786-82795808 GAACTAAAAGAAGTAGAAGTAGG - Intergenic
1120345372 14:83282275-83282297 GAAGAAAAAGAAGTAGGAGGAGG + Intergenic
1120935807 14:89893697-89893719 GAAGAAAAGGAAGCAGGATTGGG - Intronic
1121403773 14:93705551-93705573 GACCAAAAGGAAGAGTGACTTGG + Intronic
1122732692 14:103812932-103812954 GAGCAAAAGGAACTTGCAGTTGG + Intronic
1124990588 15:34669562-34669584 GAGGAAGAGGAAGTAGTAGTGGG + Intergenic
1125736371 15:41929196-41929218 ATCCCAAAGGAAGGAGGAGTGGG - Intronic
1126802695 15:52314326-52314348 GACCAGAAGGAAGGAGGAGCTGG + Intronic
1127625486 15:60776205-60776227 GAGAGAAAGGGAGTAGGAGTTGG - Intronic
1128242889 15:66113447-66113469 GACCAAAAGGAAACAGGAGACGG + Intronic
1128438352 15:67678524-67678546 GACCAAAAGGAAGTAGAAGTTGG + Intronic
1128506829 15:68278387-68278409 GACCAAACGGGTGTTGGAGTTGG + Exonic
1128741424 15:70086420-70086442 GACCAAAAGGTTGGAGGAGGCGG - Intronic
1128822904 15:70677363-70677385 GACCAAGAACAAGTAGGACTTGG - Intronic
1128824189 15:70695668-70695690 GAACAAAAGGAAGAATTAGTTGG - Intronic
1128876473 15:71205523-71205545 AACCAAAATAAAGGAGGAGTGGG - Intronic
1129309849 15:74699331-74699353 AATCAAAAGAAAGCAGGAGTAGG - Intergenic
1130042717 15:80418518-80418540 GAGGACAAGGAAGGAGGAGTGGG - Intronic
1132363918 15:101242219-101242241 GACCAAAGAAAAGTAAGAGTAGG + Intronic
1133606337 16:7391778-7391800 GACTAAAAGGAAGAGTGAGTCGG + Intronic
1134218634 16:12335952-12335974 GACCCACAGGAAGCAGGAGAGGG - Intronic
1134743188 16:16566529-16566551 GAACAAGAGGAAGAAGGAGAAGG - Intergenic
1134924372 16:18145931-18145953 GAACAAGAGGAAGAAGGAGAAGG + Intergenic
1137953248 16:52803612-52803634 GACGAAGAGGAAGAAGGAGGAGG + Intergenic
1138561996 16:57806677-57806699 TACCAAAAGGAAGTAAGAGAAGG + Intronic
1138712923 16:58989224-58989246 AACCAAAAGCATGCAGGAGTAGG + Intergenic
1139328616 16:66170586-66170608 TACCATAAGGAAATAGGAGGAGG + Intergenic
1139984732 16:70888962-70888984 GGCAGAAAGAAAGTAGGAGTAGG + Intronic
1140451239 16:75072373-75072395 TCCCAAAAGTAACTAGGAGTGGG - Intronic
1142750177 17:1982804-1982826 GACCCAGAGGAAGGAGGAATGGG + Intronic
1142999781 17:3785649-3785671 GACCTAAAGGAAGTACGGGAAGG + Intronic
1143575836 17:7792585-7792607 GAGGGAAAGGAAGTGGGAGTTGG + Intronic
1143707373 17:8708177-8708199 GACCAGAAGGAATTTGGAATGGG + Intergenic
1146184986 17:30718962-30718984 GACCAAAAGGAAGATGCAGGAGG + Intergenic
1146792514 17:35760372-35760394 GTCCAGTAGGAAGTAGGACTCGG - Intronic
1146826846 17:36030519-36030541 GACAAAAAGGAAAAAGGGGTGGG - Intergenic
