ID: 924657947

View in Genome Browser
Species Human (GRCh38)
Location 1:245990466-245990488
Sequence TCGACCTTGAATAAAATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924657945_924657947 5 Left 924657945 1:245990438-245990460 CCTACTTCCTTTTGGTCACACAG 0: 1
1: 0
2: 1
3: 19
4: 220
Right 924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 123
924657946_924657947 -2 Left 924657946 1:245990445-245990467 CCTTTTGGTCACACAGCTATCTC 0: 1
1: 0
2: 1
3: 22
4: 171
Right 924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 123
924657944_924657947 11 Left 924657944 1:245990432-245990454 CCTACTCCTACTTCCTTTTGGTC 0: 1
1: 1
2: 1
3: 32
4: 303
Right 924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924657947 Original CRISPR TCGACCTTGAATAAAATTTC TGG Intronic
904102941 1:28048656-28048678 TCTACCTTGAGTAAAAATTCTGG - Intronic
910436949 1:87215067-87215089 TAGACCTAAAATAAAATTACCGG - Intergenic
912867990 1:113276306-113276328 TCTACCTTGAAAAAATCTTCAGG + Intergenic
913303766 1:117401331-117401353 CAGAGCTTGAATTAAATTTCTGG + Intronic
917473766 1:175350485-175350507 TAGACCTTGGATGAAATTTCAGG + Intronic
917594433 1:176514735-176514757 TTGACTTTGAATCAAATTTTAGG + Intronic
918560012 1:185854289-185854311 TAGACCTTAAAAAAAAATTCAGG + Intronic
919280038 1:195478007-195478029 TCAATCTAGAATATAATTTCAGG - Intergenic
920988412 1:210912485-210912507 TTGAACTTGCATAAAATATCAGG - Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1065280040 10:24127336-24127358 CCTACCTTGAAAAAATTTTCAGG + Intronic
1067741810 10:48901238-48901260 TAGGCCTTGAATATAATTTTAGG - Intronic
1068242993 10:54328876-54328898 TGGAAGTTTAATAAAATTTCTGG - Intronic
1068771625 10:60828037-60828059 TTGACCTTGAGTCAAATGTCTGG + Intergenic
1068823860 10:61410893-61410915 TCCACCCTGAATTAAATTACTGG - Intronic
1070464159 10:76703108-76703130 ACCACAATGAATAAAATTTCTGG + Intergenic
1072260586 10:93667334-93667356 TCTACCCTCAATACAATTTCTGG - Intergenic
1078704783 11:13732508-13732530 TCCCCCTTGTATAAAATTACAGG - Intergenic
1080593138 11:33741296-33741318 ACAACCTTGAATTTAATTTCAGG - Exonic
1085849820 11:80107138-80107160 TAGACTTTGAATAAAATACCTGG - Intergenic
1086141122 11:83501597-83501619 TTGACCTTGAATGAGGTTTCAGG - Intronic
1086639283 11:89131355-89131377 TCTTCCTCAAATAAAATTTCAGG - Intergenic
1091696330 12:2630561-2630583 TGGACCATGAAGACAATTTCAGG - Intronic
1098026556 12:66209503-66209525 TCTACCTTGAATAATATATTTGG - Exonic
1098303141 12:69074877-69074899 TATCCCTTTAATAAAATTTCAGG - Intergenic
1099240238 12:80129732-80129754 GTGACTATGAATAAAATTTCAGG - Intergenic
1099362498 12:81722455-81722477 TTGACCTTTATTAAAATTACAGG + Intronic
1099381942 12:81965366-81965388 TCGACTTTGAATTAATTTTGGGG + Intergenic
1100076061 12:90785368-90785390 TTGACCTTGAATAGAAGTTGGGG - Intergenic
1100282122 12:93128030-93128052 TAGCCTTTGAAAAAAATTTCAGG + Intergenic
1100424976 12:94475762-94475784 TGGACCTTGAAAAAACTTTACGG + Intergenic
1106741672 13:32650197-32650219 TGGACCTTGAACAAACTTTGTGG + Intronic
1115020559 14:28675100-28675122 TCTACTTTTCATAAAATTTCTGG + Intergenic
1115312396 14:31992674-31992696 TCCACCTTGCATAAAAGATCTGG - Intergenic
1116411240 14:44626202-44626224 TACACCTGGCATAAAATTTCAGG + Intergenic
1116566568 14:46452063-46452085 TCAACCTTCAATAAAAATTATGG + Intergenic
1117242152 14:53844896-53844918 TAGGCCTTGAATCAGATTTCTGG - Intergenic
1118937850 14:70304008-70304030 TAGACCTAGAATAAAATGACTGG + Intergenic
