ID: 924658162

View in Genome Browser
Species Human (GRCh38)
Location 1:245992416-245992438
Sequence AAGAACATGGTGTGGTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924658162_924658165 -3 Left 924658162 1:245992416-245992438 CCTGACTACCACACCATGTTCTT 0: 1
1: 0
2: 1
3: 10
4: 134
Right 924658165 1:245992436-245992458 CTTCCAAAACATTTCAACAAAGG 0: 1
1: 0
2: 2
3: 28
4: 311
924658162_924658167 21 Left 924658162 1:245992416-245992438 CCTGACTACCACACCATGTTCTT 0: 1
1: 0
2: 1
3: 10
4: 134
Right 924658167 1:245992460-245992482 GCCATGTAGTAAAATCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924658162 Original CRISPR AAGAACATGGTGTGGTAGTC AGG (reversed) Intronic
900208226 1:1440545-1440567 AAGAAGATGGTGTGGTTGCTGGG - Exonic
906041469 1:42790851-42790873 AAGGAAATGCTGTGGTAGTTTGG + Intronic
906642801 1:47451434-47451456 AAGAACACGATGTGGAAGTCAGG + Intergenic
908326044 1:63024676-63024698 TAGAACGTGGTGTGGGAGTTGGG + Intergenic
908957375 1:69649709-69649731 AAGTATATGGTTTGGTAGACAGG + Intronic
910396479 1:86799214-86799236 CAGAAAATGGTGTGGGAGCCAGG - Intergenic
911208157 1:95113524-95113546 AAGAACATGGTAGGGTTGTGTGG + Intergenic
915269724 1:154745331-154745353 AAGAACAAGCTGTGGTTGTTTGG - Intronic
915273523 1:154772502-154772524 AAGAGCATGCTGAGGTGGTCAGG - Intronic
915635788 1:157185608-157185630 AAGGACATGGTGGGGTTGTGGGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
919184126 1:194121765-194121787 AAGAGCATGGTGTTGATGTCTGG + Intergenic
921464370 1:215468821-215468843 AAGATAATGGTGGGGTAATCTGG + Intergenic
921730724 1:218575363-218575385 AAGAACATTCTCTGGTAGACAGG + Intergenic
924658162 1:245992416-245992438 AAGAACATGGTGTGGTAGTCAGG - Intronic
1062942297 10:1433188-1433210 AAGAACACGGTGGGATAGCCAGG + Intronic
1068365173 10:56038573-56038595 AAGAACATGGGGTGGTAGAAAGG + Intergenic
1068704181 10:60055293-60055315 AAGAACACGGAGTGGGAGTTAGG + Intronic
1072540192 10:96392611-96392633 CAGAACCTGGGGTGGAAGTCAGG + Intronic
1072760520 10:98052509-98052531 AAGAACATGGCTTGGGGGTCGGG + Intergenic
1077931330 11:6736208-6736230 AAGAACATGCTATTGGAGTCAGG - Intergenic
1080666333 11:34339509-34339531 AAGACGATGGTGTGGTCGCCTGG + Intronic
1088439879 11:109858314-109858336 AATAACATGCTGTGGTATTTAGG + Intergenic
1090069207 11:123528950-123528972 AACAGCATGGTGTGTCAGTCAGG + Intronic
1091272976 11:134331224-134331246 AAGAACATGATGTAGTATTTCGG - Intergenic
1092089354 12:5791470-5791492 AAAACCATGGTGTGGTCTTCTGG - Intronic
1093089302 12:14903931-14903953 AAGAGCATAGTGTGGCAGTTAGG - Intronic
1098513827 12:71350725-71350747 TAGAAAATGGGGTGGAAGTCAGG - Intronic
1101179908 12:102204735-102204757 GAGAACAAGGTGTGGTAATTTGG + Intergenic
