ID: 924657945

View in Genome Browser
Species Human (GRCh38)
Location 1:245990438-245990460
Sequence CTGTGTGACCAAAAGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924657945_924657947 5 Left 924657945 1:245990438-245990460 CCTACTTCCTTTTGGTCACACAG 0: 1
1: 0
2: 1
3: 19
4: 220
Right 924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 123
924657945_924657950 25 Left 924657945 1:245990438-245990460 CCTACTTCCTTTTGGTCACACAG 0: 1
1: 0
2: 1
3: 19
4: 220
Right 924657950 1:245990486-245990508 TGGATCTGACATGGTTTCAGTGG 0: 1
1: 0
2: 0
3: 11
4: 118
924657945_924657949 16 Left 924657945 1:245990438-245990460 CCTACTTCCTTTTGGTCACACAG 0: 1
1: 0
2: 1
3: 19
4: 220
Right 924657949 1:245990477-245990499 TAAAATTTCTGGATCTGACATGG 0: 1
1: 0
2: 3
3: 20
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924657945 Original CRISPR CTGTGTGACCAAAAGGAAGT AGG (reversed) Intronic
901453711 1:9351730-9351752 AGGTGTGAACAAAAGGAAGTTGG + Intronic
902324611 1:15691550-15691572 CTGTCTGCCCAAACCGAAGTGGG - Intronic
902954814 1:19918343-19918365 CTGTGCTAGCAAAAGGAAGGAGG - Intergenic
905993792 1:42363436-42363458 CTGTGTGTCCAAAAAGAAAGTGG - Intergenic
906580593 1:46932584-46932606 CTCTGTGTACAAAAGGAAGGTGG - Intronic
906603131 1:47146308-47146330 CTCTGTGTACAAAAGGAAGGTGG + Intronic
907390306 1:54153753-54153775 CTTTGTGTCCAACAGGAAGCGGG + Exonic
907603105 1:55789631-55789653 CTGAATCACCAAAAGCAAGTTGG - Intergenic
907647429 1:56258317-56258339 GTGTATGACCAAAATGAAATGGG + Intergenic
908596092 1:65690252-65690274 CTGTGTCTCCAACAGGAGGTGGG - Intergenic
911622604 1:100082339-100082361 CCGTGGGAACTAAAGGAAGTGGG + Exonic
911906548 1:103576249-103576271 CTGTGTGACTCAGAGGAAGGAGG - Intronic
911913152 1:103661399-103661421 CTGTGTGACTCATAGGAAGGAGG - Intronic
911915302 1:103690549-103690571 CTGTGTGACTCATAGGAAGGAGG + Intronic
911920565 1:103755537-103755559 CTGTGTGACTCATAGGAAGGAGG - Intronic
912132230 1:106617763-106617785 CTGTGTGGCAAAAAGTAAATGGG - Intergenic
913584570 1:120261377-120261399 CTTTGTGACCTAAAGATAGTGGG + Intergenic
913623613 1:120636982-120637004 CTTTGTGACCTAAAGATAGTGGG - Intergenic
914566566 1:148873233-148873255 CTTTGTGACCTAAAGATAGTGGG + Intronic
914606253 1:149257007-149257029 CTTTGTGACCTAAAGATAGTGGG - Intergenic
914978203 1:152386923-152386945 CTGTGTGCCCAGAACTAAGTAGG + Intergenic
915340952 1:155176303-155176325 GTGGGTTTCCAAAAGGAAGTGGG + Intronic
915366367 1:155319029-155319051 CTGTGTGACCTTGAGCAAGTCGG + Intronic
918623784 1:186635123-186635145 CTTTGTGACCAATAGAAAGTAGG + Intergenic
919599958 1:199610417-199610439 CTGAGTGAATAAAAGGAGGTAGG - Intergenic
922065624 1:222136893-222136915 TATTGTGACCTAAAGGAAGTCGG + Intergenic
922349889 1:224726666-224726688 GTTTGTGATCAAAGGGAAGTTGG - Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
