ID: 924661008

View in Genome Browser
Species Human (GRCh38)
Location 1:246016701-246016723
Sequence CTGTGGAAGAGGGGCCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 650
Summary {0: 1, 1: 0, 2: 10, 3: 69, 4: 570}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924661008 Original CRISPR CTGTGGAAGAGGGGCCAGGA GGG Intronic
900195564 1:1374019-1374041 CTGCGGAGGAAGGTCCAGGAGGG - Exonic
900634807 1:3657788-3657810 CTGTGGAGGAGGCGCCAGGCGGG - Intronic
901323884 1:8355802-8355824 CCTTGGAGGAGGGGCCAGGCAGG - Intronic
901929095 1:12585615-12585637 AGGGGGAAGAGGAGCCAGGAAGG - Intronic
903072481 1:20733092-20733114 CTGAGGAGGAGTGGCCAGCATGG - Intergenic
903358102 1:22760479-22760501 CTGGGGAAGAGGGCACAGGTGGG - Intronic
903450913 1:23453029-23453051 CTGTGTGAAAGGGGGCAGGAGGG + Intronic
903839129 1:26225725-26225747 CTCTGGAAGAGGAGTCAGGGAGG - Intergenic
903938161 1:26910902-26910924 CTGGGGCAGAGGGGCAGGGAAGG + Intronic
904263799 1:29306261-29306283 GTGTGGAAGAGGGGCGAGGCGGG + Intronic
904335960 1:29798277-29798299 CTGGGGAAGAGGAGGCAGGGTGG - Intergenic
904353498 1:29924049-29924071 TTGTGGAGGAGGGGAGAGGAAGG - Intergenic
905025855 1:34848818-34848840 CTGTAGGCGAGGAGCCAGGAAGG + Intronic
905146217 1:35888654-35888676 CCTTGAAAGAGGGGCCAGAAAGG + Intronic
905370171 1:37478867-37478889 ATGTGGCAGAGGGACCGGGAAGG + Intronic
905483592 1:38279573-38279595 CTGTGGAGGAGGGGCCACAGGGG - Intergenic
905942561 1:41875421-41875443 CAGATGAAGAGGGGCCAGAAGGG - Intronic
905952510 1:41964108-41964130 TTGTGGAGGAGGGGCCAAGATGG + Intronic
906085899 1:43134529-43134551 ATGTGGAAAAGTGGGCAGGAGGG - Intergenic
906100288 1:43255951-43255973 CTGGGGATGAGGGGCCAGCAGGG + Intronic
909559944 1:76999159-76999181 CTTTGGAATAGGGGACAGTAAGG + Intronic
909933053 1:81520357-81520379 GTGTGGCAGAGGGGCGGGGATGG - Intronic
910358030 1:86382846-86382868 CTGAGGAGTTGGGGCCAGGATGG + Intronic
910861574 1:91747422-91747444 CTGGGGAAGAGGGGACAGAGAGG - Intronic
912383838 1:109261646-109261668 CTTTGGAAGATGGGCAAGGATGG - Intronic
912415479 1:109505699-109505721 CTGTGGGTGAGGGGCTTGGAGGG - Exonic
912495645 1:110089616-110089638 GTGTGGAGGAAGGGCCAGGGAGG - Intergenic
912512846 1:110200233-110200255 CTGTGGAAGAGGGATGAGTAAGG - Exonic
913116225 1:115699906-115699928 CAGAGGAAGAGGGGCTAGAAAGG + Intergenic
914254490 1:145950301-145950323 CTGTGGAAGAGAGGGAAAGAAGG + Intronic
914801574 1:150966289-150966311 CTGTGGAAAAGGGACAAGAAGGG + Intronic
914876213 1:151514147-151514169 ATGTGGATCAGGGGCCAGGAGGG - Intronic
915164452 1:153940870-153940892 CTGGGGAAGATGGGCCAGGCGGG + Intronic
915952033 1:160195874-160195896 CTTTGGGAGAGGGGGTAGGAGGG - Intronic
916784171 1:168071870-168071892 TTGAGGAAGAGAGGCCAGTATGG - Intronic
916849881 1:168692975-168692997 ATATGGATGAAGGGCCAGGATGG + Intergenic
917797414 1:178542202-178542224 CTGGGAGAGAGGGGCCAAGAGGG + Intronic
917811682 1:178664523-178664545 ATGAGGAAGAGAGGACAGGATGG + Intergenic
917927285 1:179799898-179799920 CTCAGGAAGAGAGGCCTGGAAGG + Intronic
918219745 1:182426136-182426158 CTATTGAAGAAGGGTCAGGATGG + Intergenic
918786196 1:188768178-188768200 ATGTGGGGGAGGGGCCAAGATGG + Intergenic
919973929 1:202598827-202598849 CAGTGGAAGTGGGGCAGGGATGG + Intronic
920067875 1:203282028-203282050 GAGTGGGAGAGGGGCAAGGAGGG - Intergenic
920840562 1:209550365-209550387 GTGGGGAAGAGGGGGCTGGAAGG - Intergenic
920847972 1:209609342-209609364 GTTTAGAAGATGGGCCAGGAGGG + Intronic
921188026 1:212686342-212686364 CTGTGGGAGAGTGGCCAGGCAGG + Intergenic
921300591 1:213748022-213748044 CTGTGTATGAGGAGCCAGGTGGG + Intergenic
921516540 1:216099298-216099320 GAGTGGAAGAGTTGCCAGGAAGG - Intronic
922785407 1:228280079-228280101 CTGTGGAAGGTGGGGCATGAGGG + Exonic
923402863 1:233632037-233632059 ACGTGGAAGAGGGAACAGGATGG - Intronic
924454790 1:244210799-244210821 CTGGAGAAGAGTGGCTAGGATGG - Intergenic
924661008 1:246016701-246016723 CTGTGGAAGAGGGGCCAGGAGGG + Intronic
924878121 1:248128312-248128334 TACTGGAAGAGGGGCCAAGATGG + Intergenic
924947137 1:248854153-248854175 CTGGGGCACAGGGGCCAGGAAGG - Intronic
1064370363 10:14747534-14747556 CTATGGAAGAGGGGCCTGAATGG - Intronic
1064435802 10:15310467-15310489 CTGTGGGAGAGGGGCCAGGTTGG - Intronic
1064652511 10:17523708-17523730 CTGTGGAAAATGGGACAGGGTGG - Intergenic
1065540843 10:26765615-26765637 CTGAGGAAGAGGGGAAGGGAAGG + Intronic
1065743164 10:28815408-28815430 GTGTGGAAGAGGGCCCAAGCGGG + Intergenic
1065838681 10:29682002-29682024 CTGAGGGAGTGGGGACAGGAAGG - Intronic
1065854101 10:29815812-29815834 GGGTGGAAGAGGGGACAGGAAGG - Intergenic
1066046290 10:31598356-31598378 ATGTGGGAGAGAAGCCAGGATGG + Intergenic
1067038922 10:42938388-42938410 CAGTGAAGGAGGGGCCAGGGAGG - Intergenic
1067936767 10:50619522-50619544 CTGGGGGAGAGGGGCCTGGGGGG + Intronic
1068837182 10:61568090-61568112 CTGGGGGAGAGGAGCCAGGGTGG + Intergenic
1070312614 10:75284452-75284474 ATGGGGAAGAGAGGACAGGAAGG + Intergenic
1070557312 10:77538695-77538717 CTGTGGCAGAGGGACCAAGGTGG - Intronic
1070789190 10:79179667-79179689 CTGGGAAGGAGGGGCCAAGAGGG + Intronic
1070811674 10:79301227-79301249 GTAGGGAGGAGGGGCCAGGAGGG - Intronic
1070913531 10:80137987-80138009 CTCAGGATGTGGGGCCAGGATGG + Intronic
1071605062 10:86980204-86980226 CTGGGGAGGAGGGGACAGGGAGG + Intronic
1072714972 10:97744920-97744942 GTATGGAAGAGAGGCCAGGGAGG + Intronic
1072892945 10:99341226-99341248 CTGAGGAAGGAGGGCCAGCATGG + Intronic
1072987027 10:100149823-100149845 CTGTGGCAGAGGGGCAAGGAGGG - Intergenic
1073597693 10:104817343-104817365 GGGTGGAAGAGGGGGGAGGAGGG - Intronic
1073716500 10:106114385-106114407 ATGTGGGGGAGGGGCCAAGATGG + Intergenic
1073775916 10:106785796-106785818 CTTTGGAAGATGGGCCTAGAGGG + Intronic
