ID: 924657950

View in Genome Browser
Species Human (GRCh38)
Location 1:245990486-245990508
Sequence TGGATCTGACATGGTTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924657946_924657950 18 Left 924657946 1:245990445-245990467 CCTTTTGGTCACACAGCTATCTC 0: 1
1: 0
2: 1
3: 22
4: 171
Right 924657950 1:245990486-245990508 TGGATCTGACATGGTTTCAGTGG 0: 1
1: 0
2: 0
3: 11
4: 118
924657945_924657950 25 Left 924657945 1:245990438-245990460 CCTACTTCCTTTTGGTCACACAG 0: 1
1: 0
2: 1
3: 19
4: 220
Right 924657950 1:245990486-245990508 TGGATCTGACATGGTTTCAGTGG 0: 1
1: 0
2: 0
3: 11
4: 118
924657948_924657950 -7 Left 924657948 1:245990470-245990492 CCTTGAATAAAATTTCTGGATCT 0: 1
1: 0
2: 1
3: 45
4: 364
Right 924657950 1:245990486-245990508 TGGATCTGACATGGTTTCAGTGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924657950 Original CRISPR TGGATCTGACATGGTTTCAG TGG Intronic
907261089 1:53219180-53219202 TGGTGCAGAAATGGTTTCAGCGG + Intronic
908458105 1:64323707-64323729 TCCATCTGACTTGGTTTCTGAGG - Intergenic
920866716 1:209759354-209759376 TGGACCTGGCATGGTTTAGGAGG - Intronic
922179346 1:223221810-223221832 ATGATGTGACATGCTTTCAGAGG + Exonic
923540140 1:234882896-234882918 TTGATCTGACAGAGGTTCAGAGG + Intergenic
923805562 1:237253349-237253371 TGGTTCTGATTTGGCTTCAGTGG + Intronic
924657950 1:245990486-245990508 TGGATCTGACATGGTTTCAGTGG + Intronic
1065793907 10:29289095-29289117 AGAATCAGACATGGCTTCAGGGG + Exonic
1065948646 10:30629706-30629728 AGAATCAGACATGGCTTCAGGGG - Exonic
1078532529 11:12148247-12148269 TGGAGCTGACTGGGCTTCAGAGG + Intronic
1081785706 11:45745479-45745501 TTGTGCTGAGATGGTTTCAGTGG - Intergenic
1084091628 11:66882678-66882700 TGGTTCTGACCTGCTTTCACTGG - Intronic
1090723890 11:129504207-129504229 AGGATCTTACAGAGTTTCAGTGG - Intergenic
1091011859 11:132008660-132008682 TGAAACAGACATGTTTTCAGGGG - Intronic
1092143281 12:6198668-6198690 TGGATCTGCTGTGTTTTCAGAGG - Intergenic
1097522718 12:60689097-60689119 TGGATGTGACATGGAGTCAAAGG - Intergenic
1099018525 12:77374548-77374570 TGGATCAGGGATGATTTCAGTGG + Intergenic
1103124837 12:118412534-118412556 TGGTTCTGACTTGGCTTGAGGGG - Intronic
1103861504 12:124018340-124018362 TGAATCTGTCTTGGTTACAGAGG + Intronic
1105551440 13:21399881-21399903 TAGATGTGTCATAGTTTCAGGGG + Intronic
1107658029 13:42611870-42611892 GGGATCAGAGGTGGTTTCAGAGG + Intergenic
1107761306 13:43682349-43682371 TGGAACTGAGTTGGTTTTAGTGG - Intronic
1107939899 13:45374282-45374304 TGCAGCAGACATGGTTTCTGGGG + Intergenic
1109636487 13:65124599-65124621 TGGCTCTGACTTCGTTCCAGTGG - Intergenic
1117632791 14:57710671-57710693 TGGATGTGACATGGAATCAAAGG + Intronic
1122073021 14:99217567-99217589 TGGACCTGACAGGGTCTGAGCGG - Intronic
1123705579 15:22948417-22948439 TGGTTCTGACTTGCCTTCAGTGG - Intronic
1124849120 15:33318944-33318966 TTGCTTTGAAATGGTTTCAGGGG - Intronic
1127349074 15:58131826-58131848 TGAACCTGTCATGGTTTCAAGGG + Intronic
1129096168 15:73210731-73210753 TGGCTCTTAGATTGTTTCAGAGG + Intronic
1130332068 15:82930333-82930355 GGTATCTTACATGGTTTCTGTGG - Intronic
1130898039 15:88185826-88185848 TGGCTCTGAAATGCTTCCAGAGG - Intronic
1131057277 15:89383163-89383185 TGGAACTGACATATTTTCACTGG + Intergenic
1131124799 15:89850322-89850344 AGGATCATACATTGTTTCAGTGG + Intronic
1140930633 16:79624562-79624584 TGGATCAGACATGAGTTGAGAGG - Intergenic