923723273 1:236485193-236485215 CTGGGTAACCAAAAGGGATTTGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1065145894 10:22767811-22767833 TTGGGTCACCAAAAGGAAGATGG - Intergenic
1067038714 10:42936971-42936993 CTGGGAGACCATAGGGAAGTGGG + Intergenic
1067131291 10:43567826-43567848 TTTTGTGTCAAAAAGGAAGTAGG + Intronic
1068792993 10:61047802-61047824 CTCTGTGACCAATAGTAAGTTGG - Intergenic
1070578844 10:77703404-77703426 CTGTGTGACCACATGGCAGAAGG - Intergenic
1070637727 10:78142549-78142571 CTGTAAAACCAAAAGCAAGTTGG - Intergenic
1070789411 10:79180554-79180576 CAGTCTGGCCCAAAGGAAGTGGG + Intronic
1072705153 10:97675693-97675715 CTCTGTGATCAGAAGGAAATTGG + Exonic
1072937569 10:99728089-99728111 CTTTTTTACCAAAAGGAATTAGG + Intronic
1076305337 10:129462101-129462123 CTGGGTCACTAGAAGGAAGTGGG - Intergenic
1077773583 11:5247596-5247618 CTGTGAGATCAAAATGTAGTGGG - Intergenic
1079007841 11:16804593-16804615 CTGTGTGACCAAAGGGATCGTGG - Intronic
1080681251 11:34478163-34478185 CTGCGTGTCCAGAAGGCAGTAGG + Intergenic
1080925182 11:36748811-36748833 CTGTGTGGCCTTAAGCAAGTTGG - Intergenic
1080994255 11:37580802-37580824 CTGTGTGGGCAAAAGGAAAGAGG + Intergenic
1082873209 11:57962552-57962574 CTGTGTGATCAGAAGAAAATTGG - Intergenic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085799149 11:79571992-79572014 CTGTGTGATCTCAAGCAAGTTGG - Intergenic
1088455602 11:110030034-110030056 CCTTGTGAACAAAAGGAAATGGG + Intergenic
1089935870 11:122363460-122363482 CTGTAAGACCAAATGGAAGGAGG - Intergenic
1090223540 11:125053296-125053318 CTGTATGACACACAGGAAGTGGG + Intergenic
1090723903 11:129504450-129504472 CTTTGTAACCAAAAGGTGGTAGG - Intergenic
1091769958 12:3145103-3145125 CTGTGTGCTCACAAGGGAGTGGG - Intronic
1093242301 12:16692150-16692172 CTAAGTGACAAAAAGGATGTTGG - Intergenic
1096342894 12:50817154-50817176 CTGTGTGACTGAGAGGAACTTGG + Intronic
1098457169 12:70687661-70687683 TTGGGTGACCTAAAGGAAGTAGG + Intronic
1098652585 12:72991664-72991686 CTGTCTCACCAAAAGGATTTGGG - Intergenic
1099986028 12:89665409-89665431 CTGGGAGAGCAAAAGAAAGTAGG - Intronic
1101733641 12:107446572-107446594 CTATGTGACCAAAAGGAGCTCGG + Intronic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1104275943 12:127328011-127328033 TTGAGTGACCAAAAGAAGGTGGG - Intergenic
1104391181 12:128391716-128391738 CTGTGTGACCTAAAGCAAGGAGG - Intronic
1105064774 12:133186889-133186911 TTGTGTTACAAAAAAGAAGTGGG - Intronic
1106327932 13:28711991-28712013 CAGTGTGACCAAATAGAATTGGG - Intronic
1107088797 13:36453676-36453698 CTGTGTGGTTAAAAGGAAGCAGG - Intergenic
1108321948 13:49298308-49298330 CTGTGTCATCAAAAGGCAGGGGG - Intergenic
1108951717 13:56102570-56102592 GTTTGTGTCCAAAAAGAAGTAGG + Intergenic
1110689799 13:78419589-78419611 CTGTGTGACCATAAGGGCATTGG - Intergenic
1112472429 13:99701146-99701168 CTCTGTGACCAAAAGTACATAGG + Intronic
1114325529 14:21585050-21585072 ATGTGTGACAAAAATAAAGTGGG - Intergenic
1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG + Intergenic