1102042287 12:109808583-109808605 AGGAACAGGGTGAGGTAGTTGGG + Intronic
1105869631 13:24493166-24493188 AAGAACATTTTCTGGTGGTCTGG + Intronic
1106549220 13:30757111-30757133 AGGAAAATGGTGTGGAAGGCTGG - Intronic
1106910089 13:34454210-34454232 AATAACATGGTTTGGTAGGATGG + Intergenic
1107584179 13:41826218-41826240 AAGAAAATGGTGTGGTTCTCAGG + Intronic
1108483282 13:50897704-50897726 AACAACATGCTATGGTATTCGGG + Intergenic
1108551704 13:51552426-51552448 AAGAACATGGTGTCATAGTATGG + Intergenic
1110178576 13:72587609-72587631 CAAAACATGGTGTGGAAGGCAGG - Intergenic
1110377823 13:74814339-74814361 AAGAAAATGGTTTTGTGGTCTGG + Intergenic
1112700206 13:101999340-101999362 AGGGCCATGGTGTGGTAGTCTGG + Intronic
1113048030 13:106177386-106177408 ACAAAAAGGGTGTGGTAGTCAGG - Intergenic
1114787771 14:25620871-25620893 AAGGGCATGGTGAGCTAGTCAGG - Intergenic
1125066392 15:35490892-35490914 AAGAGCATGGTGTTGGAATCTGG + Intronic
1125294580 15:38188592-38188614 AAGAATATGTAATGGTAGTCAGG + Intergenic
1127619578 15:60720559-60720581 AAGGACGTGTTGTGGTATTCTGG + Intronic
1129691957 15:77718853-77718875 AGGAAGATGCTGTGGCAGTCAGG - Intronic
1134306506 16:13037873-13037895 AAGAAACTGGTGGAGTAGTCAGG - Intronic
1137266501 16:46873402-46873424 AAGAACAAGGCGTGGGAGGCTGG - Intergenic
1137928412 16:52563700-52563722 AAGAAAATGGTGGGGGAGGCTGG + Intergenic
1138922279 16:61546271-61546293 AAGAGCATGGTGTGGTGCTGAGG + Intergenic
1139853263 16:69962950-69962972 CAGGCCATGGTGTGGTGGTCAGG - Intronic
1139882234 16:70185859-70185881 CAGGCCATGGTGTGGTGGTCAGG - Intronic
1141394452 16:83692279-83692301 AAGAGCATGGGGAGGGAGTCTGG + Intronic
1143031187 17:3968147-3968169 AGGACCATGGAGCGGTAGTCAGG + Intergenic
1143438249 17:6946734-6946756 AAGAACATGGTGTCAGAATCTGG + Intronic
1143441423 17:6977434-6977456 AAGAACATATTCTAGTAGTCAGG + Intronic
1145854459 17:28139921-28139943 AAGAATATAGTGAGGTAGTGTGG + Intronic
1148661312 17:49335537-49335559 GAGAACATGGTGGGGTAGGGTGG - Intronic
1149252284 17:54784135-54784157 CAGACCATGGTGTGGTGGTAAGG + Intergenic
1149881179 17:60292635-60292657 TAGAACATGGTGTAGCAGTGAGG - Intronic
1150850108 17:68696170-68696192 AAGTAAATGGTGTGGAAGCCCGG - Intergenic
1154254155 18:12768204-12768226 TAGAACAAGGGGTGGTGGTCAGG - Intergenic
1157523440 18:48361093-48361115 ATGAGCATGGTGGGGTAGCCTGG + Intronic
1158310337 18:56151309-56151331 AAGAACATGGTGTGGCAAGGTGG - Intergenic
927432770 2:23041037-23041059 AAGAGCATGGTGTTGGGGTCGGG - Intergenic
929224140 2:39495588-39495610 AAGAACATGGTATGGAATTTTGG + Intergenic
929569660 2:43014033-43014055 GAGAACATGGTGTGCTAGGGTGG - Intergenic
933615327 2:84477519-84477541 AAGTACATGCTGGGGTAGTGGGG + Intergenic
935737153 2:106115346-106115368 CAGAACATTGTGTGGGAGTCAGG - Intronic
