ID: 924657949

View in Genome Browser
Species Human (GRCh38)
Location 1:245990477-245990499
Sequence TAAAATTTCTGGATCTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924657944_924657949 22 Left 924657944 1:245990432-245990454 CCTACTCCTACTTCCTTTTGGTC 0: 1
1: 1
2: 1
3: 32
4: 303
Right 924657949 1:245990477-245990499 TAAAATTTCTGGATCTGACATGG 0: 1
1: 0
2: 3
3: 20
4: 242
924657945_924657949 16 Left 924657945 1:245990438-245990460 CCTACTTCCTTTTGGTCACACAG 0: 1
1: 0
2: 1
3: 19
4: 220
Right 924657949 1:245990477-245990499 TAAAATTTCTGGATCTGACATGG 0: 1
1: 0
2: 3
3: 20
4: 242
924657946_924657949 9 Left 924657946 1:245990445-245990467 CCTTTTGGTCACACAGCTATCTC 0: 1
1: 0
2: 1
3: 22
4: 171
Right 924657949 1:245990477-245990499 TAAAATTTCTGGATCTGACATGG 0: 1
1: 0
2: 3
3: 20
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924657949 Original CRISPR TAAAATTTCTGGATCTGACA TGG Intronic
902633933 1:17722798-17722820 TAAAATTTCTGGAAGTCAAAGGG - Intergenic
905418933 1:37825525-37825547 CAAAATTTCTGGGTCTGATGTGG - Intronic
908423055 1:63978621-63978643 TGAAATTTCTGGATCATAGAAGG - Intronic
908824697 1:68122153-68122175 TATAGTTTCTAGAACTGACAAGG + Intronic
909522521 1:76586007-76586029 TAAAATTACTGCTTCTGACGAGG + Intronic
909546233 1:76851351-76851373 TAGGATTTCTGGAGCTGACCTGG - Intergenic
910519101 1:88097576-88097598 TAAAATTTGTACATCTTACAAGG + Intergenic
910716376 1:90235874-90235896 TAGAATTTCTGGACCTGACCTGG - Intergenic
911010012 1:93270373-93270395 CAAAATTTCTGGACATGAAAAGG + Intronic
912675059 1:111671767-111671789 AAAAATTACTGGAGCTGGCAGGG - Intronic
912827153 1:112916207-112916229 AAAAATTTATGGATCAGGCATGG + Intronic
912926600 1:113918560-113918582 TACAATTTCTGGTAATGACAGGG - Intergenic
913494880 1:119419368-119419390 AAAGATTTCTGGATCTGGCTGGG - Intronic
915151704 1:153838172-153838194 TAAGATGTCTGGCTCTGAGAAGG - Intronic
917094234 1:171383985-171384007 TTAAATTTTTTGTTCTGACAGGG + Intergenic
917106394 1:171496675-171496697 TAAAGTTTCTGGTGATGACAGGG - Intronic
917783011 1:178419577-178419599 TAAAATTTCTCAGTCAGACACGG - Intronic
918416220 1:184311046-184311068 TAGGATTTCTGGACCTGCCATGG - Intergenic
918945392 1:191058190-191058212 TAAAATCTATTCATCTGACAAGG - Intergenic
918981611 1:191567875-191567897 TAATACTTCTGAATCTCACAGGG - Intergenic
919076155 1:192815431-192815453 TAAAATTTATGGAAATGACTTGG + Intergenic
919439492 1:197613209-197613231 TGAAATCTCTGGGTCTGTCAGGG - Intronic
919537667 1:198808411-198808433 GCAAATTTTTGTATCTGACAGGG + Intergenic
920035744 1:203064158-203064180 TCAAATTACAGGATGTGACAAGG - Intronic
921300562 1:213747692-213747714 AAAAATTTCTGCCTCTGACTAGG - Intergenic
921395488 1:214664886-214664908 AAATGTTTTTGGATCTGACATGG - Intergenic
922140497 1:222880768-222880790 TAAAATGTCTGGGCCAGACATGG + Intronic