1148536455 17:48443041-48443063 GAGCAAACGGAAGTGGGAGTGGG - Intergenic
1148617225 17:49010204-49010226 GACCAGAGGGAAGGAGGAATGGG - Intronic
1150270018 17:63857917-63857939 CATCAAAGGGAAGTAGAAGTGGG - Intergenic
1150557372 17:66266563-66266585 GAACAAAAGGCAGAAGGAGGAGG - Intergenic
1151158543 17:72145050-72145072 GAAGAAGAGGAAGTAGGAGGAGG - Intergenic
1154497804 18:14975193-14975215 GACCAATGGGAAGCAGGAGAAGG - Intergenic
1157300475 18:46475239-46475261 CACCAAAAGGCAGGAGGAGGAGG + Intergenic
1157311700 18:46557598-46557620 GACCCAAAGCAACCAGGAGTGGG + Intronic
1159245360 18:65798585-65798607 GAAAAGAAGGAAGTAGGATTGGG + Intronic
1160337255 18:78053709-78053731 GACCAAAAGGCAAAAGGAGACGG - Intergenic
1160822565 19:1065318-1065340 GAGCAGAAGGAGGCAGGAGTGGG + Exonic
1162973790 19:14196727-14196749 GACCAAAAGGAAGATGCAGGAGG - Intronic
1163765267 19:19160301-19160323 AACCAAAAGGAAGAAGGTCTGGG + Intronic
1165184888 19:34009629-34009651 GCCCAAAAGAAAGCAGGAATAGG + Intergenic
1165358291 19:35317711-35317733 GACCAGAAGGAAGTAAGGGAGGG + Intergenic
1166347390 19:42175199-42175221 GGCCACAAGGAAGTAGGGGGTGG + Intronic
1167277763 19:48549229-48549251 GACCAGAAGGATGAAGGAGTGGG - Intergenic
1167368898 19:49069110-49069132 GACCCAAAGGAAATAGCAGTGGG - Exonic
925142172 2:1558081-1558103 GACCGGAAGGAGGCAGGAGTGGG - Intergenic
925142180 2:1558109-1558131 GACCGGAAGGAGGCAGGAGTGGG - Intergenic
925142188 2:1558137-1558159 GACCGGAAGGAGGCAGGAGTGGG - Intergenic
925142196 2:1558165-1558187 GACCGGAAGGAGGCAGGAGTGGG - Intergenic
925142204 2:1558193-1558215 GACCGGAAGGAGGCAGGAGTGGG - Intergenic
925142212 2:1558221-1558243 GACCGGAAGGAGGCAGGAGTGGG - Intergenic
925142220 2:1558249-1558271 GACCGGAAGGAGGCAGGAGTGGG - Intergenic
925142293 2:1558653-1558675 GATCAGAAGGAGGCAGGAGTGGG - Intergenic
925142299 2:1558681-1558703 GATCAGAAGGAGGCAGGAGTGGG - Intergenic
925142305 2:1558709-1558731 GATCAGAAGGAGGCAGGAGTGGG - Intergenic
925298208 2:2792304-2792326 GACAAAAAGGAAGCAGGGGTGGG + Intergenic
925436879 2:3846150-3846172 GACGAAGAAGAAGTAGGAGGAGG - Intronic
927061510 2:19427167-19427189 GAAGAAAAGGAGGTAGGAGATGG + Intergenic
931801277 2:65760461-65760483 AACCCAAAGGAAGAAGGAGTAGG + Intergenic
932004710 2:67916513-67916535 GAGAAAAAGGAAGAAGGAGTTGG - Intergenic
932616234 2:73233358-73233380 GACCAATAGGAAGTAGGCTAAGG - Intergenic
935511024 2:103974260-103974282 CACCAAAAGAAAGTTAGAGTGGG + Intergenic
936483736 2:112908663-112908685 GGCCAAAAGGAAGTAAAAGCTGG - Intergenic
936496450 2:113026102-113026124 GACCAATGGGGAATAGGAGTGGG - Exonic