1142680154 17:1542774-1542796 TGGGTCTGACATGGACACAGTGG - Intronic
1143158211 17:4852445-4852467 TGGAGGTGACATTGTCTCAGTGG + Intronic
1143244044 17:5468268-5468290 TGGATCTGACCCGGTTTGTGAGG - Intronic
1144351701 17:14403067-14403089 TGGATGCGACATGGTGTCAAAGG + Intergenic
1145724997 17:27111956-27111978 TATATCTGACAGGCTTTCAGAGG - Intergenic
1146932637 17:36788473-36788495 TGGTGCTGACATGGTTTCTGAGG - Intergenic
1148846609 17:50533443-50533465 TGGATCTGACTTGGAGGCAGGGG + Intronic
1156902609 18:42319011-42319033 TGGATCTGAGATATTTTGAGAGG - Intergenic
1157513586 18:48295681-48295703 TGGGGCTGAAATGGTTTCAGAGG + Intronic
1159156429 18:64589215-64589237 TGCATCTGCCATGGGTACAGTGG - Intergenic
1159995725 18:74962117-74962139 TGCTTTTGACATGGTGTCAGTGG + Intronic
1161486548 19:4538824-4538846 TGGAGCTGCCATGGTCTGAGCGG + Exonic
1162191063 19:8947361-8947383 TGTATCTGTCATGATTTCAGAGG + Exonic
1163078151 19:14914991-14915013 GGGATGAGAGATGGTTTCAGGGG - Intergenic
1163103922 19:15112701-15112723 TGGATCTGAACTGGTTGCTGAGG - Intronic
1163658175 19:18560306-18560328 TGGATCAGAAAGGGTTTCAGAGG - Exonic
925952324 2:8926849-8926871 TGGATTTGACATGGGTTGGGGGG + Intronic
939194465 2:138954877-138954899 TGTATCCTACTTGGTTTCAGAGG - Intergenic
939410770 2:141821914-141821936 TGGATTTGAAATGTTTACAGAGG - Intronic
941267212 2:163377491-163377513 TGGATCTTACATTTTCTCAGTGG + Intergenic
1172765265 20:37347272-37347294 GGGATCAGACTTGGTTTCAAGGG + Intronic
1174373541 20:50110731-50110753 TGGATTTGAGATGGTATGAGGGG - Intronic
1174404276 20:50293656-50293678 TTGAACTGTCATGGATTCAGAGG - Intergenic
1174769710 20:53287494-53287516 AAGATCTGTCATGGGTTCAGAGG + Intronic
1179386635 21:40949286-40949308 TGGATGTGACATGATTTAATTGG + Intergenic
1180190487 21:46160516-46160538 TGCACCTGACATGGTCTCCGGGG + Intergenic
950801539 3:15555601-15555623 TGGATGTGCCATGGGTTCACTGG + Intergenic
955564829 3:60232789-60232811 TGTATATGACATGGCTTTAGAGG - Intronic
961923728 3:130453347-130453369 TTCTTCTGACATGGCTTCAGCGG + Intronic
962137602 3:132753313-132753335 TGGATGAAACATGTTTTCAGGGG - Intergenic
963152204 3:142056937-142056959 TTCATCTCACATGGTTTCTGAGG - Intronic
964678071 3:159305544-159305566 TTGATGGGACATGGTCTCAGAGG - Intronic
969595872 4:8149020-8149042 TGGATCTGCCCTGGTATCTGGGG - Intronic
969630154 4:8331190-8331212 TGGTTCTGACAAGGTTTCCAGGG - Intergenic
971329761 4:25672891-25672913 TGATTATGACATAGTTTCAGTGG + Intronic
972094587 4:35333543-35333565 TGGATTTGAGATGGTTCAAGGGG - Intergenic
974399715 4:61388002-61388024 TTCTTCTGCCATGGTTTCAGCGG + Intronic
977004549 4:91548686-91548708 TCTATCTGGCATGGTTTCTGTGG + Intronic
977596010 4:98882042-98882064 TAAAGCTGACAAGGTTTCAGAGG + Intronic
983782533 4:171689125-171689147 TGGATTTGTCATGGTTTCTCTGG + Intergenic
984656428 4:182323445-182323467 TGCATTTGACAAAGTTTCAGTGG + Intronic
986422733 5:7600509-7600531 AGGGTCTGAGATGGTCTCAGAGG + Intronic
987173753 5:15285891-15285913 TGGATGTGACATCGGTTTAGAGG + Intergenic
988874955 5:35433762-35433784 TGGATCTCACTTTGTTTCATAGG - Intergenic
989597611 5:43171326-43171348 TAGATGGGACATGGTTTTAGAGG - Intronic
995165356 5:109033543-109033565 CGCCTCTGAAATGGTTTCAGAGG - Intronic
997169450 5:131701197-131701219 GGGAGTTGCCATGGTTTCAGAGG - Intronic
997378615 5:133418821-133418843 TGGTTGTGATATGGTTTCATGGG - Intronic