923280206 1:232436461-232436483 TAAACTTTCAGGAACTGACCGGG - Intronic
923826152 1:237502879-237502901 TAAAATTACAGGATTTAACAAGG - Intronic
924657949 1:245990477-245990499 TAAAATTTCTGGATCTGACATGG + Intronic
1063706527 10:8436278-8436300 TAAATTTCCTGGAACTTACAGGG + Intergenic
1065614898 10:27510718-27510740 TAAAATTTCATGATCTGATGAGG + Intronic
1065790514 10:29255974-29255996 TAAATTTTCTGAATCAGACTAGG + Intergenic
1066467345 10:35664665-35664687 AAAAATTCCTGCATCTGCCATGG - Intergenic
1067950502 10:50732201-50732223 TAAAATTTCTGTATCTGATATGG + Intergenic
1068273719 10:54764216-54764238 CAAAATTTCTATATCTGATATGG - Intronic
1068670160 10:59714261-59714283 GAAAATTTCTGCATCTGTCCAGG + Intronic
1069222362 10:65900688-65900710 TAAAAATACTGGATCTGTCCAGG + Intergenic
1070166420 10:73901673-73901695 TAAAAGTTCTGGACCAGACGCGG - Intergenic
1070885844 10:79897438-79897460 TAAAATTTCTGTATCTGATATGG + Intergenic
1070977366 10:80615634-80615656 TAGAATTTCTGGAGCTAAGAGGG + Intronic
1076234752 10:128854764-128854786 TACAATTTCTGCAGCTGTCAGGG + Intergenic
1078162168 11:8850291-8850313 TAAAACTGCTTGATCTGATAAGG + Intronic
1079580751 11:22061298-22061320 AAAAATACCTGCATCTGACAAGG - Intergenic
1079780926 11:24603446-24603468 TCAAATTTCTGGTTCTCACTTGG - Intronic
1084010467 11:66345512-66345534 TAAAATTCCTGGTTCTCTCAGGG - Exonic
1084482866 11:69432185-69432207 TAGGATAACTGGATCTGACATGG + Intergenic
1086670760 11:89544104-89544126 TAAAATTTCAGGCTCAGGCATGG + Intergenic
1087033982 11:93737588-93737610 TAAAATTTCAGGTTCTGGCAAGG + Intronic
1087599322 11:100292222-100292244 TACAATTTGTGGTTCTCACATGG + Intronic
1088009832 11:104986548-104986570 TAGCATTTCTGGACCTGTCATGG + Intergenic
1088210777 11:107453757-107453779 TAGCATTTCTGGATCTGCCCTGG + Intronic
1089381165 11:118033559-118033581 TAAACTTTCTTGATTTTACAGGG - Intergenic
1090087206 11:123661299-123661321 TAAAATTTGGAGATCTCACATGG + Intergenic
1091936532 12:4439324-4439346 TAAATTCTCTGGAACTGACTGGG - Intronic
1093371422 12:18370411-18370433 TACAATCTCTGGATATGATAAGG - Intronic
1093851031 12:24038451-24038473 TAGGATTTTTGGAACTGACACGG - Intergenic
1094417169 12:30229605-30229627 TAAAGTTTTTTCATCTGACAAGG - Intergenic
1097515625 12:60601682-60601704 TAAAATTTCTGGGTATTAAAAGG + Intergenic
1099005957 12:77235085-77235107 TGAAGTTTCTGGGTCTGACAAGG - Intergenic
1099202543 12:79691937-79691959 TGAAATTTCTGGATCAGAGCGGG + Intergenic
1100412080 12:94329642-94329664 TAAAATTTCTTGCTGTAACACGG + Intronic
1108067634 13:46594652-46594674 TAAAGTTTCTCGATTTGACGGGG + Intronic
1109426391 13:62169391-62169413 TGCAATTTATGCATCTGACAAGG - Intergenic
1109723875 13:66314442-66314464 TAACATTTAGGGATCTGGCAAGG - Intronic
1110525546 13:76532334-76532356 TAAAATTTCTGGGTCATATAAGG - Intergenic
1110717745 13:78726816-78726838 AAAAATTCCTCAATCTGACAAGG + Intergenic