936855531 2:116953251-116953273 GACCAGAAGGAAGGAGGGGGAGG + Intergenic
939388560 2:141534898-141534920 GACAAAAAGGAAGTAGTGGGGGG - Intronic
941995999 2:171602535-171602557 GATGAGAAGGAAGTAGGAGAAGG - Intergenic
942122393 2:172791206-172791228 GACCAAATAGCAGAAGGAGTAGG + Intronic
942347510 2:175018492-175018514 GACCAAAAGAAAGGAGCAATAGG - Intergenic
943188133 2:184640176-184640198 GAAAAAAAAGAAGTAGGAGGAGG + Intronic
943537054 2:189165866-189165888 GGCCTACAGGCAGTAGGAGTAGG - Intronic
944127249 2:196308102-196308124 CACCGAAAGGAATTAGGAGGAGG + Intronic
945722949 2:213441491-213441513 GACAAAATGGAATCAGGAGTTGG + Intronic
946022184 2:216648337-216648359 GACCCAAAGGTAGTAGAAGAGGG - Intronic
946180984 2:217948749-217948771 GGCCAGAAGGAGGCAGGAGTAGG + Intronic
947091910 2:226521416-226521438 GAGCAAAAGGGAGAAAGAGTTGG + Intergenic
947460699 2:230301957-230301979 CACCAAAAGCGAGCAGGAGTAGG + Intronic
948256710 2:236573873-236573895 GAGCAAATGGAGGTAAGAGTTGG - Intronic
1170099777 20:12686374-12686396 GACCAAAAGGAAAGGGGAGAGGG - Intergenic
1170755775 20:19205741-19205763 GACCAGCAGGCACTAGGAGTTGG - Intergenic
1170832890 20:19858875-19858897 GACCAGAACAAAGCAGGAGTTGG + Intergenic
1171472466 20:25383021-25383043 GAGCAAAAGGAAAAAGGAGATGG + Intronic
1172719240 20:36986671-36986693 GACCAAAAAGAAGCAAAAGTAGG - Intergenic
1173942811 20:46926497-46926519 GAACAAAAGGAAGAAGAAGAAGG - Intronic
1174887180 20:54348716-54348738 GACCAGAAGGAGGTAAGAGAGGG + Intergenic
1177161100 21:17548900-17548922 GACCAAAAGAAAGAAGGGTTAGG + Intronic
1177564110 21:22796215-22796237 GACCAGAAGGGAGATGGAGTAGG + Intergenic
1177823200 21:26054522-26054544 GTCCAGAAGGAAGTAGCACTGGG + Intronic
1179290601 21:40014708-40014730 AAGCAAAAGGAAGCAGGAGGTGG - Intronic
1182960093 22:34463829-34463851 CACCAAAAAGGAGGAGGAGTTGG + Intergenic
1184853163 22:47132331-47132353 GATCGGAAGGAAGCAGGAGTAGG - Intronic
949247548 3:1942779-1942801 GAACAAAAGAAAGAAGGAGGAGG + Intergenic
951468003 3:23022690-23022712 CACCAAAAGCAAGAAGGAGTAGG + Intergenic
951534679 3:23729878-23729900 GGACAAAAGGAAGCAGGAGTGGG - Intergenic
951560549 3:23961792-23961814 GCACCAAAGGAAGTAGGAGAGGG - Intronic
955239761 3:57168290-57168312 GACAGAAAGGGAGCAGGAGTGGG - Intronic
955689575 3:61578125-61578147 CACCAACAGGAACTAGGAGAGGG - Intronic
956225368 3:66951477-66951499 GACCAAGAGGTCTTAGGAGTAGG - Intergenic
956292015 3:67670466-67670488 CAGCAAAAGGAAGAAGTAGTTGG + Intergenic
956370168 3:68550408-68550430 GACCAAAAGGAAGCAGTATAAGG + Intergenic