997843512 5:137264379-137264401 TGGATTTGAAATGGGTTGAGGGG - Intronic
997866343 5:137466926-137466948 GGGATCTGCCAAGGTTTCACGGG + Intronic
998891261 5:146748399-146748421 AGGATCTGACATTGATACAGTGG + Intronic
1000096086 5:157971988-157972010 ATGATCTCACATGGTTTCTGAGG + Intergenic
1000241295 5:159410930-159410952 TGGGTCTGACATGGTCTCACTGG + Intergenic
1003091534 6:3107858-3107880 GGGTTCTGAGATGCTTTCAGTGG + Intronic
1004668306 6:17770164-17770186 TGGGTCTGACATGGTGTCGCTGG + Intronic
1007219641 6:40268473-40268495 TGGATGTGAGAGGGTTTAAGGGG - Intergenic
1008464378 6:51814493-51814515 TTGCTGTGAAATGGTTTCAGAGG - Intronic
1012567113 6:100671421-100671443 TGGATCTCAAATGGCTTCTGTGG - Intronic
1013349492 6:109292363-109292385 TGGAGGTGATATGGTTTCAGAGG + Intergenic
1013797760 6:113905688-113905710 TGGATCTGACATGTTGTGTGTGG + Intergenic
1014100552 6:117506747-117506769 AGGATCTGGCATGGCTGCAGAGG + Intronic
1014994277 6:128122925-128122947 TGGATATGGCATGGTGTAAGTGG + Intronic
1015320789 6:131871670-131871692 TAGATCTGGTATGGTTTCACTGG - Intronic
1017817284 6:158025180-158025202 TGCATCTGACATGGTGGGAGAGG + Intronic
1018255104 6:161910596-161910618 TGGCTTTGACAGGGTTTGAGAGG + Intronic
1023512069 7:40963855-40963877 TGCATCTGACATCTTTTCAAAGG - Intergenic
1024476718 7:49819811-49819833 TGGACCTGAGATGGTACCAGAGG - Intronic
1028180975 7:87724230-87724252 GGCAGGTGACATGGTTTCAGGGG - Intronic
1029319218 7:99742850-99742872 TTGAACTGACATGATTTCAAGGG + Intergenic
1030162336 7:106521621-106521643 TGGGTCTGTCTTGGGTTCAGAGG - Intergenic
1034869318 7:154669674-154669696 TACATCTGACATGGTTAAAGTGG + Intronic
1035690525 8:1556745-1556767 TAACTCTGACTTGGTTTCAGTGG + Intronic
1036602080 8:10270592-10270614 CTGCTCTGACGTGGTTTCAGTGG - Intronic
1041924111 8:63218367-63218389 AAGACCTGACATGGTTTCAGTGG - Intergenic
1042655445 8:71090685-71090707 AAGATCTGACATGGTTTAACAGG - Intergenic
1043509799 8:80938654-80938676 TGGATCAGAGATGGTTTACGTGG + Intergenic
1045054827 8:98359935-98359957 TGAATGTGCCATGTTTTCAGGGG + Intergenic
1046301956 8:112306304-112306326 TGATTCTGAGATTGTTTCAGAGG - Intronic
1046929109 8:119825182-119825204 TGGATGTGACATGGAGTCAAGGG + Intronic
1047715786 8:127593936-127593958 TGTCTCTAACATGGTTACAGTGG + Intergenic
1049640408 8:143712633-143712655 TGGATCTGGCCTGGGTTCTGAGG - Intronic
1050152434 9:2630099-2630121 TGGTTCTTACAATGTTTCAGAGG + Intronic
1061222339 9:129259425-129259447 GAAATCTGACATGGTCTCAGAGG + Intergenic
1061371708 9:130201145-130201167 CGGGACTGACGTGGTTTCAGTGG + Intronic
1187491863 X:19759708-19759730 TGGATTTTACATTGTTTCAGTGG + Intronic
1187669387 X:21654403-21654425 TGGATGTGTCATGTTTACAGTGG + Exonic
1188493124 X:30756519-30756541 TGGAACTAACATGGCTCCAGCGG - Intergenic
1189127628 X:38464647-38464669 TGGCTCTGAATTGGTTTCAGAGG + Intronic
1190916590 X:54815690-54815712 GGTATCTGCCTTGGTTTCAGTGG + Exonic
1192738345 X:73870235-73870257 TGGAGATGACATAGCTTCAGAGG - Intergenic
1194008223 X:88523892-88523914 TGGCTTTTACTTGGTTTCAGAGG - Intergenic
1197794619 X:130285902-130285924 TGGATCTAACTTGGCTTCAGTGG + Intergenic
1198406786 X:136321060-136321082 TGTATCTGACATCATTTCAGAGG + Intronic
1200148615 X:153940476-153940498 TCCATATGACATGGTGTCAGAGG + Intronic
1200937864 Y:8753988-8754010 TGAATCTGCCATGAATTCAGAGG - Intergenic