1074273221 10:111975659-111975681 CTAAGGAAGAGTGGCCAGGAAGG + Intergenic
1074661546 10:115664107-115664129 CACTGGCAAAGGGGCCAGGAAGG - Intronic
1074774021 10:116753213-116753235 CCATGGCAGTGGGGCCAGGATGG + Intergenic
1074778401 10:116783300-116783322 CAGTGGCAGAGGAGCCTGGATGG + Intergenic
1075569765 10:123531437-123531459 TAGAGGAAGAGGGGCCAGGTGGG - Intergenic
1076426177 10:130369253-130369275 CTGGGGAAGAGGGAGCAGGAGGG + Intergenic
1077013911 11:391723-391745 CGGTGGGAGAGGGCGCAGGAGGG - Intergenic
1077015242 11:396397-396419 CTGTGGAAGATGGACCACCAGGG + Intronic
1077140191 11:1020836-1020858 CTGTGGTGGAGGGGACTGGAGGG + Intronic
1078156822 11:8806943-8806965 AAGTGGAGAAGGGGCCAGGAGGG - Intronic
1078227530 11:9405892-9405914 CTGTGGAAGACAGGAAAGGAAGG - Intronic
1078360876 11:10666835-10666857 TTGTGGAACCTGGGCCAGGAAGG - Intronic
1079141418 11:17812543-17812565 CTGTGGCACAGGGGCCAAGCAGG + Intronic
1079244809 11:18744200-18744222 CTGTGGAAGATGGGCCATGCGGG + Intronic
1079249160 11:18774511-18774533 CTGAGGAGGAGGGGGCTGGAGGG + Intronic
1079638383 11:22773798-22773820 CTGTGGAAGCGAGGTCAGGAAGG - Intronic
1080190106 11:29534929-29534951 CTGAGGAAGAGGGGCCAACTGGG - Intergenic
1080641583 11:34161485-34161507 TTGTGGAGGGGTGGCCAGGAGGG + Intronic
1081296552 11:41397249-41397271 AGGTGGAAGAGGAGGCAGGAGGG - Intronic
1081458966 11:43253409-43253431 CTTTGGTGGAGGGGGCAGGAAGG - Intergenic
1081566366 11:44263543-44263565 CTGTGGAAGAAGTGTAAGGACGG + Exonic
1081669466 11:44935018-44935040 CTGTGGGAGAGAGTCCAGCAAGG + Intronic
1081669929 11:44937200-44937222 CCCTGCACGAGGGGCCAGGATGG + Intronic
1084022340 11:66425082-66425104 CTGAGGCAGAGGGCCCAGGAGGG + Exonic
1084161328 11:67352020-67352042 CTGTGGAAGATGGGGTGGGAGGG + Intronic
1084361235 11:68669809-68669831 CTGGGGAAAAGGGGTCAGGGTGG - Intergenic
1084698207 11:70768857-70768879 CATGGGAAGAGGGGCCAGGTGGG + Intronic
1084790281 11:71471201-71471223 CCGTGGAAGAGGTGGCAGGAAGG + Intronic
1084881936 11:72177735-72177757 GTGTGGCAGAGGGCCCAGGCCGG - Intergenic
1085046249 11:73355510-73355532 CTGTGGAGGAGGAGGCAGGTTGG - Intronic
1085712360 11:78841658-78841680 CTGTGGGAAAGGAGCCAGGGGGG - Intronic
1086353071 11:85962877-85962899 CTTTGGAATAGATGCCAGGAAGG - Intronic
1087384676 11:97455866-97455888 GTGTGGGAGAGAGGACAGGAAGG + Intergenic
1087551368 11:99654469-99654491 CTGTGGAACAGGGGGTAGTATGG + Intronic
1087700471 11:101431344-101431366 CTGTGAAAGAGGGGAAAAGAAGG - Intergenic
1088688316 11:112303749-112303771 CTGTGGAAGAGAGGACCTGAGGG - Intergenic
1088723344 11:112613469-112613491 CTGGGATGGAGGGGCCAGGAGGG + Intergenic
1088805423 11:113347951-113347973 AGGTAGGAGAGGGGCCAGGAAGG - Intronic
1088848169 11:113684728-113684750 GGGTGGAGGTGGGGCCAGGAAGG - Intergenic
1089503384 11:118946475-118946497 CTGTGGAAGAGAGTCCTTGAGGG - Intronic
1089727670 11:120496906-120496928 CTGGGGAAGAGGGCTCACGATGG - Intergenic
1089898551 11:121957071-121957093 CTGAGGAAGAGTGGACAGGGAGG + Intergenic
1090124005 11:124066703-124066725 CAGGGGAAGAGAGGACAGGAAGG - Intergenic
1090307386 11:125703137-125703159 TTATGGAGGAGGGGCCAAGATGG + Intergenic
1090979017 11:131700665-131700687 CTGAGGATGAGGTGCCTGGAAGG - Intronic
1091246230 11:134097365-134097387 CTGTAGAAGAGTGGCCAGCTGGG - Intronic
1091252341 11:134154423-134154445 CTGAGGAAGAGGACGCAGGAGGG - Intronic
1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG + Intronic
1091297687 11:134485485-134485507 TTGGGGAAGGGGAGCCAGGAGGG + Intergenic
1091449097 12:561661-561683 CTTTGAGAGAGAGGCCAGGAGGG + Exonic
1091718479 12:2795719-2795741 CGGTGGAACACGGGCCAGGACGG + Intronic
1091776257 12:3186828-3186850 CTGGGGAGGAGGGGGCAGGATGG + Intronic
1092305126 12:7292492-7292514 GTTTGGAAGAGGGGCCTGGTGGG - Intergenic
1093057473 12:14568990-14569012 CAGTGGGAGAGGGGGAAGGAGGG + Intergenic
1094719996 12:33053117-33053139 CTGAGGGCAAGGGGCCAGGAGGG - Intergenic
1094729778 12:33161573-33161595 CTGTGGGAGAGGGAGCATGAGGG + Intergenic
1095466259 12:42490685-42490707 CAGTGGAAGGGGTGGCAGGAGGG + Intronic
1095839265 12:46674331-46674353 GTGTGGCAGTGGTGCCAGGAGGG + Intergenic
1096661589 12:53128737-53128759 CGGTGGAGGAGGCGCCTGGATGG - Intergenic
1096788359 12:54030462-54030484 CTGGGGCAGAGGGGCTAGGCAGG - Exonic
1096789480 12:54035910-54035932 CTGGGGAAGAGGGAGCAGGGAGG + Intronic
1097640445 12:62174401-62174423 CTGAGGAAGAGGAGCCAGCAAGG + Intronic
1100984445 12:100190824-100190846 CTGTGGGAGGGAGGCCTGGAAGG + Intergenic
1102030586 12:109737984-109738006 CAAGGGAAGAGGGGTCAGGAAGG + Intronic
1102038637 12:109786681-109786703 CTGGGGCAGTGGGGCCAGGATGG - Intronic
1102455026 12:113065775-113065797 GTGACGAGGAGGGGCCAGGACGG + Intronic
1102467420 12:113137997-113138019 CTCTGGAAGATGGGCCAAGATGG - Intergenic
1102625615 12:114233179-114233201 CTTTGGAAGAGGGGCCTAGCAGG - Intergenic
1103035644 12:117654340-117654362 CTGGGGAAGAGAAGGCAGGATGG - Intronic
1103623883 12:122204499-122204521 CTGTGGACGAGAGGCCCGGGCGG - Intronic
1103791750 12:123477026-123477048 CTGAAGCAGAGGGGCCAGGCAGG + Intronic
1103921978 12:124403930-124403952 TTCTGTAAGAGGAGCCAGGAAGG + Intronic
1104054256 12:125217260-125217282 GTGGGGAAGAGAGGCCAGGCTGG + Intronic
1104803459 12:131570227-131570249 AGGTGGAAGAGGGGCCAACAAGG + Intergenic
1105277664 13:18944931-18944953 CGGTGCAGGAGTGGCCAGGAGGG + Intergenic
1106190737 13:27450413-27450435 CTGTGGAGGAGGCACCCGGAAGG - Intronic
1106328347 13:28716245-28716267 CTGTGTTAGAGGTTCCAGGATGG + Intronic
1107655560 13:42589392-42589414 CAGTGGCAGTGAGGCCAGGAGGG - Intronic
1107858279 13:44636441-44636463 GTGAAGAAGAGGGGCAAGGAAGG + Intergenic
1108396779 13:49997385-49997407 CGCTGGTAGCGGGGCCAGGAAGG - Intronic
1109357470 13:61248841-61248863 CTGTGGAAGATGGTACAGAAGGG - Intergenic