937536632 2:122896801-122896823 AACAAGATGGAGTAGTAGTCAGG + Intergenic
938591401 2:132739967-132739989 AAAATCATGGTGTAGTAATCTGG - Intronic
941584864 2:167345326-167345348 AAAAAAATGCTGTGATAGTCTGG - Intergenic
941868777 2:170361912-170361934 AAGAACATAGTCAGTTAGTCTGG + Intronic
942057784 2:172200580-172200602 AGGAAGATGGTGTGGTTGTTGGG + Intergenic
943016313 2:182514952-182514974 AAGAACATGGTTTGGGTGTGTGG - Intronic
945006512 2:205413340-205413362 AAGGAAATGGTGAGGTAGTAAGG - Intronic
948743785 2:240070173-240070195 ACCAACATGGTGTGGTAGCCTGG - Intergenic
1171964930 20:31522609-31522631 AAGCACAGTGTCTGGTAGTCTGG - Intronic
1172764433 20:37343805-37343827 AAGAACAAGGCGAGGTAGCCAGG + Intergenic
1174445637 20:50589126-50589148 AAGAACATTTTGTGTTAGACTGG - Intronic
1178020434 21:28402059-28402081 AAGCAGATGGTGTGGAAGCCTGG - Intergenic
1179474827 21:41636458-41636480 AACAACATGGAGTGTGAGTCAGG - Intergenic
1180122371 21:45762393-45762415 AAGAACATAGTGTGGCAGAAGGG - Intronic
1181172734 22:21018958-21018980 AAGAACAAGGTGGGGGACTCTGG - Intronic
949448773 3:4163714-4163736 AAGAACAGGGAGTGGCAGTTAGG - Intronic
949781422 3:7693088-7693110 AAGAACATGGTCTGCTAGAACGG + Intronic
953527547 3:43706093-43706115 AAGCAGATGGGGTGGTTGTCAGG + Intronic
960007590 3:112795972-112795994 AAGAACATAGTGTGTTAGGTTGG - Intronic
960235367 3:115275629-115275651 AATAACTTTGTATGGTAGTCAGG + Intergenic
967250555 3:187533777-187533799 AAGGACATGCTGTAGTAGTAAGG - Intergenic
969189333 4:5504421-5504443 GGGAACATGGTGTGGTGGTGGGG - Intergenic
970896943 4:21115042-21115064 AGGAACATGGGGTGGTAGCATGG - Intronic
971828948 4:31665124-31665146 AAGAACATGATGAGATAGGCAGG - Intergenic
974646372 4:64698391-64698413 AAGTCAATGGTGTGGTACTCTGG + Intergenic
977526623 4:98153723-98153745 AACACCATGGTCTGGTGGTCTGG + Intergenic
977856652 4:101903475-101903497 AAGAACATGACGTAGTAGACTGG - Intronic
981089728 4:140720335-140720357 AACAACAGTGTGTGGTAGTTAGG + Intronic
981277178 4:142914297-142914319 AAGACCTTGGTGTATTAGTCAGG + Intergenic
983372127 4:166873789-166873811 AAGAACATAGGTTGGTAGTTGGG + Intronic
990111118 5:52326115-52326137 AAGAACATGATGTGGTAGTTTGG + Intergenic
992162745 5:74018262-74018284 AAGAAAATGCTGTTGTAGCCAGG + Intergenic
994118124 5:96083846-96083868 AAAACCATGGTGTGGTGGTTCGG + Intergenic
995277468 5:110293452-110293474 AAGAACATGGTGTTGGCATCTGG - Intronic
996552217 5:124743094-124743116 CAAAACATGGTGTGGGTGTCGGG + Intronic
998519670 5:142788347-142788369 AAAAAAATGGGGTGGGAGTCGGG - Intronic
1000272547 5:159700408-159700430 AAGAAAATTGTATGGTAGGCTGG + Intergenic
1000742180 5:164982845-164982867 ATGCAGATGGTGTGGAAGTCAGG + Intergenic
1001115104 5:168932870-168932892 CATAACCTTGTGTGGTAGTCTGG + Intronic