1115694218 14:35879045-35879067 CTCTGTGACCGTGAGGAAGTGGG + Intronic
1115712572 14:36067182-36067204 CTGTGGGGGCAAAAGCAAGTTGG - Intergenic
1116976012 14:51116804-51116826 CTGAGTGTCCAAAAGTAAATTGG - Intergenic
1119103308 14:71900393-71900415 CTGGGAGACCAAAAGCCAGTAGG - Intergenic
1125077693 15:35638731-35638753 GTGGGTGACCAAAAGGAGCTTGG + Intergenic
1125176687 15:36830560-36830582 GTGTGTGAACAAGAGAAAGTTGG + Intergenic
1127051115 15:55085129-55085151 CTGTAAAACCAAAAGCAAGTTGG - Intergenic
1127892691 15:63269262-63269284 CTGTGAGACCAAGAGGAAGGAGG - Intergenic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128655952 15:69462244-69462266 CTCCGTGTCCAGAAGGAAGTGGG - Intergenic
1130867520 15:87945238-87945260 CTGTCTCACAAAAAGGAATTAGG - Intronic
1137582999 16:49645614-49645636 CTCTGTGACCAACAGGATTTTGG - Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1144334684 17:14258095-14258117 TTGTGTGAAGAAAAGGAAGGTGG - Intergenic
1144620714 17:16816765-16816787 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1144834302 17:18148898-18148920 CTCTGTGCCCACAATGAAGTAGG - Exonic
1145147293 17:20492995-20493017 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1146601815 17:34223917-34223939 CTGTGTGAGTAATAGCAAGTGGG - Intergenic
1147572104 17:41577663-41577685 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1149531190 17:57396770-57396792 CTGTGTGCACAAAGGGCAGTGGG - Intronic
1151053953 17:71010900-71010922 CTGTGTGACCTCATGTAAGTGGG + Intergenic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1151572450 17:74933646-74933668 CTCTGGGACCAGAAGGAAATGGG - Exonic
1152466177 17:80467868-80467890 CTGTGTTATCAAAAGCAAGAAGG + Exonic
1153341606 18:3980445-3980467 ATTTGTGTCCAAAATGAAGTGGG + Intronic
1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156519318 18:37708294-37708316 GTGTGAGGCCAAAAGGAAGCAGG - Intergenic
1157300473 18:46475233-46475255 CTGGGTCACCAAAAGGCAGGAGG + Intergenic
1160891500 19:1381005-1381027 CTGTGTGACCAACAGAATGGCGG - Intergenic
1161064103 19:2229123-2229145 CTTTGAGACCAGAAGGAAGTTGG + Intronic
1162153268 19:8660178-8660200 CTGTGTGACCCTAGGCAAGTCGG + Intergenic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1165891111 19:39112730-39112752 CTGTGTGACCATGGGCAAGTCGG + Intergenic
1168358713 19:55719684-55719706 CTGTCAGACCAAGAGGAAATGGG + Intronic
1168514548 19:57000714-57000736 CTATGTGGCCAAAAGAGAGTGGG + Intergenic
925581361 2:5414672-5414694 ACTTGTGACCAAAAGGAAATGGG + Intergenic
926551887 2:14310959-14310981 ATGTTTGACCTAAAAGAAGTTGG + Intergenic
928084345 2:28336511-28336533 CTGTGTGACCCCAAGGATGATGG + Intronic
928421016 2:31137993-31138015 CTGGGTAACCAAGAGGAAGTTGG - Exonic
928898152 2:36288486-36288508 ATGTATGTCCAAAAGAAAGTTGG + Intergenic
931706705 2:64952215-64952237 CTGTGGGACCCAGAGAAAGTGGG + Intergenic
932344413 2:70986197-70986219 CTCTGTGACCAAAAGAAAGGAGG + Exonic