1112196262 13:97229635-97229657 ATGTGGTATAGTGGCCAGGAAGG + Intronic
1112803706 13:103139058-103139080 CTGTGGAAGAGGGTCCAGTGGGG + Intergenic
1112844195 13:103617825-103617847 CAGTGGAAGATGGGTCTGGAAGG - Intergenic
1112945063 13:104918503-104918525 TGTTGGAAGAGGGGCCTGGAGGG + Intergenic
1113618465 13:111697239-111697261 CTGTGGAGGAAGGGAGAGGAAGG - Intergenic
1113623994 13:111782500-111782522 CTGTGGAGGAAGGGAGAGGAAGG - Intergenic
1113751288 13:112778051-112778073 CTGTAGAAGAAGGAACAGGAAGG - Intronic
1113801868 13:113090923-113090945 CAGTGAAGGAGGGGCCGGGAGGG - Intronic
1114556249 14:23564018-23564040 CAGTGATAGAGGGGACAGGAGGG - Intronic
1114598567 14:23935140-23935162 GTGTGGAGGTGGGGCCTGGAGGG - Intergenic
1114649896 14:24277828-24277850 GTGGGGAAGCGGGGCCAGCAAGG + Intergenic
1116428552 14:44820013-44820035 CTGCAGAGGAGGGGCCAAGATGG + Intergenic
1116870048 14:50061812-50061834 CCTTGCAGGAGGGGCCAGGAGGG + Intergenic
1118391305 14:65298114-65298136 CTGTGGAATAGGAGCCACCAAGG - Intergenic
1118689701 14:68326400-68326422 GTGAGTAAGAGGGTCCAGGATGG - Intronic
1118723224 14:68608841-68608863 CAGAGGAAGAGGGACCAGCAGGG - Intronic
1118775662 14:68972364-68972386 CAGGGGAAGAGGGACAAGGATGG + Intronic
1118843190 14:69527760-69527782 CTGTGGCGGCAGGGCCAGGAAGG - Intronic
1119705834 14:76782046-76782068 CTGTGGAAAATGGACCAGGTTGG + Exonic
1119757228 14:77127724-77127746 ATGTGGAGGAGGGGCTGGGAGGG + Intronic
1120678493 14:87451039-87451061 AAGTGGAAGAGTGGCCAGGATGG - Intergenic
1121046257 14:90790601-90790623 CTGTGGCAGGGAGGCGAGGAGGG - Intronic
1121789792 14:96690425-96690447 CTGGGGCAGAGAGGGCAGGACGG - Intergenic
1121846101 14:97173562-97173584 CTGTGGGAGAAAGGCCAGGTTGG - Intergenic
1122292783 14:100688468-100688490 CTGGGGGTGGGGGGCCAGGAAGG - Intergenic
1122884740 14:104706012-104706034 CTGTGCAGGAGGGGCCAGGTGGG - Intronic
1123032273 14:105457513-105457535 GGGTGGAAGAGGGGCCAGGAGGG + Intronic
1123097663 14:105774079-105774101 CAGTGGAAGATGGGCAAGCAGGG - Intergenic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1125736303 15:41928869-41928891 CTGGGGAAAAGGGGGCAGGGAGG - Intronic
1126283641 15:46986543-46986565 CTGGGGAAGAGAAGGCAGGATGG - Intergenic
1126725448 15:51626859-51626881 CTGTGGTAGAAGGTCCAAGATGG + Intergenic
1127373580 15:58362297-58362319 CTGTGGAAGATGGAGCAGCAAGG - Intronic
1128113801 15:65093232-65093254 CTGAGGAAGAGGAGACAGGGAGG + Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128331347 15:66757590-66757612 CTGTGGGACAAGGGCCAGAAGGG - Intronic
1128495847 15:68198100-68198122 CCGTGGAGGAGGGGCTGGGATGG - Intronic
1129060014 15:72853246-72853268 CAGTGGAGGAGGGGCCCGGCAGG + Intergenic
1130561686 15:84963926-84963948 CTGTGGAAGAGCCGAGAGGAAGG - Intergenic
1130795390 15:87203251-87203273 CTGTGGAAGTGGGGAAAGGTGGG + Intergenic
1131263647 15:90903060-90903082 CGGCGTCAGAGGGGCCAGGAAGG + Exonic
1132692325 16:1187185-1187207 CTGAGAATGAGGGGCCGGGAGGG + Intronic
1133230778 16:4365546-4365568 CTGGGGAAGAGAGGGCAAGATGG + Intronic
1133234247 16:4380468-4380490 GTCTGGAAGAGGGGGCAGGCAGG - Intronic
1133304641 16:4801586-4801608 CTGTGGAACAGAGGGAAGGAGGG + Intronic
1136080660 16:27850572-27850594 CTGAGGCAGAGTGGCCAGGGAGG + Intronic
1136684668 16:31987017-31987039 CTGTGGAAGGGGGGCTGAGATGG + Intergenic
1136785292 16:32930553-32930575 CTGTGGAAGGGGGGCTGAGATGG + Intergenic
1136884490 16:33923251-33923273 CTGTGGAAGGGGGGCTGAGATGG - Intergenic
1138317031 16:56078988-56079010 CTGTGGAAGTGGTACCAGGGAGG - Intergenic
1138618911 16:58197052-58197074 CTTGGGAAGATGGGGCAGGAAGG + Intronic
1139371839 16:66473836-66473858 GGGTGGGAGAGAGGCCAGGAGGG - Intronic
1139759318 16:69171670-69171692 CTGTGGGAGAGGGGAGAGGAGGG + Intronic
1140376335 16:74448192-74448214 CTGTGGAGGAAGGACCAAGAAGG + Intergenic
1140769094 16:78187264-78187286 CTTTGCAAGAGGTGCCAGGTGGG + Intronic
1140892916 16:79300028-79300050 CTGCGGAAGAGACGCCAGGTGGG - Intergenic
1141360631 16:83392172-83392194 ATGAGGCAGTGGGGCCAGGATGG - Intronic
1141611356 16:85182811-85182833 CTGTGGATGCTGGGGCAGGAGGG - Intronic
1141926241 16:87171660-87171682 CTGGGGAAGGGGGGTCAGGAAGG + Intronic
1142284366 16:89165719-89165741 GGGTGGAAGAGGGAGCAGGAAGG - Intergenic
1142299271 16:89247261-89247283 CTGAGGCAGAGGCGCCAGGGAGG + Intergenic
1142393185 16:89816166-89816188 CCGGGGAAGACGGCCCAGGAGGG + Intronic
1142560706 17:807386-807408 CTGTGGAAGAGAGGCAGGCACGG + Intronic
1142604995 17:1076683-1076705 CCCTGGAAGGGCGGCCAGGAGGG + Intronic
1142621170 17:1166500-1166522 GTGTGGCAGTGGGGCCAGGAGGG + Intronic
1142640325 17:1281595-1281617 CTGTGGAAGCAGGGCCGGGCAGG + Intronic
1142679130 17:1535362-1535384 CTGTGGAGGAGGGGCATGGCTGG - Intronic
1142974140 17:3633374-3633396 CTGGGGAAGAGGGGCAAGCGTGG + Intronic
1143263604 17:5619177-5619199 ATCAGGGAGAGGGGCCAGGAAGG - Intronic
1144773779 17:17773781-17773803 CAGGGGAAGAAGGGCTAGGAGGG - Intronic
1144791554 17:17862398-17862420 CTGTGGATGAGGGGCCAGGCAGG + Intronic
1145997281 17:29111903-29111925 CTGTGGGAAAGGGGCCAGGGTGG + Intronic
1146311410 17:31771245-31771267 CTGTGGGATAGGGGCAAAGAAGG - Intergenic
1146491730 17:33288186-33288208 GGGTGGAAGAGGGGCAAGAAGGG + Intronic
1146637129 17:34514751-34514773 CGGTAGGAGAGGGGCCAGGGAGG - Intergenic
1147145601 17:38482698-38482720 CTGTGGAAGAGGGGCTGAGATGG + Intronic
1147510946 17:41068487-41068509 CTGTAGATGATGGGCCAGGGTGG - Intergenic
1147613252 17:41813431-41813453 GTTTGGAAGTGGGGGCAGGAGGG - Intronic
1147860855 17:43522192-43522214 CTGTTGAAGAGGGCACTGGAAGG - Exonic
1147916741 17:43892190-43892212 CAGTGTAGGAGGGGCCAGGCTGG - Intronic
1148075199 17:44931749-44931771 CACAGGTAGAGGGGCCAGGATGG + Intronic
1148090536 17:45020326-45020348 CTGAGGCAGAGGAGCTAGGAAGG + Intergenic