1111591874 13:90358158-90358180 AAAAAATTCTTGATCTAACAAGG + Intergenic
1112091403 13:96088509-96088531 TAAAATTGCTTGATATCACATGG - Intergenic
1113275142 13:108719994-108720016 TAAAATTTCTGGATGTGGTTCGG + Intronic
1114960761 14:27885589-27885611 TAAAATTTATGAATTAGACACGG + Intergenic
1115238396 14:31230579-31230601 TAAAATTTTTGGGCCAGACACGG - Intergenic
1115349692 14:32380630-32380652 TAAAATTTCTGCCTCTCATAAGG + Intronic
1115586451 14:34818781-34818803 TAAAATTTCTGGACTTAATAAGG + Intronic
1117553027 14:56855097-56855119 TAAACTTTATGCATATGACAAGG + Intergenic
1118136266 14:63031548-63031570 TGAGATTTCTGGATCCGAGAAGG - Intronic
1120622210 14:86777813-86777835 TAAAAGTTTTGGATCTAACAGGG - Intergenic
1122248763 14:100423600-100423622 ATAAAATTCTTGATCTGACATGG - Intronic
1128447084 15:67773106-67773128 GAAAATTTCTGAATATGGCATGG + Intronic
1131345300 15:91641848-91641870 TAAAATTGCTGAAGCTTACACGG + Intergenic
1137006804 16:35283636-35283658 TAAAATTTCTGCACCTGTCTGGG + Intergenic
1137013752 16:35351716-35351738 GAAAATATGTGCATCTGACAAGG + Intergenic
1137020728 16:35424597-35424619 GAAAATATGTGCATCTGACAAGG + Intergenic
1141458717 16:84163203-84163225 TGAAATTTCTGGGTCATACAGGG + Intronic
1144324243 17:14162660-14162682 TAGAATTTGTGGATCCAACAGGG - Intronic
1144381196 17:14700477-14700499 AAAAGTTTCAGGCTCTGACAGGG + Intergenic
1145353530 17:22113208-22113230 TAAAATTTCAGAATCTGACCGGG + Intergenic
1148062147 17:44844306-44844328 GAAAATGTCTGGATAAGACAGGG - Intergenic
1150176424 17:63061440-63061462 TAAAATTACTGGATTTAAAAAGG - Intronic
1151270110 17:72987538-72987560 TAACATTTCTGAATTTGCCATGG - Intronic
1157158201 18:45288065-45288087 AAATATTTCTGGATCTAAGATGG - Intronic
1158561205 18:58515332-58515354 TAAAATTTCTCGAGCCGGCAGGG + Intronic
1160080605 18:75723562-75723584 CAAAATTTCAGCATCTTACAAGG + Intergenic
1160297807 18:77654137-77654159 CAAAATCTCTGGGTCTTACATGG + Intergenic
1163866677 19:19778887-19778909 TAAAATATGTGGTTCTGGCACGG + Intergenic
929055306 2:37871594-37871616 TACAATTTCTGTAACTGCCATGG + Intergenic
929478237 2:42275725-42275747 GAAAATTTCTGGGACTGAGAGGG - Intronic
929813983 2:45216334-45216356 TAAAATTTATGGAACTAAAAAGG + Intergenic
930485870 2:52010031-52010053 TAAAATATATGGAACTGATATGG - Intergenic
932986902 2:76737111-76737133 TAAAATATCTGTATTTGAAAAGG + Intergenic
933037814 2:77422384-77422406 TTACATTTCTGCATCAGACATGG - Intronic
933375601 2:81476360-81476382 TACAATTTCTGTATCTGCCAGGG + Intergenic
933806350 2:86000668-86000690 TAAAATTTCAGCATCATACAGGG + Intergenic
936741129 2:115510102-115510124 TGAAACTTATGTATCTGACAAGG - Intronic
939171021 2:138695705-138695727 TAAAATCTCTTTATCTGACAAGG - Intronic
939266988 2:139886608-139886630 TAACATTTTTGCATCTGTCAGGG - Intergenic