1119905827 14:78301129-78301151 TCCACATTAAATAAAATTTCAGG - Intronic
1121224747 14:92313074-92313096 AAGACCTTGAATATAATTTCTGG - Intergenic
1125849818 15:42892404-42892426 TGGACCTTTAATAAAATGTTTGG + Intronic
1126118931 15:45233882-45233904 TCCATTTTAAATAAAATTTCTGG + Intergenic
1132515918 16:366046-366068 ACGACCTTGAAAAAAATTTTAGG - Intergenic
1140689444 16:77467595-77467617 TGGACCTTGAATAAATTGTATGG - Intergenic
1146579659 17:34025459-34025481 CCGACCTTGCATAAACATTCAGG + Intronic
1153434235 18:5051905-5051927 ACTTCCTTGAGTAAAATTTCAGG + Intergenic
1159092006 18:63860428-63860450 TGGACCTTCAATATCATTTCTGG - Intergenic
927382652 2:22497025-22497047 GAGACCAGGAATAAAATTTCAGG + Intergenic
930950626 2:57139812-57139834 TACACCTTCAATAAAATATCCGG - Intergenic
931432474 2:62219235-62219257 TAGACCTTTACCAAAATTTCTGG - Intronic
935153053 2:100456470-100456492 TAGACCTAGAATAAAATGACTGG + Intergenic
938602584 2:132857297-132857319 TCCACATTTAATACAATTTCTGG + Intronic
939299970 2:140322993-140323015 AAGACTTTGGATAAAATTTCAGG + Intronic
943004271 2:182370465-182370487 TCATCCTTAAATAAAAGTTCAGG - Intronic
943958679 2:194229986-194230008 TCTACCTTAAATAAAAATTAAGG - Intergenic
944410538 2:199437809-199437831 TAGGCCTTGAAAAAAATTACTGG - Intronic
944655500 2:201873183-201873205 TCCACGTAGAATAAAATATCAGG + Intronic
944696473 2:202205038-202205060 GGGACCTTGAATAACATTTAGGG - Intergenic
945633839 2:212321096-212321118 TCTACATTAAATAAAATTTGTGG + Intronic
945831342 2:214790108-214790130 ACTAGCTAGAATAAAATTTCTGG + Intronic
1169546917 20:6659984-6660006 GTGACCTTGAAAAAAAATTCTGG + Intergenic
1169828443 20:9795586-9795608 TAGATGTTGAATAAAATTTGTGG + Intronic
1177027121 21:15933733-15933755 TCTGTCTTGAATGAAATTTCTGG - Intergenic
1177535109 21:22415655-22415677 TTGACTTTGAGCAAAATTTCAGG - Intergenic
1177917649 21:27110262-27110284 CCTACCATGAATGAAATTTCAGG + Intergenic
1183816941 22:40310035-40310057 TGCACTTTGAATAAAATTTTAGG - Intronic
951402292 3:22248294-22248316 TCAAGCTTGAATAAAATTTAAGG - Intronic
952086701 3:29831113-29831135 TCCACCCTGAGTAAAGTTTCAGG - Intronic
956538263 3:70304265-70304287 TGGAAATTAAATAAAATTTCTGG - Intergenic
957565080 3:81875185-81875207 GTGAACTTGACTAAAATTTCAGG + Intergenic
957833336 3:85552160-85552182 TCAGCCTTAAATAAAATGTCTGG - Intronic
958072388 3:88630840-88630862 TGGACCTAAAATAAATTTTCAGG + Intergenic
958136926 3:89505914-89505936 TCATCCTTGAATAAAACTGCAGG + Intergenic
960023372 3:112980888-112980910 TAAAATTTGAATAAAATTTCAGG - Intergenic
963383788 3:144565092-144565114 TTTACCCTGAATAAAATTTGAGG + Intergenic
964542508 3:157795252-157795274 TGGACCTTAATTAAAATTTGTGG + Intergenic
966560604 3:181315636-181315658 TAGACATTTAATAAAAATTCTGG + Intergenic
967244685 3:187473884-187473906 TAGACCTAAAATAAAATGTCTGG + Intergenic
970219189 4:13792330-13792352 TCAAATTTGAATAAAATTTCAGG + Intergenic
971514540 4:27469868-27469890 TAGTCCTTTAATATAATTTCTGG - Intergenic
971645407 4:29193920-29193942 TCGAATTTTAATAAAATTGCGGG + Intergenic
973245628 4:48008280-48008302 TAGACCTAGAATAAAATGACTGG - Intronic
973858537 4:55037526-55037548 TCCACCTTGTTTAAAAGTTCTGG + Intergenic
975767502 4:77684311-77684333 CCATCCATGAATAAAATTTCAGG + Intergenic
976814931 4:89137456-89137478 TTGAATTTGAATAAAATTTACGG - Intergenic
977799775 4:101213142-101213164 ATGACTTTGATTAAAATTTCTGG - Intronic
978083903 4:104626277-104626299 TGAAGCTCGAATAAAATTTCTGG + Intergenic