1148913967 17:50958945-50958967 GTGTGGAACAGTGGCAAGGATGG - Intergenic
1149595597 17:57862796-57862818 CTGAGGAAGGGGGACCAGAAGGG + Exonic
1149682113 17:58514125-58514147 CAGTGGCTGCGGGGCCAGGATGG + Intronic
1149782566 17:59409650-59409672 CAGTGGAAGAGGGGCCATGGTGG - Intergenic
1149919793 17:60646552-60646574 ATGTGGAAGAGGAGACAGAAAGG - Intronic
1150090657 17:62322317-62322339 TTGAGGAGGAGGGGCCAAGATGG + Intergenic
1151143329 17:72016220-72016242 CTGGGGAAGAGGGGACAGGAAGG + Intergenic
1151161217 17:72167355-72167377 CTGTGGAAGCAGTGGCAGGAGGG - Intergenic
1152120037 17:78412938-78412960 CTGGGGAAGAGGGGGTGGGAGGG + Intronic
1152240285 17:79157355-79157377 CTGTGGAAGGGGTGCATGGACGG - Intronic
1152570555 17:81119626-81119648 CTGTGGGAGCGGGGCCGGGCCGG - Intronic
1152616362 17:81339751-81339773 CACTGGAGGAAGGGCCAGGAGGG + Intergenic
1152632129 17:81415064-81415086 CCCTGGAAGAGGGGCCGGGGCGG - Intronic
1152754556 17:82081844-82081866 CTGTGGGGGAGGGGGCAGGTGGG + Intronic
1152768437 17:82153230-82153252 CTGGGGGAGAGGGGCCAGGCAGG + Intronic
1153535206 18:6094822-6094844 CTCTGGAACTGGGGACAGGATGG + Intronic
1155718336 18:28975474-28975496 CTGTGGAGCAGGGCCAAGGAGGG + Intergenic
1156485637 18:37463946-37463968 ATGAGGGAGAGGGGACAGGAGGG - Intronic
1157181184 18:45499685-45499707 TTGGGGAAGAGGGGCCAGGAGGG + Intronic
1157217806 18:45800191-45800213 CTGTGGAGGTGGAGCCAAGATGG - Intergenic
1157637708 18:49177185-49177207 GAGTGCAAGAGGAGCCAGGATGG + Intronic
1158358746 18:56648877-56648899 TTCTGGGAGAGGGTCCAGGAAGG + Intronic
1158667713 18:59447956-59447978 GTGTGGAAGAGGGCACAGGAGGG - Intronic
1158898540 18:61939220-61939242 CTGAGAAAGAGAGGCCAGGCGGG - Intergenic
1159203377 18:65218444-65218466 CTCTGGAAGAGGGGGCAGAAAGG - Intergenic
1160054422 18:75465523-75465545 CTGTGGGAGGGGGCCCAGGGGGG + Intergenic
1160408272 18:78657924-78657946 AAGTGGAAGGAGGGCCAGGAAGG + Intergenic
1160785783 19:899725-899747 CTGTGGGTGGGGGGCCAGGGAGG + Intronic
1161268294 19:3375297-3375319 CTGTGGAGGAGATGCCAGGCGGG - Intronic
1161316941 19:3621558-3621580 CTGTGGAAGCGGCCCCAGGCTGG - Intronic
1161347560 19:3775813-3775835 CTGTGCCAGAGAGGACAGGAGGG + Intergenic
1162076525 19:8191578-8191600 CTGTAGGAGAGGGGGCAGGTAGG - Intronic
1162098763 19:8326979-8327001 GTGAGGAACAGGGACCAGGATGG - Intronic
1162105218 19:8366149-8366171 CTGGGGACGTGGGGCCAGGCAGG + Intronic
1162246462 19:9405717-9405739 CTGTGGAAGGGAGGAAAGGAAGG + Intergenic
1162933128 19:13966931-13966953 CTCTGGCAGAGAGGACAGGAGGG + Intronic
1162955076 19:14092882-14092904 AAGTGGGAGAGGGGGCAGGAGGG + Exonic
1163116068 19:15189220-15189242 CTGGGAAAGAGGGGAGAGGAGGG - Intronic
1163651864 19:18522388-18522410 CTATGGAGGCGGGGCCTGGAGGG - Intergenic
1163846913 19:19643270-19643292 CTGGGGGAGGGGGCCCAGGAAGG - Intronic
1164561161 19:29293194-29293216 CTGTGGAAGAGGCCACAGGAAGG + Intergenic
1164890599 19:31820176-31820198 AGCTGGAAGAGGGGCCAGAATGG - Intergenic
1164909313 19:31992796-31992818 CTGAGGGAGGGGAGCCAGGATGG - Intergenic
1165148480 19:33747654-33747676 CTGTCCAAGAGGGGCAAAGAGGG + Intronic
1165436180 19:35796815-35796837 CTGTGGCTGGGGGCCCAGGATGG - Intergenic
1165462450 19:35952101-35952123 CTGAGGAGGAGAGGCCAGCATGG + Intergenic
1165483882 19:36083594-36083616 CTCTGGGAGAGGGGCTATGAGGG + Intronic
1165858654 19:38895070-38895092 CTGTGGCAGGAGGGCGAGGAGGG - Intronic
1166300004 19:41907967-41907989 CTTTGGGAGTGGGGCCAGGCGGG + Intronic
1166651355 19:44577577-44577599 TTGAGGAAGAGGGGCCTGGAGGG - Intergenic
1167236405 19:48318591-48318613 AGGTGGAAGAGGGGCCAGTAAGG + Intronic
1167253844 19:48415610-48415632 CAGTGGAGGCGGGGCTAGGAGGG + Intronic
1167253871 19:48415681-48415703 CAGAGGAGGAGGGGCCAGGAGGG + Intronic
1167408945 19:49333750-49333772 TTGGGGAAGAGGGGACAAGATGG + Intergenic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167729688 19:51244665-51244687 CTGGGGAAGAGGAGTCAAGATGG - Intergenic
1168189874 19:54730111-54730133 CTGTGGGTGACAGGCCAGGATGG - Intronic
1168191873 19:54744411-54744433 GTGTGGGTGAGAGGCCAGGATGG - Intronic
1168196204 19:54775781-54775803 GTGTGGGTGAGAGGCCAGGATGG - Intronic
1168204565 19:54840023-54840045 GTGTGGGTGAGAGGCCAGGAAGG - Intronic
1168206810 19:54856236-54856258 GTGTGGGTGAGAGGCCAGGATGG - Intronic
1168271648 19:55253240-55253262 ATGTGGAAGAGGGGCCCAGAGGG + Intronic
925578122 2:5381441-5381463 CGCTGGAAGTGGGGCCTGGAGGG + Intergenic
925998150 2:9308539-9308561 CTGTGTAAAAGGGAACAGGAGGG + Intronic
926127421 2:10280128-10280150 CTGAGGAAGAGAGGAGAGGAAGG - Intergenic
926230751 2:11002118-11002140 CTGGGGAGGAGGAGCCAAGATGG - Intergenic
926727875 2:16012768-16012790 ATGTGGCACAGGGGCCAGGCAGG + Intergenic
926934596 2:18074267-18074289 CTGAGGATGAGGGGACAGGGAGG - Intronic
927159846 2:20246673-20246695 CAGTGGAAGAGGGTGCAGGAAGG + Intergenic
927213955 2:20655721-20655743 TTGCTGAAGATGGGCCAGGATGG + Intergenic
927319264 2:21723408-21723430 AAGTGGAAGAGGGGGCAGGGAGG + Intergenic
927966756 2:27275255-27275277 CTGGGGAAGAGGGGCTCGGTGGG + Intronic
928182746 2:29080930-29080952 CTCAGGAAGGGAGGCCAGGAGGG - Intergenic
928637309 2:33261055-33261077 GTGTGGTAGAGGGGACAGCAAGG + Intronic
928996967 2:37303195-37303217 ATGTGGGAGAGGGGACGGGACGG - Intronic
929107787 2:38380918-38380940 CTTTGGGGGAGGGGCCAGGGAGG + Intergenic
929288201 2:40159982-40160004 CTGTAGAAGATGAGCCTGGAGGG + Intronic
929325635 2:40607409-40607431 CTGTAGAAGAAGGGGCAGGTGGG - Intronic
929766093 2:44845049-44845071 GTGTTAGAGAGGGGCCAGGAGGG + Intergenic
931423645 2:62151220-62151242 ATGTGAGAGAGGAGCCAGGAAGG - Intergenic
932064495 2:68539451-68539473 ATGTGGAAAAGAGACCAGGAAGG - Intronic
932127600 2:69157963-69157985 CTGGAGAAGTGGGGCCAGGATGG - Intronic