939475163 2:142677407-142677429 CATGATTTTTGGATCTGACATGG - Intergenic
941193311 2:162414819-162414841 TAAAATTTGTGTATATGAGAAGG + Intronic
941464105 2:165805235-165805257 TAATATTTTTGTATCTGTCATGG + Intergenic
942126516 2:172831064-172831086 TAAAATTACTGAAACTGTCAAGG + Intronic
944284619 2:197934874-197934896 TGCAAATTCTGCATCTGACAAGG + Intronic
944309305 2:198215464-198215486 TAGAATTTTTGGATCCTACAGGG - Intronic
1168742048 20:200309-200331 GAATATTTCTGGACCTGTCATGG - Intergenic
1171563786 20:26157407-26157429 TAAAATTTCAGAATCTGGCCGGG + Intergenic
1174319106 20:49726644-49726666 AAAAATTTATGGACCAGACATGG + Intergenic
1176272162 20:64241038-64241060 TAAAATTCCTTGACCTGACAGGG - Exonic
1177349103 21:19912258-19912280 TAGAATTTGTGGATCCAACAGGG + Intergenic
1177548974 21:22596975-22596997 TAAAAATTATGGATAAGACAAGG - Intergenic
1178193057 21:30308289-30308311 TAAATTTTCTAGTTCTCACAAGG - Intergenic
1179364972 21:40750586-40750608 TAAGAGGTCTGGATCAGACATGG - Intronic
1182195635 22:28513362-28513384 TAAAATTTTAGGAGCTGAAATGG + Intronic
949642634 3:6055774-6055796 AAAAACTACTGGATATGACAGGG + Intergenic
950456795 3:13097485-13097507 TCAACTTTCTGGATTTCACACGG + Intergenic
950849054 3:16044419-16044441 TAAAAGTTCTAGATCTAAGATGG - Intergenic
951362939 3:21746325-21746347 TAAAATTTAAGGATGTGATAAGG + Intronic
951435438 3:22657289-22657311 TAGCATTTCTGGATCTGCCCTGG - Intergenic
954351730 3:50049978-50050000 AAAAATTTCTGGAACTAACCTGG - Intronic
956539491 3:70319983-70320005 GAAAATTTCTGCATCCAACATGG + Intergenic
958813007 3:98884102-98884124 TAAAATTTCTTTATCAGCCAAGG - Intronic
959008610 3:101048617-101048639 TAAAGTTTCAGGGTCTGGCATGG + Intergenic
959309518 3:104715761-104715783 TACAACTTATGGATCTGAAAGGG - Intergenic
961095109 3:124147780-124147802 TAGAATTTCTGGATATGACCTGG - Intronic
964707726 3:159637848-159637870 TAAAATTTCTGTCCCTGAGAGGG + Intronic
965023500 3:163266536-163266558 TGAAATCTATGGATCTGACAAGG - Intergenic
966295660 3:178419098-178419120 TACAATTTCAGCATCTGAAAAGG + Intergenic
968321122 3:197769379-197769401 TAAAAATTCTGAATCTGGCCAGG - Intronic
970446822 4:16130476-16130498 AAAAATATCTGAATCTGGCAAGG + Intergenic
970771395 4:19616586-19616608 TGAATTTTCTGGATCCCACAAGG + Intergenic
970973690 4:22017037-22017059 TAAAATCTGTGGATCTGGCCGGG - Intergenic
971006123 4:22375794-22375816 TAAAATTTCTGTTTCTTAGAAGG - Intronic
972182995 4:36492359-36492381 TAAAATTGCTGGGTCAGAGATGG - Intergenic
973088672 4:46103105-46103127 CAAATTTCCTGGTTCTGACACGG + Intronic
973751213 4:54022556-54022578 TAAAATGTCTTGATCTAATAAGG - Intronic
973763262 4:54140025-54140047 TAGCATTTCTGGACCTGCCATGG + Intronic
974826124 4:67133273-67133295 TAAAATAACTGGTGCTGACAAGG + Intergenic
975060574 4:69993033-69993055 TATAATTTGTGAATCAGACAAGG - Intergenic
975152218 4:71034280-71034302 TAAAATGTCTCGATCTAATAAGG - Intergenic