956540535 3:70333170-70333192 GTCCACAAGGAAGAACGAGTGGG - Intergenic
957744483 3:84321235-84321257 GGCCAATAGGAAAAAGGAGTGGG + Intergenic
959659535 3:108850623-108850645 AACCAAGATGTAGTAGGAGTTGG + Intronic
959916581 3:111823144-111823166 GACCAGGAGGAAGTGGGAGTTGG + Intronic
961423824 3:126829416-126829438 GACCAAAGGCAAGCAGAAGTTGG - Intronic
961427048 3:126856582-126856604 GAAGCAAAAGAAGTAGGAGTGGG + Intronic
967781040 3:193439894-193439916 GAGCAGAAACAAGTAGGAGTCGG + Intronic
969139457 4:5055763-5055785 GACCCGAAGGAAGTGAGAGTGGG - Intronic
969236655 4:5870161-5870183 GGCCCAAAGCAAGTAGGAGCAGG - Intronic
971298115 4:25418414-25418436 GGCCAAAAGGACATAGGAGATGG + Exonic
972015861 4:34244678-34244700 GACCACAAAGAAGGAGGAGGAGG - Intergenic
972326073 4:38016430-38016452 GACCTAAAGGAAGCAAGAGGAGG - Intronic
972763185 4:42127206-42127228 GAATAACAGGAAGTAGGAGTAGG + Intronic
973083527 4:46025965-46025987 TACCAAAAGGGAACAGGAGTAGG + Intergenic
973589598 4:52427437-52427459 GACCAAAAGGTGGCAGCAGTCGG - Intergenic
976392676 4:84521987-84522009 GTCCACAAGGCAGTAGGTGTAGG + Intergenic
976727368 4:88227764-88227786 GACCAAAACAAAGTAGAAATAGG + Intronic
979029983 4:115631646-115631668 CACCAAAAGTGAGCAGGAGTAGG - Intergenic
979144703 4:117229520-117229542 GAGCAGAAGGGAGTAGAAGTGGG + Intergenic
979352619 4:119662899-119662921 GAGCAGAAGGAAGTTGGGGTGGG - Intergenic
981006212 4:139878216-139878238 GACCAAGAATGAGTAGGAGTTGG - Intronic
982806948 4:159777894-159777916 GAATAACAGGAAGTGGGAGTGGG - Intergenic
983884306 4:172963231-172963253 GACCAGAAGGAAGTAAGGGCGGG - Intronic
984599659 4:181711764-181711786 AGCCAAGAGGAAGTGGGAGTGGG - Intergenic
984700200 4:182814180-182814202 GCCCAGATGGAAGTAGGAGTGGG + Intergenic
985038086 4:185861428-185861450 GACCAAAAGGAAGCTAGTGTAGG + Intronic
986884393 5:12215919-12215941 TCCCAACAGGAAGTAGAAGTAGG + Intergenic
987550453 5:19373200-19373222 GAGCAAGAGAAAGAAGGAGTAGG + Intergenic
989343233 5:40400559-40400581 GGCCAAAAGGATGTGGGGGTGGG + Intergenic
990917105 5:60919570-60919592 GAAAAAAAGGAAATATGAGTAGG - Intronic
991253015 5:64584696-64584718 GGCCAAAGGGCAGTAGGAGAAGG + Intronic
992681380 5:79156832-79156854 GCCAAAAAGGAGGTAGGAGAAGG - Intronic
993252705 5:85549524-85549546 GACCAAAAAGAAGGTGGAGATGG + Intergenic
995722716 5:115153213-115153235 CACCAAAAGCCAGCAGGAGTAGG + Intronic
996573783 5:124960803-124960825 GGCCAGAATGAAGTAGGAGGTGG - Intergenic
997050635 5:130375582-130375604 GTCCAGAAAGAAGTATGAGTAGG - Intergenic