932967416 2:76492826-76492848 TTTTGTTACCAAAAGGAAGTAGG + Intergenic
934521452 2:95022645-95022667 CTCTGGGAACACAAGGAAGTGGG - Intergenic
936607988 2:113976685-113976707 CTCCCTAACCAAAAGGAAGTTGG - Intergenic
937031943 2:118747957-118747979 CTGTGTGACCAAAACTGGGTTGG + Intergenic
942130273 2:172871913-172871935 CTGTGTGACTCCAAGCAAGTTGG - Intronic
942623892 2:177878097-177878119 CTGTGTGACCAGATGAATGTAGG + Intronic
942691285 2:178587952-178587974 GTGTGTGCCCAAAACCAAGTTGG - Exonic
944037164 2:195308968-195308990 CTCTGTGACCAACAGGGACTGGG + Intergenic
945420473 2:209630006-209630028 CTGTTTGACCAAATGGAGATAGG + Intronic
946980476 2:225208573-225208595 CTGTGTCACTAAAATGAATTGGG - Intergenic
947478446 2:230473548-230473570 CTGGATCACCAACAGGAAGTGGG + Intronic
1169003336 20:2184556-2184578 CTGTGAGAGCCAAAGGAAATGGG - Intergenic
1170212207 20:13856664-13856686 CTGTCTTTCAAAAAGGAAGTTGG - Intronic
1175142537 20:56871824-56871846 ATGGGTGATCAAAAGGAAGGCGG - Intergenic
1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG + Intergenic
1177036130 21:16045307-16045329 CTGTTTTGCCAAAAGGAGGTTGG - Intergenic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1179594047 21:42430505-42430527 CTGTGTGGCCAAGAGGGAGCAGG + Intronic
1183528822 22:38341118-38341140 CTCGGTGACGAAAAGGAAGGAGG - Intronic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
949168476 3:969470-969492 CTGTGTGACCCAGGGCAAGTCGG - Intergenic
949290665 3:2461844-2461866 CTGTGTGACCCTAAGCAACTTGG - Intronic
953505553 3:43482681-43482703 CTGTGTGACCAAAAAGGCCTTGG + Intronic
954574371 3:51667464-51667486 CTGAGAAATCAAAAGGAAGTGGG - Exonic
955714213 3:61811401-61811423 CTGTGGGACCAAAAGCAAGAGGG - Intronic
955808184 3:62758472-62758494 CAGTCTGACAAAGAGGAAGTGGG + Intronic
957967299 3:87338895-87338917 CTGTGTGACCCAAGGCAAATTGG - Intergenic
961003265 3:123388306-123388328 CTGTATGACCAACTGAAAGTGGG + Intronic
961797882 3:129422805-129422827 CTGTGAGACAAAAAGGAATGGGG - Intronic
962695701 3:137945230-137945252 ATGTGTGACCAACAGGATGGAGG + Intergenic
962996821 3:140636980-140637002 GAGTATGACTAAAAGGAAGTAGG - Intergenic
963932843 3:151022149-151022171 CTGGGAGACCTAGAGGAAGTTGG - Intergenic
964330086 3:155592582-155592604 CTCTCTGACCAAAGGGCAGTCGG + Intronic
964427795 3:156571406-156571428 CTGTGTGGACCAAAGGAAGTAGG + Intergenic
964451681 3:156818498-156818520 TTTTGTCACCAAAAGGAACTGGG - Intergenic
964956943 3:162370965-162370987 CTCTGTGACCACAAAGAAGAAGG - Intergenic
965473518 3:169125139-169125161 CTCTGTGAACAAAAGGTACTAGG + Intronic
965516083 3:169622474-169622496 GCGTGTGACCCAAAGTAAGTGGG - Intronic
965565146 3:170107966-170107988 ATGTGTGCCCAAAAGGTAGTAGG + Intronic
966155332 3:176910190-176910212 CAGTGTGACCAAGAGGGAGCAGG - Intergenic
966387912 3:179421202-179421224 CTGTGAGAGAAAAAGGAATTAGG - Intronic
966550050 3:181194817-181194839 CTGACTGACCAACTGGAAGTTGG + Intergenic