976623617 4:87154727-87154749 TACAATCTCTCCATCTGACAAGG + Intergenic
977352657 4:95907768-95907790 TAAAATTTCTGGAACTTTGATGG + Intergenic
978486242 4:109257147-109257169 TAAAATTTCTAGATATGTAAGGG + Intronic
979892255 4:126113029-126113051 TAAAATTTCTGAAAATTACAAGG + Intergenic
980245415 4:130233425-130233447 TAAAATATCTGGATTTTTCAGGG + Intergenic
981362927 4:143867818-143867840 TAGAATTTCTGTGTCTGCCAAGG + Intergenic
981382757 4:144091882-144091904 TAGAATTTCTGTGTCTGCCAAGG + Intergenic
981797810 4:148617264-148617286 TAAAATTACTAGATATGACAAGG + Intergenic
983776861 4:171618770-171618792 TACAAATTATGTATCTGACAAGG - Intergenic
983883672 4:172959327-172959349 TAAAATGTCTGGACCTAATAAGG + Intronic
989215310 5:38899345-38899367 TGGCATTTCTGGATCTGACCTGG - Intronic
989494452 5:42095523-42095545 TTGAATTTCTCCATCTGACAAGG - Intergenic
989800135 5:45527298-45527320 TTAAATTTCTGAAGGTGACATGG + Intronic
989800176 5:45527854-45527876 TTAAATTTCTGAAGGTGACATGG + Intronic
990565034 5:57019942-57019964 TAAAATGTCTTGATCTAATAAGG + Intergenic
991441131 5:66650628-66650650 TAAATTTTCAGGAACTTACATGG - Intronic
991510576 5:67372355-67372377 AAAAATTTCTGGATATAAAAGGG - Intergenic
991710450 5:69403627-69403649 TAAAATTTCTGGGCCAGGCATGG + Intronic
993278525 5:85894175-85894197 TAAAATTTCTGCATCTCAAAGGG - Intergenic
993358803 5:86947425-86947447 AAGAATTACTGGATTTGACAGGG - Intergenic
994064060 5:95515171-95515193 TAAAAGTTCTGCAGATGACAAGG - Intronic
995020311 5:107359979-107360001 TAAAATTTAAGGATGTGACAGGG + Intergenic
995172965 5:109138876-109138898 TACAAATTCTTGATATGACAGGG + Intronic
995243940 5:109916414-109916436 TGAAATTGCTCAATCTGACATGG + Intergenic
995351908 5:111187175-111187197 TAAATTGTTTGGATCTGACAGGG + Intergenic
996302638 5:122007437-122007459 TAATATTGCTGGTGCTGACATGG + Intronic
999353433 5:150900484-150900506 TAAAAGTTCTGTAGCAGACATGG - Intronic
1000270176 5:159676850-159676872 TAACATTTCTAGATATGACCTGG + Intergenic
1002388364 5:178889047-178889069 TAGAATTTCTAGAGCTGAAAAGG - Intergenic
1003686310 6:8306493-8306515 TGAAAATTATGTATCTGACAAGG - Intergenic
1003817286 6:9856055-9856077 TAATATTTCTAGATCTGAGACGG - Intronic
1005897029 6:30187284-30187306 TAAAATTGCTGAAGTTGACAGGG - Intronic
1008069532 6:47085544-47085566 TAAAAATTCTGGATCTGGCCAGG + Intergenic
1008227274 6:48936234-48936256 TAACATTTCTGGACATGCCATGG - Intergenic
1008562528 6:52736541-52736563 TAAAATTCCTGGATGTGATCTGG - Intergenic
1009640198 6:66325468-66325490 TAATATATCTAGATTTGACAAGG - Intergenic
1009687786 6:66986408-66986430 TAACATTTCTGGACCTGCCCTGG - Intergenic
1010892200 6:81326976-81326998 TAAAACTCCTGAATCTGACTAGG - Intergenic
1012294089 6:97497964-97497986 TAAAATGTCTGCTCCTGACATGG + Intergenic
1012319927 6:97830508-97830530 TAAAATTATTTTATCTGACAGGG - Intergenic