997662390 5:135599546-135599568 GAACAACTGGAAGCAGGAGTGGG + Intergenic
997691581 5:135831038-135831060 GATCTGAAGGAGGTAGGAGTCGG + Intergenic
998395938 5:141818029-141818051 GAGCTAAAGAAAGTAGGATTTGG + Intergenic
998874405 5:146584763-146584785 GAACAAAAGGAAAAAGGGGTAGG + Intronic
999217253 5:149945606-149945628 CACCAAGAGAAAGTTGGAGTGGG - Intergenic
999366784 5:151028652-151028674 GCCCTTCAGGAAGTAGGAGTGGG - Exonic
999629865 5:153559861-153559883 GAACTCAAGGAAGTAGGAGCTGG - Intronic
1000444809 5:161306435-161306457 AAACAAGAGGAGGTAGGAGTAGG - Intronic
1001354890 5:171009851-171009873 GATCAAAAGTAGGTAGGAATTGG + Intronic
1001538349 5:172516514-172516536 CATCAAAAGAAAGTGGGAGTAGG + Intergenic
1003711773 6:8600875-8600897 CACCAAAAGCAAGCAGGGGTAGG - Intergenic
1007637218 6:43306728-43306750 GATGAAAAGGAAGCAGGAGAAGG - Intronic
1007787678 6:44290627-44290649 GGCCAAAACCAAGCAGGAGTTGG - Intronic
1007896843 6:45371299-45371321 GACCAAAAAGAAAAAGGACTGGG + Intronic
1007917257 6:45573041-45573063 AACCAGAAGGAAGGAAGAGTTGG - Intronic
1008237801 6:49071087-49071109 GAATAAAAGGAAGAAAGAGTTGG - Intergenic
1010089196 6:71959949-71959971 GACCAAAAGCATGTGGGATTCGG + Intronic
1010745684 6:79558899-79558921 CACTAAAAGGAAGCAGGAGGAGG + Intergenic
1011332223 6:86222772-86222794 AACCAAAAGCAAGCAAGAGTAGG - Intergenic
1011720580 6:90151756-90151778 AGCCATAAGGAAGTTGGAGTTGG - Intronic
1011872207 6:91910157-91910179 GATGAAAAGGAAGGAGGAGGAGG - Intergenic
1012850052 6:104435896-104435918 GGCAAAAAGGAAAAAGGAGTGGG - Intergenic
1013091992 6:106908421-106908443 GTGCAAAAGGAAGCTGGAGTGGG - Intergenic
1013360070 6:109385612-109385634 GACCTCAAACAAGTAGGAGTTGG - Intergenic
1013685629 6:112578240-112578262 GAGGAAAAGGAAGCAGGATTGGG + Intergenic
1014528101 6:122524374-122524396 GAAGAAAAGGAAGGAGGAGGAGG - Intronic
1015312390 6:131780005-131780027 GACCCAAAGGAAGTGAGAATAGG + Intergenic
1015421142 6:133010211-133010233 GACAAAAACGAAGAAGGAATAGG - Intergenic
1017089482 6:150745912-150745934 GAACAAAAGGAAGCAAGAGAGGG + Intronic
1017119102 6:151007116-151007138 GACCAAGAGGAGGAAGGAGAGGG - Intronic
1017636568 6:156449745-156449767 GAACTAAAGGAAGTAGGGTTGGG + Intergenic
1019261809 7:86130-86152 GAGCTCAAGGTAGTAGGAGTGGG - Intergenic
1019404671 7:877225-877247 GACGCAAAGGAAGAAGGAGAAGG - Intronic
1021403344 7:20235860-20235882 GAAAAAAAGGAAAGAGGAGTAGG + Intergenic
1021438398 7:20648786-20648808 AAAAATAAGGAAGTAGGAGTAGG - Intronic
1021666027 7:22981019-22981041 GATCCAAACGAATTAGGAGTTGG - Intronic