967596656 3:191332783-191332805 CTTGGAGAGCAAAAGGAAGTAGG - Intronic
971860568 4:32097824-32097846 ATGTGTAAGCAAAAGGAAATAGG - Intergenic
972137445 4:35909165-35909187 CTGTAAGATCAAAAGCAAGTTGG - Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
973819871 4:54653388-54653410 CTGTGTGACCAAAAGTATTGTGG - Intergenic
975494249 4:75020514-75020536 CTGTGTGGACAACAGGGAGTAGG - Intronic
977692164 4:99925402-99925424 CTTTGTGACCAAATGCAATTTGG - Intronic
981364792 4:143889876-143889898 CTGTGTGAACTTAAGCAAGTCGG - Intronic
982094820 4:151912156-151912178 CTGAGAGACCAAGAGGCAGTGGG + Intergenic
982103279 4:151989523-151989545 CTGTGTAACCACAGGGAAGCAGG - Intergenic
984297566 4:177872814-177872836 CTGTTTTACCCAAAGAAAGTTGG + Intronic
984957842 4:185063445-185063467 CTGTGTGAGTAAAAGAAACTTGG - Intergenic
985020866 4:185688689-185688711 CTGTGTTTACAAAATGAAGTAGG - Intronic
986111227 5:4720646-4720668 GGGTGAGACCAAAAGGAAGCAGG - Intergenic
986326974 5:6683297-6683319 CTCTGTGTCCAAAAGGTAGAAGG - Intergenic
986405860 5:7424380-7424402 CTGTGTGACTTTGAGGAAGTTGG - Intronic
993153764 5:84195473-84195495 TTGTGTGACCTAATTGAAGTAGG + Intronic
993479631 5:88408333-88408355 ATGTGTGACAAAAACGGAGTGGG + Intergenic
994613445 5:102074983-102075005 CTGTGTGCCCAAGAGGAAAAGGG - Intergenic
996993301 5:129663569-129663591 CTTAGTAACCAAAAGAAAGTGGG - Intronic
998772154 5:145557949-145557971 CTGTGAGAACAAAAGTAAGATGG + Intronic
1000167760 5:158671757-158671779 GAGTGTTACCAAAAAGAAGTTGG + Intergenic
1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG + Intronic
1003056690 6:2827145-2827167 TTAGGTGACCGAAAGGAAGTGGG - Intergenic
1008513425 6:52298084-52298106 CTGTGTGAGCAAAGGCAATTGGG - Intergenic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1008906318 6:56681267-56681289 CTGTGTTACCAATTGGATGTGGG - Intronic
1009584360 6:65578911-65578933 CTGTGTGACCATAAGAGAATGGG - Intronic
1010863055 6:80937519-80937541 CTGTGTCACCCCAGGGAAGTGGG + Intergenic
1012637212 6:101558985-101559007 CTTGGTAACCAAAAGGAAGGTGG - Intronic
1012642076 6:101631548-101631570 CTGTGTGTCCCAAAGGAAACAGG + Intronic
1014296412 6:119623833-119623855 TTCTGTGACCTAAAGGAAGAAGG + Intergenic
1015218769 6:130780624-130780646 CAGTGTGACCTATAGGAAGATGG + Intergenic
1016274381 6:142331473-142331495 CTGTATGACGAAAATGCAGTGGG + Intronic
1016323104 6:142869794-142869816 CTGTGTTAATAAAATGAAGTTGG - Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018641873 6:165911478-165911500 CTGTGTAACCAGATGAAAGTTGG - Intronic
1020884035 7:13800511-13800533 CTGTGTGACCCTAATGAGGTGGG + Intergenic
1022947174 7:35298531-35298553 CTGTGTTGCAAAAATGAAGTTGG + Intergenic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1023185271 7:37526571-37526593 CAGTGTGACCAAAAGGAATCTGG - Intergenic
1023426064 7:40037559-40037581 CTGTGTGACCAACAGAATATTGG - Intronic