1013814178 6:114078073-114078095 TTAAATTTTTGGATCTAACTTGG - Intronic
1016566006 6:145454816-145454838 TTAAATTTATGGATATGGCATGG - Intergenic
1016908153 6:149171625-149171647 TAATGTTTCTGGATATGAAATGG - Intergenic
1017269905 6:152492961-152492983 TAAAATGTCTTGATCTAATAAGG - Intronic
1017799996 6:157886587-157886609 TAACATTTCTGATTCTGGCAAGG - Intronic
1019177433 6:170167288-170167310 TTAACTTTCTGGATCTTTCACGG - Intergenic
1020659753 7:10967670-10967692 AAAAATTTCTAAATGTGACATGG - Intergenic
1020689444 7:11336862-11336884 TTACATTTCTGGTTTTGACATGG - Intergenic
1021837759 7:24696970-24696992 TTAAAGTTATGGACCTGACATGG - Intergenic
1022447489 7:30481970-30481992 TAAAATTTCTCGACCTAATAAGG - Intergenic
1023440572 7:40180977-40180999 TAAAAATTCTGGATCTAACAAGG + Exonic
1023734330 7:43221423-43221445 AAAAATTTGTGGTTCTGACTAGG - Intronic
1024084136 7:45879788-45879810 TAAAATTACTGTATCTGGCTGGG + Intergenic
1025042165 7:55656265-55656287 TAAAATTTCTGTTTCTGGCCGGG + Intergenic
1025273939 7:57556889-57556911 TAAAATTTCAGAATCTGGCCGGG - Intergenic
1026063368 7:67046572-67046594 AAAAATATATGGATCTTACATGG + Intronic
1026714975 7:72780925-72780947 AAAAATATATGGATCTTACATGG - Intronic
1027158404 7:75784676-75784698 TAAAATTTCTGAACCTAATAAGG - Intronic
1027548298 7:79558062-79558084 CAAAATTCCTTGATCTGAGATGG + Intergenic
1027573718 7:79905325-79905347 TATAATATCTTGACCTGACAGGG - Intergenic
1027761845 7:82288546-82288568 TAAAATATTTGTATCTCACAAGG + Intronic
1028543925 7:91976802-91976824 TAAAAATTCTGGAATTGAAAAGG - Intronic
1028723444 7:94060157-94060179 TAAACTTTCTTAATCTGACAGGG + Intergenic
1030874674 7:114798824-114798846 TGAAATAACTGGATCAGACATGG - Intergenic
1031770846 7:125839931-125839953 TATAATTTCTACATCAGACAGGG + Intergenic
1032682361 7:134198239-134198261 AAAAATTTCTTCATTTGACAAGG + Intronic
1033052424 7:138017993-138018015 TTCAAATTCTGGATTTGACAAGG + Intronic
1033211608 7:139464041-139464063 TAAAATGTCTTGACCTAACAAGG - Intronic
1033892245 7:146028536-146028558 TAGAAATTCTGGTTCTGAAATGG - Intergenic
1037075692 8:14714255-14714277 GAAAATTTCAGGGTCGGACACGG - Intronic
1037169347 8:15872992-15873014 TCAAATTTCAGAATCTGATATGG - Intergenic
1037367042 8:18134238-18134260 TAAACTTTGAAGATCTGACATGG + Intergenic
1038264437 8:26027012-26027034 GAAGATTTCTGGCTCTGAGAAGG - Intronic
1038621716 8:29149816-29149838 TTAGATTTCTGGTTCTGTCAGGG + Intronic
1038871866 8:31503930-31503952 TAAAATTTCTGGCTCTGTCCTGG - Intergenic
1039745276 8:40420035-40420057 TAAACCTTCTGGATCCAACATGG + Intergenic
1040095717 8:43440542-43440564 TTACATTTCTGGATCTGCCCTGG + Intergenic
1043112214 8:76200345-76200367 TAAAATTCCTGCATCTGACTGGG - Intergenic
1043192271 8:77240748-77240770 TAAAAGTTCTGTATTTGATAAGG + Intergenic