1023493767 7:40772171-40772193 CACCAAAAGTCTGTAGGAGTAGG + Intronic
1024940590 7:54759256-54759278 AACCAATAGGACGGAGGAGTGGG - Exonic
1025176030 7:56802936-56802958 GACCAATAGGAGGCAGGAGATGG + Intergenic
1026375563 7:69746941-69746963 GACCAAAAAGAAGGTAGAGTTGG + Intronic
1026413056 7:70146581-70146603 GACCAAATGGAGGTAGAGGTTGG - Intronic
1028635848 7:92988522-92988544 TACCAATAGAAAGTTGGAGTTGG - Intergenic
1030372328 7:108714625-108714647 AAACAAAAGTATGTAGGAGTAGG + Intergenic
1030570903 7:111222495-111222517 GACCAAAAAGAAAAATGAGTAGG + Intronic
1030736797 7:113058649-113058671 TTCCAAAAGTAAGTTGGAGTTGG - Intergenic
1030868492 7:114728817-114728839 GAGAGAAAGGAAGAAGGAGTGGG - Intergenic
1031261551 7:119527022-119527044 CACCAAAAGCCAGCAGGAGTAGG + Intergenic
1031910539 7:127512657-127512679 GGCCAAAATGAAGTAGGAGGTGG + Intergenic
1032882350 7:136103116-136103138 GACCAATAGGAAGTGGGTCTAGG - Intergenic
1035288220 7:157819636-157819658 TGCCAAAAGGAGGTAGGGGTGGG - Intronic
1035749532 8:1986348-1986370 CACAAAAAAGAAGTAGGAGACGG + Intronic
1036108596 8:5873306-5873328 CACCAAAAGCAAGCAGAAGTAGG - Intergenic
1036546484 8:9774895-9774917 GGATAAAAGGAAGTAGGGGTGGG + Intronic
1037077895 8:14744487-14744509 GAAAAAAAGGAAGTTGGAATGGG - Intronic
1039250655 8:35660697-35660719 GTCCACTAGGAAGGAGGAGTGGG + Intronic
1039454936 8:37699896-37699918 GACCAGAAGGAGGGAGGAGTGGG - Exonic
1040396410 8:47004689-47004711 AATCAAAAGAAAGCAGGAGTGGG - Intergenic
1040836450 8:51736553-51736575 GACAAACAGGAACAAGGAGTGGG - Intronic
1042431596 8:68712516-68712538 CACCAAAAGTGAGCAGGAGTAGG + Intronic
1042689463 8:71481817-71481839 GAGAAAAAGGAAGGAGGAGCAGG + Intronic
1042810544 8:72821151-72821173 GAGCAAAAGAAAGTCGCAGTGGG - Intronic
1043253921 8:78109200-78109222 AACCATAAGGAAGTGGTAGTGGG + Intergenic
1043337420 8:79193612-79193634 GACCACAAGGAACAAGGAGTGGG + Intergenic
1043587160 8:81782626-81782648 GACCAAAAAAAAGGAGGAGGGGG - Intergenic
1044494839 8:92864547-92864569 GACAAAAATGAAGTAGTAATGGG + Intergenic
1045089475 8:98726170-98726192 GACGAAAGGGAAGTAGAACTGGG + Intronic
1045321357 8:101084244-101084266 GAACAAAAGGAAGATGGGGTAGG + Intergenic
1047102058 8:121688233-121688255 GGCCAAAAACAACTAGGAGTTGG + Intergenic
1047559458 8:125970898-125970920 GAGCAAAAGCAAGTCAGAGTTGG + Intergenic
1047629257 8:126688995-126689017 GATCAGAAGGAAGTAGGTGAGGG - Intergenic
1047685708 8:127302927-127302949 GAGAAAGAGGAACTAGGAGTTGG + Intergenic
1047798165 8:128279308-128279330 CACCAAAAGCAAGCAGAAGTAGG + Intergenic