1024019897 7:45359207-45359229 CTGTAAGACTAAAAGGCAGTAGG + Intergenic
1024396813 7:48879006-48879028 CTGGGTGAGTAACAGGAAGTAGG - Intergenic
1029100582 7:98126591-98126613 CGGTGTGGCCAAAAGAATGTCGG - Intronic
1029506278 7:100965777-100965799 CTGTGTCACCAAATGCACGTCGG + Exonic
1030318497 7:108140667-108140689 CTGTGTGAAGAAAAGAAAGGGGG + Intergenic
1030801227 7:113855748-113855770 CTGTGTGTCCAAAAGAAAATAGG + Intergenic
1031136448 7:117889559-117889581 CTGTGTGATCAAACGGCATTTGG - Intergenic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033486976 7:141800151-141800173 CTGTCTATCCACAAGGAAGTGGG + Intergenic
1034175078 7:149093360-149093382 CTGTCTTAACAAAAGGAAGCAGG + Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1037876199 8:22549828-22549850 CTTTGTGAGAAACAGGAAGTGGG + Intronic
1040463139 8:47669441-47669463 CTGTGTGAGCAAAACAGAGTGGG + Intronic
1041712563 8:60907685-60907707 CTGTCTGACCAATGGGAAATCGG + Intergenic
1042449119 8:68923669-68923691 CTGTGTTACCAAAGTGAACTGGG - Intergenic
1042963024 8:74322355-74322377 CTGTGTGCCCAACAGGTAGACGG + Intronic
1043682852 8:83052552-83052574 CAGGGAGACCAACAGGAAGTAGG - Intergenic
1047527019 8:125642167-125642189 CTGTGGGAGCACAAGGAAGGAGG - Intergenic
1048639059 8:136332552-136332574 CTGTGGTACCAAAAGGCAGGAGG + Intergenic
1050980933 9:12014693-12014715 CTTGGAGGCCAAAAGGAAGTGGG + Intergenic
1052887084 9:33660159-33660181 CTCTGGGACCACATGGAAGTAGG - Intergenic
1052963463 9:34319981-34320003 CTGTGAGACCAAATGGAGCTAGG + Intronic
1053130767 9:35614039-35614061 CTGTATGGCCAAATGGAAGAGGG + Intronic
1054840417 9:69732285-69732307 CTTTGTGACCAAAGGAAACTTGG - Exonic
1054857459 9:69916229-69916251 ATATTTGGCCAAAAGGAAGTGGG + Intergenic
1055826041 9:80325982-80326004 CTGTGTTACCAATGGGAAGTGGG - Intergenic
1057217257 9:93235974-93235996 CTGTGTGCCCCTGAGGAAGTGGG + Intronic
1057872824 9:98731105-98731127 CTGTGTGACCTCAACAAAGTTGG + Intergenic
1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG + Intronic
1060071048 9:120547732-120547754 GTGTGTGAACAAAAGGACATAGG + Intronic
1185697877 X:2209005-2209027 CTGTGTGCTCACAAGGCAGTGGG + Intergenic
1186233382 X:7480223-7480245 CTGTGGCAGCAAAGGGAAGTTGG + Intergenic
1187344798 X:18453152-18453174 TTGTGTGACCAAAAAGAAGAGGG - Intronic
1188465304 X:30472818-30472840 CTGTGTTATGAATAGGAAGTGGG - Intergenic
1188551107 X:31365503-31365525 CTGTGTTACAAAAAGGTACTTGG + Intronic
1189346959 X:40249024-40249046 GTGTTGGACCAAAAGGCAGTGGG - Intergenic
1189501111 X:41560048-41560070 CTGTATGAGCAAAAGGCAATTGG - Intronic
1189630560 X:42948102-42948124 CTCTGTGACCAATACAAAGTAGG + Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1198194089 X:134342606-134342628 CTGTGTGACCTTGAGCAAGTTGG + Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1200683145 Y:6236326-6236348 AAGTGTGGCCAAATGGAAGTGGG - Intergenic
1201049487 Y:9918060-9918082 AAGTGTGGCCAAATGGAAGTGGG + Intergenic