1043720992 8:83546704-83546726 TAAAATGTCTGGACCTAATATGG - Intergenic
1044589224 8:93897490-93897512 TATAATTTCAGAATCTGAAAAGG - Intronic
1045757589 8:105563005-105563027 TAAAATTTCTGGATCCTCTAAGG - Intronic
1045817856 8:106297948-106297970 TAAAGTTTATGTATCTGCCAGGG - Intronic
1046161067 8:110365835-110365857 CAAAATTACTAGCTCTGACATGG + Intergenic
1046299917 8:112274604-112274626 AACAATATCTGGAGCTGACATGG + Intronic
1046793527 8:118346597-118346619 ATAATTTTCTGGATGTGACAGGG + Intronic
1047547363 8:125831977-125831999 TAAAATATCTGGAAATGGCATGG + Intergenic
1049064933 8:140305590-140305612 AAAAATTCCTGGGTCTGGCACGG - Intronic
1050043096 9:1515948-1515970 TAAAATGTCAGGATGTCACAAGG - Intergenic
1050521973 9:6510451-6510473 TAATATTTATGGATATGCCACGG + Intergenic
1052100271 9:24437545-24437567 TAAAAGTTTTGTATCAGACATGG + Intergenic
1053357529 9:37459539-37459561 AAAAGTTTCTTGATCTGTCAGGG - Intronic
1055609060 9:78002650-78002672 GTAAATTTCTACATCTGACAGGG + Intronic
1059804556 9:117784533-117784555 TAAAATTTGGGGATTTGACTGGG + Intergenic
1059939441 9:119343692-119343714 TCAAATTTCAGTATCTGTCAAGG - Intronic
1186126028 X:6414819-6414841 CAAAAGTTCTGGATGTGAGAAGG - Intergenic
1186534036 X:10328907-10328929 GAAAATTTCAGGATCACACAGGG - Intergenic
1188200872 X:27292100-27292122 TAAAATGTCTTGATCTAATAAGG + Intergenic
1188994016 X:36859941-36859963 TAAAATTTGTGAATCAAACATGG - Intergenic
1189703940 X:43741352-43741374 TAAACTTTCTGAATGTGCCAGGG + Intronic
1190783185 X:53618851-53618873 TAAAAATTCTGGAACGGGCACGG - Intronic
1191233779 X:58118110-58118132 TAAAATTTCTGGGGCTCACCAGG - Intergenic
1193220045 X:78913481-78913503 TAGCATTTCTGGATCTGCCCTGG - Intergenic
1193568450 X:83110254-83110276 AAAACTTTCTCGATCTGATAAGG - Intergenic
1193650326 X:84123415-84123437 TATAATTTCTGGATCTGCCCTGG + Intronic
1193860299 X:86657396-86657418 TAATATTTGTGGATCTAACTAGG - Intronic
1194642233 X:96416196-96416218 GAAAATTTCAGGATCTGATTTGG + Intergenic
1195338544 X:103880491-103880513 TAAACTTTCTAAATCTGAAAAGG + Intergenic
1195461495 X:105130957-105130979 TTAGATTTCTAGATCTGAAAAGG + Intronic
1197225700 X:123954183-123954205 TCAATTTCCTGGATTTGACAAGG - Intergenic
1197411499 X:126121306-126121328 TAGCATTTCTGGATCTGCCCCGG - Intergenic
1197439343 X:126471170-126471192 CAACATTTCTGGACCTGCCATGG + Intergenic
1197520315 X:127489697-127489719 CAGCATTTCTGGACCTGACAAGG - Intergenic
1197880867 X:131164968-131164990 CAAAAATTATGGCTCTGACAGGG + Intergenic
1198938890 X:141931364-141931386 TGACATTTCTGGATCTGCCCTGG - Intergenic
1199093269 X:143714720-143714742 TCAAATGTCTGGGTCTGACTGGG - Intronic
1199175937 X:144787197-144787219 CAGAATTTCTGGATCTGCCCTGG + Intergenic
1199430080 X:147748760-147748782 TAAAATTTCTCTGTCTCACAGGG - Intergenic
1199431448 X:147765295-147765317 TAACATTTTTGGATTTGACTTGG - Intergenic