1048733556 8:137471791-137471813 GGCCTAAAGGAAATAAGAGTGGG - Intergenic
1050176937 9:2877988-2878010 GAAAAAAATGGAGTAGGAGTAGG - Intergenic
1050448069 9:5748240-5748262 GACTAAAAGAAACTAAGAGTGGG - Intronic
1050487937 9:6154675-6154697 AACCAAAACACAGTAGGAGTGGG + Intergenic
1050775686 9:9257230-9257252 GAGCAGAAGGAAGGAGGAGAGGG + Intronic
1052738429 9:32369626-32369648 GACGAAAAGGAAGGAAGAGGAGG + Intergenic
1054857461 9:69916235-69916257 GGCCAAAAGGAAGTGGGTGTGGG + Intergenic
1056956123 9:91082969-91082991 CTCCAAAAGGAAGAAGGAGGAGG - Intergenic
1057484915 9:95475405-95475427 GACCAAAAGGAAAGAGAAGAGGG + Intronic
1059280599 9:113130183-113130205 GAACAAATGGCAGTTGGAGTTGG - Intergenic
1059367911 9:113800971-113800993 GACCCACAGGCAGTAAGAGTTGG + Intergenic
1060030220 9:120208206-120208228 GTCCAACAGGCAGTGGGAGTTGG + Intergenic
1060434275 9:123580359-123580381 GACCACAGGGAAATAGGAGTCGG - Intronic
1060566887 9:124600858-124600880 GACCTGAAGGAAGAAGGAGAAGG + Intronic
1060698616 9:125731390-125731412 GAGGAAAAGGAAGCAGGAGGGGG - Intergenic
1186685338 X:11919438-11919460 GGCCAATAGGGAGTGGGAGTGGG + Intergenic
1187040781 X:15593469-15593491 AACCAAAGGGAAATAGGAGAAGG - Intronic
1188707116 X:33348221-33348243 GACCAAAAGAAAGCAGGAGTAGG - Intergenic
1189592982 X:42535181-42535203 GACCATAAGGAAGTATGAACAGG + Intergenic
1189595591 X:42562129-42562151 GACCAAGAGGAAGAAAGTGTTGG + Intergenic
1189863207 X:45294608-45294630 GAAGAGAAGGAAGCAGGAGTGGG + Intergenic
1190248700 X:48706934-48706956 GGCCAAAGGGAGCTAGGAGTGGG - Intronic
1190302552 X:49065128-49065150 GGCTAAAGGGACGTAGGAGTCGG - Intronic
1190490540 X:50978500-50978522 GACAAAAAGGAAAAAGGGGTGGG + Intergenic
1190955726 X:55191284-55191306 AACCAAAAGCAAGCAGGAGTAGG - Intronic
1193352138 X:80475627-80475649 GATCAAAACAAAGTAAGAGTTGG - Intergenic
1193921303 X:87430238-87430260 AACAAAAAGGAAATGGGAGTGGG - Intergenic
1194621348 X:96176239-96176261 GGCCAAAGGCAAGAAGGAGTTGG + Intergenic
1194940824 X:100008216-100008238 GATCAAAAGGAAATGGGGGTTGG - Intergenic
1194978247 X:100414195-100414217 GGGCAAAAGGAAGGAGGAGGAGG - Intergenic
1194986104 X:100491288-100491310 GACCAATGGGAAGTACTAGTGGG - Intergenic
1196172383 X:112603930-112603952 GAACGAAAGGAAGAAGGAGAGGG - Intergenic
1196901941 X:120392414-120392436 GCTCAAAAGAAAGAAGGAGTAGG + Intergenic
1199719668 X:150533688-150533710 CACCAAAATGTAGTAGGTGTTGG + Intergenic
1199903921 X:152206031-152206053 TACCAAAATGAAGTGGGAGTGGG + Intronic
1200795485 Y:7337604-7337626 GAGCAAAAGGAGATAGGAGCAGG + Intergenic