932369834 2:71177754-71177776 CTGGGGAGGAGGAGTCAGGAAGG + Intergenic
932873677 2:75428982-75429004 CTGTGGAAGAGGAGGCTGGCTGG + Intergenic
932923930 2:75948209-75948231 CTGTGGAATAGTGTACAGGACGG + Intergenic
933867910 2:86540275-86540297 CAGGAGAAGAGGGGTCAGGAAGG - Intronic
935629528 2:105201556-105201578 ATGTCGAAGGTGGGCCAGGAGGG + Intergenic
935737486 2:106117926-106117948 CTGAGGAAGGGGGTCCAGGAGGG + Intronic
935814098 2:106830316-106830338 TTGAGGCAGAGGGGCCAGGCTGG + Intronic
936450580 2:112631067-112631089 CTTGGGCAGAGGTGCCAGGAGGG - Intergenic
936531641 2:113280100-113280122 CAGTGGGAGGGGGGCAAGGAAGG + Intergenic
936687124 2:114840892-114840914 CTGTGGAACAGAGGCAGGGATGG - Intronic
936996568 2:118420789-118420811 CTGTGGAAGAGGGAAGAGCATGG + Intergenic
937151431 2:119689050-119689072 CTGTGGAGGAGTGGGGAGGATGG - Intergenic
937379675 2:121365368-121365390 CTCTGGGAGAGGAGGCAGGAAGG - Intronic
937451359 2:122004498-122004520 TTGAGGAAGAGGGGCCAGAAGGG - Intergenic
937873964 2:126806297-126806319 CTGAGAAAGAGGAGCCAGGAGGG - Intergenic
937931382 2:127208078-127208100 GTATGGGAGAGGGGCCAAGATGG + Intronic
938119190 2:128622019-128622041 CTGGTGAAGACAGGCCAGGATGG - Intergenic
938379258 2:130827412-130827434 CAGTGGAGGAGGAGCCACGAAGG - Intergenic
938692865 2:133808271-133808293 CTGGGGACAAGGGACCAGGAAGG + Intergenic
943347983 2:186762666-186762688 CTGGAGAAGAGTCGCCAGGAAGG + Exonic
944562781 2:200957682-200957704 CTGTGGAAGAGTGGTCAGAGTGG - Intronic
947232455 2:227902044-227902066 CTGTTGAGGAGGGGTGAGGATGG + Intronic
947962523 2:234251611-234251633 CTGGGGATGAGGGGCCAAGCTGG - Intergenic
948538416 2:238666126-238666148 AGGTGGAAGAAGGGCTAGGAGGG - Intergenic
1169091735 20:2865100-2865122 ATGGGGATGAGGGACCAGGAGGG - Intronic
1169131128 20:3166923-3166945 CAGTGGCAGTGGGGCCAGCAGGG - Exonic
1169388958 20:5173926-5173948 AAGAGGAAGAGGGGACAGGAGGG + Intronic
1169392978 20:5205052-5205074 ATCAGGAAGTGGGGCCAGGAGGG + Intergenic
1170131235 20:13022528-13022550 CTGGAGAAGCTGGGCCAGGAGGG + Intronic
1170547969 20:17451012-17451034 CTGGGGAAGATGGGCCAGTGAGG - Intronic
1170639248 20:18137558-18137580 CTGTGGGAGAGGGGTCAGCACGG + Intergenic
1172012913 20:31856835-31856857 CAGTAGAGGAGGGGACAGGATGG + Intronic
1172224583 20:33296840-33296862 CTCTGGAACAGAGGCCAGCAAGG - Intronic
1172292268 20:33784509-33784531 AGGTGGATCAGGGGCCAGGAAGG - Intronic
1172357687 20:34291338-34291360 CTGAAGAAGAGTGCCCAGGAAGG - Intronic
1172504378 20:35450629-35450651 CTGCAGGAGAGGGGCCAGTAGGG - Intronic
1173812048 20:45962024-45962046 CTGGGCAAGAGAGGCCAGGTTGG - Intronic
1174037844 20:47679069-47679091 CTCAGGAAGTGGGGACAGGAAGG - Intronic
1174292565 20:49519486-49519508 GTGAGGAGGAGGGGCCAGGAAGG - Intronic
1174396668 20:50251030-50251052 ATGCAGAAAAGGGGCCAGGATGG - Intergenic
1174421501 20:50401978-50402000 GTGTGGAGGAGGGGACAGAATGG - Intergenic
1174735195 20:52959601-52959623 CTGGAGAAGAGGGGCTTGGACGG - Intergenic
1174772465 20:53313728-53313750 TTGTGGAACAGAGGCCAAGAGGG - Intronic
1175398002 20:58680727-58680749 CTATGGCAGACGGACCAGGAAGG - Intronic
1175547573 20:59788504-59788526 TCAGGGAAGAGGGGCCAGGATGG - Intronic
1175924777 20:62466321-62466343 CTGGGGAGGAGCGGGCAGGATGG - Intronic
1176095778 20:63343713-63343735 CTGGGAAGGAGGGGGCAGGATGG + Intronic
1176113547 20:63421498-63421520 CTGTGGCTGATGGGGCAGGAAGG - Intronic
1176252331 20:64131707-64131729 CTGTTGTAGGTGGGCCAGGAGGG + Intergenic
1176363869 21:6020800-6020822 CCGTGTATGAGGGGGCAGGAGGG + Intergenic
1178881747 21:36455451-36455473 CTGTGGAAGGAGGGTGAGGATGG + Intergenic
1179270849 21:39849888-39849910 AGATGGAAGAGGGGACAGGAGGG + Intergenic
1179652151 21:42818496-42818518 AGGTGGTGGAGGGGCCAGGATGG + Intergenic
1179716376 21:43290823-43290845 CTCTGGAAGAGGGGCCGAGGTGG - Intergenic
1179759649 21:43517745-43517767 CCGTGTATGAGGGGGCAGGAGGG - Intergenic
1180004284 21:45012906-45012928 CTGGGGAAGAGGTGTCTGGATGG + Intergenic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1181343556 22:22201101-22201123 CTGTGGGGCAGGGGCCAGCAGGG - Intergenic
1181386751 22:22551297-22551319 GTGTAGAGGAGGGGACAGGACGG + Intronic
1181608746 22:23998785-23998807 CTGTGGGAGAGGACCCAGGTGGG - Intergenic
1182070844 22:27462589-27462611 CTGCGCAGGAGGGGGCAGGAAGG + Intergenic
1182281150 22:29218398-29218420 CTGTGGAGAAGGGGCTAGAATGG + Intronic
1182293634 22:29300527-29300549 CTGTGGAACAGAGGCCGAGAAGG - Intergenic
1183018472 22:35008650-35008672 CATTGGCAGATGGGCCAGGAGGG + Intergenic
1183512142 22:38242595-38242617 GTGCCCAAGAGGGGCCAGGAGGG - Intronic
1183590295 22:38775899-38775921 CTGTGGGGGACGGGGCAGGAGGG + Intronic
1183732690 22:39627567-39627589 CTGCTGAAGAGGGGCGAGGAAGG + Intronic
1183872203 22:40748493-40748515 CTGTGTAAGAGGGGGCCTGAAGG - Intergenic
1184254817 22:43280846-43280868 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254847 22:43280967-43280989 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254876 22:43281085-43281107 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254905 22:43281203-43281225 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254935 22:43281324-43281346 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184254978 22:43281493-43281515 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184255007 22:43281596-43281618 CTGAGGAGGAGGTGACAGGAGGG - Intronic
1184414145 22:44342356-44342378 CTTTGGAAGAGGAGAAAGGAAGG + Intergenic
1184802415 22:46769630-46769652 CTGGGGAGGAGGGGCATGGAGGG + Intronic
1185295275 22:50049944-50049966 CTGGGGCAGGGAGGCCAGGAGGG + Intronic
1185313534 22:50169613-50169635 CTGTGGAACAGGGGACGGGATGG + Intergenic
949741603 3:7240694-7240716 ATGTGGAAGAGGGGGAGGGAAGG - Intronic