1002054257 5:176589650-176589672 AAGAACAGGGTGTAGGAGCCTGG + Intronic
1006544622 6:34769487-34769509 AAGAAAATAGTGAGGTAGGCTGG - Intronic
1007928304 6:45667972-45667994 GAGAACATGCTGTGGGAGACTGG + Intergenic
1008000136 6:46351784-46351806 ATGACCATGGTGTGGCAGTTGGG + Intronic
1009502431 6:64431714-64431736 ATGAAAATGCAGTGGTAGTCAGG - Intronic
1011073216 6:83408747-83408769 AAGAAAATGATGTGGTAGATTGG + Intronic
1012678982 6:102154338-102154360 AAGAACATTGGCTGGTAGTCTGG + Intergenic
1014318665 6:119898209-119898231 AATAACCTGGTGTGGAAGTACGG - Intergenic
1017179242 6:151534525-151534547 GAAAATATGGTGTGGTGGTCAGG + Intronic
1017919336 6:158857649-158857671 AAGTACATGGTGAGGGAGGCAGG - Intergenic
1020457860 7:8394609-8394631 AAGAACATTTTATTGTAGTCTGG - Intergenic
1021237854 7:18165256-18165278 AAGAGTATCGTGTGGTAGCCTGG + Intronic
1023734117 7:43219876-43219898 AAGAACCTTTTGTGGTAGTAAGG - Intronic
1026158238 7:67846292-67846314 AAGAAGATGGTGTGATGGTTGGG - Intergenic
1027723261 7:81770695-81770717 AAGAAAAGGGTGTGGTATTGTGG + Intergenic
1034332972 7:150299296-150299318 AAAAACAAGGTGTGGTAGCCGGG + Intronic
1034665068 7:152810584-152810606 AAAAACAAGGTGTGGTAGCCGGG - Intronic
1043454309 8:80398685-80398707 CAGAACTTGGTGTGTTAGCCAGG - Intergenic
1043812951 8:84765294-84765316 AAGAACAAGGAGAGGTAGTGGGG + Intronic
1045672747 8:104575072-104575094 AGGAACATGGTGTGGGAGAGGGG + Intronic
1045688485 8:104736218-104736240 GAAAACATGGTCTGGTAGTTAGG + Intronic
1047009461 8:120655490-120655512 AAGAAGATGGTGTCTTAGTGGGG + Intronic
1050857765 9:10382886-10382908 AATACCATGGTGTGGAAGTGTGG + Intronic
1051086676 9:13358167-13358189 GAGAACCTTGTGTGGTAGTAAGG + Intergenic
1051188213 9:14482449-14482471 AAGAACATGGTGAGGGGGTGAGG - Intergenic
1051769129 9:20557252-20557274 AATAACATAGTGGGGTAGTGGGG + Intronic
1054836805 9:69683921-69683943 AATAACATGTTGTGGGATTCCGG + Intergenic
1056336130 9:85571297-85571319 AAGAACATGCAGTGATAGCCTGG + Intronic
1061171848 9:128962228-128962250 AAGAGTATGGTGTGTTGGTCAGG - Intronic
1186682473 X:11890461-11890483 AAGAAGATTGTTTTGTAGTCAGG + Intergenic
1186862867 X:13690351-13690373 AAGACAATGCTGTGGCAGTCTGG + Intronic
1187467440 X:19539933-19539955 AGAAACATGGTGTGGCAGCCCGG + Intronic
1187643222 X:21317770-21317792 AAGAACATGGTTTAGCAGCCTGG - Intergenic
1189012576 X:37061115-37061137 TAGAAGATGGTTTGGTTGTCAGG - Intergenic
1189860057 X:45262817-45262839 AAGACCATGGAGAGGTATTCTGG + Intergenic
1189995779 X:46636145-46636167 TACAACATGGTGTGCTTGTCTGG - Intronic
1192357832 X:70420442-70420464 GAGAACATAGAGTAGTAGTCTGG - Exonic
1198633524 X:138669680-138669702 AAGAACAAGGTGTGGGGGCCAGG - Intronic
1199715098 X:150502426-150502448 AAGCACTTGGTGTGCTCGTCAGG + Intronic