978871068 4:113578633-113578655 ACAAACTTGAGTAAAATTTCTGG - Intronic
979063049 4:116091126-116091148 TTGACATTCAATAAAATTTTAGG + Intergenic
982463255 4:155697815-155697837 TCCACCTTGAAGGAAACTTCTGG + Intronic
982525303 4:156470485-156470507 TTGACCTTCAATAATATCTCAGG - Intergenic
982989406 4:162252174-162252196 TTCATCTTGAAGAAAATTTCAGG + Intergenic
985140525 4:186834951-186834973 TCAACGTTTAAAAAAATTTCTGG - Intergenic
988276264 5:29084532-29084554 GCAACCTTGATTAAAATTTCTGG - Intergenic
988774006 5:34460169-34460191 TAGTCCTAGAATAAAATGTCTGG - Intergenic
990087211 5:51993576-51993598 TCGACATCTAATAACATTTCTGG - Intergenic
990795549 5:59535908-59535930 TTGACATTCAATAAAAATTCTGG + Intronic
997811789 5:136977864-136977886 CAGACCTGGAACAAAATTTCTGG - Exonic
998056258 5:139080577-139080599 TAGACCCTGAACAAAATTTGAGG - Intronic
1004332701 6:14736255-14736277 TCCACCTTGGATAAACTCTCTGG - Intergenic
1010039428 6:71363643-71363665 TACACATTTAATAAAATTTCAGG + Intergenic
1010446227 6:75951538-75951560 TGGAAAGTGAATAAAATTTCTGG - Intronic
1010455022 6:76044631-76044653 TCCACCTGGAAAAAAATTCCAGG - Intronic
1010759289 6:79703859-79703881 TATACCTTGAATAGAATTGCTGG + Intergenic
1012943024 6:105436484-105436506 CTAACCTGGAATAAAATTTCTGG + Intergenic
1016138029 6:140570789-140570811 TTGACCTTGTTTAAAATCTCAGG - Intergenic
1018670521 6:166173172-166173194 TTGGCCCTGAATAAAATATCTGG + Intergenic
1020700193 7:11472253-11472275 TTGACCTTGAATAAGATTTGGGG - Intronic
1020861021 7:13491815-13491837 TCTATCTTGAAGAAAGTTTCAGG - Intergenic
1021191333 7:17623218-17623240 ACGACCTTGCATAAAATTGAGGG + Intergenic
1022603646 7:31786484-31786506 TAGAAGTTGAATAAATTTTCAGG + Intronic
1022616350 7:31934742-31934764 CTGACCTTGAGTAAAATTTCTGG - Intronic
1026898870 7:74026552-74026574 TGGACCTAGAAGTAAATTTCTGG - Intergenic
1028959206 7:96730244-96730266 TCACCCTTGGAAAAAATTTCTGG + Intergenic
1032955915 7:136972278-136972300 TCTACCTTGAGGGAAATTTCTGG + Intronic
1034722077 7:153302646-153302668 TTGACCTTGAATGCAATTTAGGG + Intergenic
1035163837 7:156971635-156971657 TCGAGCTAAAATAAAATTTGAGG - Exonic
1039916194 8:41862057-41862079 TGGAACTGGAACAAAATTTCGGG + Intronic
1040405123 8:47093752-47093774 TCCACCTTGAATTAATTTTTGGG - Intergenic
1041768460 8:61445793-61445815 TCTACCAAGAATAAAAGTTCTGG - Intronic
1042389315 8:68214821-68214843 TCAACCATGAATCAAATTACAGG + Intronic
1042664240 8:71188999-71189021 TAGACTTTGAAGAAAATTACAGG - Intergenic
1043025597 8:75064038-75064060 TCAACTTTGGATAAAATTTCTGG + Intergenic
1043103386 8:76076498-76076520 TCCATCCTGAAAAAAATTTCTGG - Intergenic
1045270661 8:100658351-100658373 AAGACTTTGAATAAAATCTCAGG - Intronic
1045420442 8:102009395-102009417 TCTACCCTGAATAAAATGGCAGG - Intronic
1046181161 8:110649954-110649976 ACAATCTTGAATAAAATCTCAGG - Intergenic
1046587768 8:116168536-116168558 ATGACCTTGAATAAAATATCAGG + Intergenic
1047386557 8:124415545-124415567 TGGACTTTGCCTAAAATTTCAGG - Intergenic
1047576690 8:126163566-126163588 TTAACCATGATTAAAATTTCAGG - Intergenic
1051245835 9:15110063-15110085 TAGACATTGTATATAATTTCAGG + Intergenic
1052390498 9:27873377-27873399 TCTACCTTCACAAAAATTTCAGG + Intergenic
1059843879 9:118249331-118249353 ATGACCTTGAATACAACTTCTGG + Intergenic
1187816458 X:23237835-23237857 TAGACCTAGAATAAAATGACTGG + Intergenic
1188187739 X:27135851-27135873 ACGGCCTAGAATGAAATTTCAGG + Intergenic
1189449419 X:41114189-41114211 TAAACCTTGAATAACATTACGGG + Intronic