949797254 3:7864481-7864503 CGGTGAAAGAGGGGGCAAGAGGG - Intergenic
950025528 3:9817437-9817459 ATGTGAAAGGGGGGACAGGAGGG + Intronic
950109898 3:10412272-10412294 CCTTGGAAGAGGGGCCTGGAAGG + Intronic
950799141 3:15535216-15535238 CTGGGGAAGAGAGGGGAGGAGGG + Intergenic
951705654 3:25541820-25541842 CTGTGGAGGAAGGGGCCGGAGGG - Intronic
952488427 3:33840326-33840348 CTGAGGAAGAGGCGGAAGGAGGG + Intronic
952585097 3:34882909-34882931 AAGTAGATGAGGGGCCAGGAGGG + Intergenic
953041119 3:39255733-39255755 CTGTGGTAGAGGGAGCAGTAGGG + Intergenic
953058239 3:39405338-39405360 CTTTGGAAGAGTGGCCATAAGGG + Intergenic
953134357 3:40169984-40170006 AAGTGGAAGAAGAGCCAGGATGG + Exonic
953821693 3:46212469-46212491 GTGTGGTAGGGGGGCCAAGAGGG - Intronic
953837865 3:46362711-46362733 CTGTGGAGGATGGAGCAGGAGGG - Intergenic
953997801 3:47534091-47534113 CTGGGGAGGAGGAGCCAGGCTGG + Intergenic
954465010 3:50649184-50649206 CAGTGAGAGAGGGGCCAGGAAGG - Exonic
954574495 3:51668245-51668267 CAGGGGAAGAGGGTCCAGGTGGG + Exonic
955600587 3:60641351-60641373 ATGAGGCAGAGGGCCCAGGAGGG + Intronic
955727660 3:61950069-61950091 TTCTGGAGGAGGGGCCTGGAAGG - Intronic
956733240 3:72215990-72216012 CTGAGGAGGAGTGGCCAGGGAGG - Intergenic
958094672 3:88928675-88928697 TTGTGGAAGAGGAGCAAGGTAGG - Intergenic
958560376 3:95741999-95742021 TGTTGGAAGAGGGGCCAGGTGGG - Intergenic
959149326 3:102590056-102590078 ATGTGGAGGAGGGGCCTGGTAGG + Intergenic
960262250 3:115581039-115581061 CCGGGAAAGAGGGGGCAGGATGG + Intergenic
960361372 3:116716007-116716029 CTGTGGAAGAAAGGCCAGAAGGG + Intronic
961626872 3:128270102-128270124 CTCTGGAAGATGGGTCAGGGTGG + Intronic
961634852 3:128326859-128326881 CTCTAGATGAGAGGCCAGGATGG - Intronic
961658643 3:128456921-128456943 CTGGGGGAGAGGGGACAGGCAGG + Intergenic
962345937 3:134619088-134619110 CTGTGGAAGAGGGAGAGGGATGG + Intronic
963017332 3:140838385-140838407 CTGGGGATGAGGGGCTTGGAGGG + Intergenic
963049424 3:141128508-141128530 ATATGGCAGAGGAGCCAGGAGGG + Intronic
964557862 3:157960600-157960622 CTGAGGTAGAGGGTCCAAGATGG + Intergenic
966910363 3:184556203-184556225 CTCTGGGAGAGGGGTCAGGGAGG - Intronic
967186396 3:186948263-186948285 GTCTGAAAGAGGGACCAGGAAGG + Intronic
968433297 4:572112-572134 GTGTGCAAGTGGGGACAGGACGG + Intergenic
968438708 4:610481-610503 GAGTGGCAGAGGAGCCAGGAGGG + Intergenic
968569414 4:1331649-1331671 CTTTGGCAGAGGGGCCCTGAGGG + Intronic
968598877 4:1499783-1499805 CTGTGGAGCAGGGGCCTGGCTGG - Intergenic
968665069 4:1816504-1816526 AAGAGGAAGAGGGGCCAGGAAGG + Intronic
968962240 4:3751537-3751559 GTGAGGAAGAGGAGCGAGGATGG - Intergenic
969470540 4:7385065-7385087 CTGTGGAGCAGGGGCCAGGGTGG + Intronic
969477509 4:7429907-7429929 CTGTGGGAGGTGGGCCATGAGGG + Intronic
969526937 4:7708603-7708625 TTGGGGCAGAGGGTCCAGGAAGG - Intronic
969658337 4:8510658-8510680 CAGGGGAAGAGGGCCCGGGAGGG + Intergenic
971007305 4:22389728-22389750 CTTTGGAAAAGGGGTCAGGTAGG - Intronic
971968630 4:33593990-33594012 ATGTGGATTGGGGGCCAGGAAGG - Intergenic
973061738 4:45734879-45734901 CTGCTGAAGGCGGGCCAGGATGG + Intergenic
973321685 4:48816982-48817004 GGGTGGGAGAGGGGCCAAGATGG + Intronic
973584536 4:52377245-52377267 CTGAGGGCGCGGGGCCAGGATGG + Intergenic
974295141 4:59988474-59988496 CTGTGGGAGTGGGACAAGGAAGG + Intergenic
974334330 4:60520800-60520822 TGGTGGAAGAGAGGACAGGAAGG + Intergenic
974372983 4:61041836-61041858 CTGTGGAAGTGGGGGCTGGTAGG - Intergenic
977983819 4:103359101-103359123 CAGTGGAGGAGGGGCCTGGTGGG + Intergenic
978450951 4:108833054-108833076 TTGAGGAAGAGGTGACAGGAAGG - Intronic
979076879 4:116282389-116282411 CTTTGGAAGAGGAGGCAGTATGG - Intergenic
979083589 4:116375812-116375834 CAGTGGAAGAGTGGAAAGGAAGG + Intergenic
979517462 4:121626384-121626406 ATGTTGGAGAGGGGGCAGGAAGG + Intergenic
980103673 4:128566488-128566510 CTGTGGAAGAGGGGCCCCGATGG + Intergenic
981631804 4:146827346-146827368 CTGTGGGGGCGGGGCCAAGATGG - Intronic
981679659 4:147381916-147381938 CTGTGGGGTAGGGGCCATGATGG - Intergenic
982162055 4:152580107-152580129 CTGTGACAGAGGGGGCTGGATGG + Intergenic
982389676 4:154850834-154850856 CTGAGGTAGAGGGGAAAGGATGG + Intergenic
983831184 4:172329897-172329919 CTGTGGAAAAGTGGCCAGACTGG - Intronic
983920700 4:173341223-173341245 CTGTGGAAAATAGGCCAGTACGG - Intergenic
984163520 4:176282352-176282374 CTGAGGAGGCGGGGCCAAGATGG + Intergenic
984206338 4:176792393-176792415 CCGGGGGAGAGGGACCAGGAGGG - Exonic
984623769 4:181982057-181982079 CTGTGGTATAGAGACCAGGAGGG + Intergenic
985341082 4:188955410-188955432 CTCTGGAGGAGGGGCCTGGTGGG - Intergenic
985936614 5:3102384-3102406 CTAGGGAAGAGGAGACAGGAGGG + Intergenic
986637290 5:9835738-9835760 CTGTGGGAGAGGGGCCCAGCAGG - Intergenic
988167927 5:27617743-27617765 TTTAGGAAGAGGGGCCAAGAAGG - Intergenic
988169169 5:27632574-27632596 CTGGGGGAGAGAGGCCAGGGTGG + Intergenic
989138193 5:38176186-38176208 CTGTGGAAAACGGGCCATGAAGG - Intergenic
989323623 5:40165283-40165305 CTGTGCAGGAGTGGCCAGGTAGG - Intergenic
989382364 5:40822022-40822044 TGGTGGAAGTGGGGCCAGGTGGG - Intergenic
989499624 5:42150253-42150275 ATGTGGAGGAGGGGCCTGGTGGG + Intergenic
989658192 5:43768076-43768098 CTGGGGAAGAGGGTTCAGGTGGG + Intergenic
989782183 5:45281187-45281209 GTGTTGAAGAGGGGCCTGGTGGG + Intronic
992381860 5:76245335-76245357 CTGTGGAAGGGGTTCCAGGATGG + Intronic
992616121 5:78547855-78547877 CTGAGGGAGACTGGCCAGGAGGG + Intronic
992754796 5:79894182-79894204 CTGGGAAGGAGGGGCCAGTAGGG + Intergenic
994212132 5:97099140-97099162 GTGGAGGAGAGGGGCCAGGAGGG - Intronic
994499085 5:100551495-100551517 CTGTGAAAGAGTGGAAAGGAAGG - Intronic
995712849 5:115052420-115052442 CTGGGCAAGAGAGCCCAGGAAGG + Intergenic
995835464 5:116395899-116395921 ATGAGGAAGAAAGGCCAGGAAGG + Intronic
996077099 5:119208861-119208883 CTGGGGAAGAGGGCACAGGTGGG - Intronic
997356021 5:133263452-133263474 CTGAGGAAGAAGGGCCAAGGAGG + Intronic
998178627 5:139918903-139918925 CAGTGGTGGAGAGGCCAGGAGGG + Intronic
998227408 5:140337605-140337627 CAGTGGCAGAGGGGCCAGGCTGG + Intronic
999467608 5:151822461-151822483 CTGTGGGCGGGGGGTCAGGAGGG - Intergenic
1000018727 5:157300927-157300949 CCCTGGAGGAGGGGCCTGGATGG - Intronic
1000297464 5:159924546-159924568 CTGGGGCAGAGGGGCAGGGAGGG + Intronic
1001257467 5:170195102-170195124 CTGTGGAATTGGAGCCGGGAGGG - Intergenic
1001705733 5:173740024-173740046 CTGTAGGAGAGGGGTCAGGGAGG + Intergenic
1002089643 5:176796957-176796979 CTATGGAAGTGTGGCCAGGGAGG - Intergenic
1002784809 6:392749-392771 GTGCGGAAGGAGGGCCAGGAGGG + Intronic
1002854817 6:1027332-1027354 CTGGGGAACTGGGGGCAGGAAGG + Intergenic
1002945410 6:1756675-1756697 CTGGGGCAGTGGGGCCAAGATGG + Intronic
1003010646 6:2423785-2423807 TTGTGGAGGAGGAGCCAAGATGG - Intergenic
1003094300 6:3130501-3130523 CTGAGGAAGAGGGTCCTGGTGGG - Intronic
1003811495 6:9787933-9787955 CTGTGGGAGATGTGCAAGGAAGG - Intronic
1005508967 6:26495060-26495082 GTGTGGAAGAGGGGTTAGCAGGG - Intergenic
1005926807 6:30451643-30451665 CAGGGGAAGAGGGGACTGGATGG - Intergenic
1006019888 6:31111754-31111776 CTGTGGATGAGAGACCAGGGAGG + Exonic
1006191119 6:32210156-32210178 CTGTGGAAGAGGGGTTGGGAAGG + Intronic
1006580358 6:35073520-35073542 CTGAGGAAGAGGGGACAGGAGGG - Intronic
1006683594 6:35814529-35814551 CTGTGGCTGAGGGGGAAGGAGGG - Exonic
1007219786 6:40269376-40269398 GGTTGGAAGAGGGGGCAGGAAGG - Intergenic
1007351650 6:41277841-41277863 TTGAGGAAGTGGGACCAGGAAGG - Intronic
1007478337 6:42133990-42134012 CTGAGGGAGAAGGGGCAGGAGGG - Intronic
1007492246 6:42232607-42232629 CTATGGGAGCTGGGCCAGGATGG - Intronic
1007616397 6:43182179-43182201 CTGAGGAGGCGGGGCCAGGACGG + Exonic
1007695892 6:43734169-43734191 CTGGGGAAGGGGGGCAAGAAGGG - Intergenic
1007710398 6:43819423-43819445 CTGGGGAAGATGGGGCAGGGAGG + Intergenic
1007780109 6:44247748-44247770 CGGTGGAGGAGGGGCGGGGAGGG + Intronic
1011443456 6:87412007-87412029 CCGTGGAAGAGAATCCAGGAGGG + Intronic
1011696909 6:89921292-89921314 CTGTGGAAGTGAGCCCAGGCTGG - Intergenic
1013009219 6:106105059-106105081 TTCTGGCAGAGGGGCCCGGATGG - Exonic
1013977749 6:116096224-116096246 CTGTGGGATAGGGGCAAAGAAGG - Intergenic
1014275400 6:119382160-119382182 CTGTAGGAGATGGGCCAGGGTGG + Intergenic
1015055961 6:128903818-128903840 CTGTGGAGGATGGGGAAGGACGG + Intronic
1015208880 6:130672788-130672810 CAGTGGAAGAAGGCCAAGGATGG - Intergenic
1015628288 6:135204668-135204690 CTGTCAGAGAGAGGCCAGGAAGG - Intronic
1015863282 6:137702501-137702523 CCGTGAAAATGGGGCCAGGAAGG + Intergenic
1016006935 6:139098972-139098994 GAGCTGAAGAGGGGCCAGGAAGG - Intergenic
1016423944 6:143913980-143914002 CATTGGGAGAGGGGCCAAGATGG - Intronic
1016481145 6:144483548-144483570 CTCAGGAAGCGGGGGCAGGAAGG - Intronic
1016989388 6:149918837-149918859 GTGAGGAAGAGGAGTCAGGAGGG + Intronic
1016998638 6:149979255-149979277 GTGAGGAAGAGGAGTCAGGAGGG - Intergenic
1017011253 6:150065172-150065194 GTGAGGAAGAGGAGTCAGGAGGG + Intronic
1017027314 6:150192723-150192745 CTGTGTAAGAGAGCCCAAGAGGG - Intronic
1018839659 6:167508434-167508456 CAGGGGAAGAGGGGACAGGGAGG - Intergenic
1019037308 6:169072510-169072532 ATGTGGGAGAGTGGCCAGGCTGG - Intergenic
1022124471 7:27342134-27342156 GTGGGGAAGTGAGGCCAGGAGGG - Intergenic
1022505554 7:30907035-30907057 TTGTGAAGGAGGGGTCAGGAGGG + Intergenic
1022510913 7:30934315-30934337 CAGTGGAAGAGAGGCCAGCAGGG - Intergenic
1023177430 7:37448095-37448117 CAGAGGAATGGGGGCCAGGAGGG - Intronic
1023337278 7:39183562-39183584 ATGTGGAAGAGGGACCTGGTGGG - Intronic
1023875226 7:44283081-44283103 CTGTGGAGGTGGGTGCAGGAAGG - Intronic
1023940515 7:44766095-44766117 CGCTGGCAGAGGAGCCAGGAGGG - Intronic
1024279907 7:47710326-47710348 CTGTTGGTGAGGGGCCCGGACGG + Intronic
1025249316 7:57341485-57341507 GTGTGGAGGAGGGGACAGAATGG + Intergenic
1026227956 7:68459278-68459300 CTGTCGAGGAGGGGCCTGGTGGG - Intergenic
1026824463 7:73572830-73572852 CTGTGGCAGGTGGGCAAGGAGGG - Exonic
1026908937 7:74081549-74081571 ATGGGGAAGAGGGCCCAGAAGGG - Intergenic
1027024565 7:74841570-74841592 GTGTGGATGAGGGGGAAGGATGG - Intronic
1027063200 7:75102552-75102574 GTGTGGATGAGGGGGAAGGATGG + Intronic
1027627920 7:80566355-80566377 TTGGGGAAGAGTGGCCAAGAAGG - Intronic
1027667985 7:81062817-81062839 GTGTGCAAGAGGGGGTAGGAAGG - Intergenic
1028440172 7:90850597-90850619 CTGTGGAAGAGGGAACAGAAAGG + Intronic
1028642018 7:93053040-93053062 CTGTGGAACAGGTGTCAGCAAGG - Intergenic
1028920540 7:96305972-96305994 CTGTGGAATAGGGCCCAGGAGGG - Intronic
1029248242 7:99218015-99218037 CTGAGAAAGAGGGGCCAGAGGGG + Intergenic
1029275238 7:99400026-99400048 CTCTGGAAGAGGGGAATGGAGGG + Intronic
1030738305 7:113077617-113077639 CTGTGAAAGTGGGAGCAGGAAGG - Intergenic
1032092898 7:128920533-128920555 CAGGGGATGAGGGGGCAGGAGGG + Intergenic
1032390745 7:131554007-131554029 CTGGGGGAGAGGGGCAGGGATGG + Intronic
1032531215 7:132622162-132622184 CAGTGGAAGAGAGGACAGCATGG - Intronic
1032758406 7:134914482-134914504 CTGTGGAAGGGAGTCCCGGAAGG - Intronic
1033724808 7:144103618-144103640 GTGAGGATGAGGGACCAGGAGGG - Intergenic
1034032671 7:147785482-147785504 AGGTTGAAGAGGGACCAGGAAGG + Intronic
1034313887 7:150112246-150112268 TTGAGGGAGAGGGGCCAGGAAGG - Intergenic
1034488128 7:151379014-151379036 CGGTAGAGGAGGGGGCAGGACGG + Intronic
1034939393 7:155220570-155220592 GTGTGGAGGAGGGGCCAGGCTGG - Intergenic
1035000515 7:155609034-155609056 ATGGGGAAGAGCGGCCAAGACGG + Intergenic
1035421090 7:158729562-158729584 CTGTGGAAGAGGGGCAAGTGAGG + Intergenic
1035564703 8:633749-633771 CTTTGGCACAGGTGCCAGGATGG + Intronic
1035681592 8:1492673-1492695 CGGAGGCAGAGGGGCCGGGATGG + Intergenic
1035830396 8:2688779-2688801 CTCGGGCAGAAGGGCCAGGAGGG - Intergenic
1036626843 8:10479386-10479408 GTGTGGAAGGGGGGCCAGGCGGG + Intergenic
1036644352 8:10602441-10602463 CTGTGGACACGGGGGCAGGAGGG + Intergenic
1036648402 8:10626094-10626116 CTGTGGAGGAAGGGGCAGGGCGG + Intronic
1037364560 8:18107998-18108020 CTGGGGGAGAGGGGGCAGGGTGG + Intergenic
1037725621 8:21480461-21480483 CTGTGGAACATGGGCCAGACAGG + Intergenic
1038280966 8:26164330-26164352 CAGAGGAAGATGGGACAGGATGG + Intergenic
1038329157 8:26593980-26594002 CTGTGGGAGCGGGGCTGGGAAGG - Intronic
1039704404 8:39992098-39992120 CTGTGGAGGAGCGCGCAGGATGG - Intronic
1040532187 8:48275116-48275138 GTGTGGAATAGGGGAGAGGAGGG + Intergenic
1041776488 8:61528720-61528742 CTGTGGGTGAAGGGGCAGGAAGG - Intronic
1042606054 8:70547906-70547928 GTGTTGAGGAGGGGCCTGGAGGG + Intergenic
1045048691 8:98303123-98303145 CTGTGGAGGACTGGCCTGGATGG - Intergenic
1045993205 8:108334269-108334291 CTGTGAAAGAGGTGACAGCAAGG - Intronic
1047968622 8:130065944-130065966 CTGTGGAAAACGGCCCAAGAAGG - Intronic
1048013787 8:130480035-130480057 CTCAGGAAGAGGGGCCTGGTGGG - Intergenic
1048549990 8:135425266-135425288 CTGTTCTAGAGGGTCCAGGATGG - Intergenic
1049029314 8:140022703-140022725 CTGGGGAAGCTTGGCCAGGATGG - Intronic
1049228611 8:141470467-141470489 TTGTTGAAGTGGAGCCAGGAAGG - Intergenic
1049261684 8:141642299-141642321 CTGTAGAACAGAGGCCAGCAGGG - Intergenic
1049331370 8:142055903-142055925 CTGTGGAAGCAGGGCCATGTAGG - Intergenic
1049416746 8:142498868-142498890 CAGTGGAGGAGGGGACAGGTGGG + Intronic
1049641962 8:143719867-143719889 CAGTGGTAGAGGGGCCATGGGGG + Intronic
1049808422 8:144551879-144551901 CTCGGGAAGAGGGGCTATGAAGG - Intronic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051595922 9:18824344-18824366 GTGTGTAAGAGGGGCCAGGTTGG - Intronic
1052324782 9:27205936-27205958 CTGGAGAAGAAGGGCCAGCAAGG + Intronic
1053125381 9:35576632-35576654 CTGTGGAAGAGAGGAAGGGAAGG - Intergenic
1053135681 9:35649173-35649195 CTGGGGATGAGGGGCCAAGAGGG - Intergenic
1055135502 9:72824508-72824530 CAGTTGGAGAGGGGCCAGGAAGG + Intronic
1055752483 9:79522235-79522257 TGTTGGTAGAGGGGCCAGGAAGG - Intergenic
1055954781 9:81763459-81763481 GTGGGGAAGAGGGGGCAGGAAGG + Intergenic
1056106292 9:83349854-83349876 CTGGGGAGTGGGGGCCAGGAGGG + Intronic
1056659459 9:88534156-88534178 GACTGGAAGAGAGGCCAGGAGGG + Intergenic
1056985915 9:91363660-91363682 CAGTGGAAGGGGGTCAAGGAAGG + Intergenic
1057396917 9:94688845-94688867 CTGGGGAAGAGGGGCAAGGATGG + Intergenic
1057552381 9:96061427-96061449 TTGTGGTTGAGGGACCAGGAGGG - Intergenic
1057797612 9:98169873-98169895 CTGTTGGAGCTGGGCCAGGAAGG - Intronic
1057844055 9:98508274-98508296 CTGGGGAGGAGGAGCCAAGATGG + Intronic
1057854697 9:98593545-98593567 CTGAGGTAGAGAAGCCAGGAGGG + Intronic
1057867199 9:98691084-98691106 GTCTTGAAGAGGGCCCAGGAGGG - Intronic
1057912507 9:99031100-99031122 CTGTGGCAAAGGAGCCAGCAGGG - Intronic
1060131613 9:121105618-121105640 CTGAGAAAGAGAGGCCAGCAAGG + Intronic
1060514803 9:124258732-124258754 CGGTGAACCAGGGGCCAGGAGGG + Intronic
1060847187 9:126846926-126846948 GTGTGGAACAGGTGCCTGGAGGG + Intergenic
1061166493 9:128925734-128925756 GGGTGGAAGAGGAGGCAGGAGGG - Intronic
1061507195 9:131038097-131038119 CAGAGGAAGAGGGGGCGGGAAGG - Intronic
1061897682 9:133656942-133656964 CTGGGGAGGAGGTGGCAGGACGG + Intronic
1061917034 9:133760666-133760688 CTGAGGATGAGGGATCAGGAAGG + Intergenic
1061917084 9:133760884-133760906 CTGAGGACGAGGGATCAGGAAGG + Intergenic
1062083861 9:134638514-134638536 CTGCTGAAGTGGGCCCAGGAGGG - Intergenic
1062180427 9:135188479-135188501 CTGTGGCAGAGAGGAAAGGAGGG + Intergenic
1186610750 X:11135955-11135977 CTCTGGCAAAGGGGCCAGAATGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187125415 X:16449849-16449871 ATAAGGAAGAGGGACCAGGATGG - Intergenic
1187391188 X:18887469-18887491 CGGTGCAAGAGGGGTCAAGATGG - Intergenic
1187493888 X:19777720-19777742 CAGGGGAAGAGGGGCAATGAGGG + Intronic
1189369870 X:40419128-40419150 CGGTGTAAGAGGGGCTGGGAAGG + Intergenic
1190432270 X:50389723-50389745 CTGAGGCGTAGGGGCCAGGAAGG - Intronic
1190525367 X:51324296-51324318 CTGTGAAAGAGGGGAAAAGAGGG - Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191122713 X:56922627-56922649 TGTTGGAAGAGGGGCCAGGTAGG + Intergenic
1192181242 X:68917074-68917096 CTCTGGCAGCGGGGCGAGGAGGG + Intergenic
1192248441 X:69391698-69391720 ATGTGGAAGAGGGGAGAGCAGGG - Intergenic
1192705119 X:73521047-73521069 CAGTGGATGAGGGTTCAGGAAGG + Intergenic
1193048712 X:77079135-77079157 GTTTGGAACAGGGCCCAGGACGG - Intergenic
1193152625 X:78140402-78140424 CTGTGGGTGAGGGGCTGGGAAGG - Intergenic
1193603827 X:83541796-83541818 CTGTGGAAAGAGGGCCAAGAGGG + Intergenic
1195356958 X:104048225-104048247 CTGTGGAACAGGGGTCTAGAAGG + Intergenic
1196654754 X:118206095-118206117 CTTTGGAAAAGGGACCAAGAAGG + Intergenic
1196990848 X:121327023-121327045 CTGTGGATTAGGGGCCATGCTGG + Intergenic
1198060670 X:133042642-133042664 CCTTGGAGGAGGGGCCAAGATGG - Intronic
1198393113 X:136196231-136196253 ATGTGGAAGAAGGTCCTGGAGGG + Intronic
1198887534 X:141355705-141355727 CTTTGGAACCTGGGCCAGGAAGG - Intergenic
1200101217 X:153689807-153689829 GTGCGGAAGAGGGGCCAGGCCGG - Intronic
1200156702 X:153980416-153980438 CCCTGGAAGAAGCGCCAGGAGGG - Intronic
1200157683 X:153985923-153985945 CCCTGGAAGAAGCGCCAGGAGGG + Intergenic
1200344437 X:155434947-155434969 CTTTGTCAGAGGGGCCAAGATGG + Intergenic
1200958057 Y:8971274-8971296 GCGTGGAAGAGAGGCAAGGAAGG + Intergenic
1200970682 Y:9149346-9149368 GTTTAGAAGAGGGCCCAGGATGG + Intergenic
1201471531 Y:14340666-14340688 CAGTGGAAGGGGGCCCAGAAGGG + Intergenic