ID: 924669701

View in Genome Browser
Species Human (GRCh38)
Location 1:246111069-246111091
Sequence AAGATGTTATGCATGGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924669701_924669705 22 Left 924669701 1:246111069-246111091 CCCTGACCCATGCATAACATCTT 0: 1
1: 0
2: 1
3: 8
4: 131
Right 924669705 1:246111114-246111136 TATATGATAGAAACATGCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 88
924669701_924669706 23 Left 924669701 1:246111069-246111091 CCCTGACCCATGCATAACATCTT 0: 1
1: 0
2: 1
3: 8
4: 131
Right 924669706 1:246111115-246111137 ATATGATAGAAACATGCCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924669701 Original CRISPR AAGATGTTATGCATGGGTCA GGG (reversed) Intronic
903587692 1:24428768-24428790 AAAAGGTTATGTATGGGCCAAGG - Intronic
905498320 1:38414879-38414901 AAGTTGTTTCCCATGGGTCATGG + Intergenic
906239422 1:44233284-44233306 AAGATTGTTTGCATGGGTGAGGG - Intronic
907224529 1:52932597-52932619 AATATGTTCTGGATGGGTCCAGG + Intronic
908479398 1:64522628-64522650 AAGATGTTATCAATGGGGGAAGG + Intronic
910155940 1:84219499-84219521 AAGATTTTATGGGTGGGGCATGG - Intronic
910606239 1:89087808-89087830 TAGATGTTCTGCAGGGGTAATGG + Intergenic
911687820 1:100797436-100797458 AAGATGCTATGGATGGGTCCTGG + Intergenic
912255542 1:108054438-108054460 CACATGTAATGCATGTGTCAGGG - Intergenic
912444791 1:109727102-109727124 CACATGTTATGCAGGGATCACGG + Intronic
916821278 1:168401097-168401119 AAGATGGAAGGCAGGGGTCAGGG + Intergenic
917099314 1:171429766-171429788 AGGATGTTATGTATGGGTTAAGG - Intergenic
917508405 1:175649622-175649644 AAGAAGTGATGCCTGGGTGAAGG - Intronic
921634210 1:217473545-217473567 AATATTTTATGCATGTCTCAGGG - Intronic
922402957 1:225279343-225279365 TAGATCTTTTTCATGGGTCAAGG + Intronic
923215987 1:231848196-231848218 AACCTGTTATGCAAGGGACAGGG - Intronic
923380833 1:233416298-233416320 AAAATGTTATGCCAGAGTCAGGG + Intergenic
924669701 1:246111069-246111091 AAGATGTTATGCATGGGTCAGGG - Intronic
1064429386 10:15257826-15257848 AAGATGGTATGCATGGGGTTGGG + Intronic
1066581258 10:36884925-36884947 GAGATTTTATGCATGAGACATGG + Intergenic
1068312507 10:55296100-55296122 AATAAGTGATGCATGGGGCAAGG + Intronic
1069584208 10:69586620-69586642 AAGATGCTATCCATGGGTGAAGG + Intergenic
1072505051 10:96057511-96057533 ATGATGTTAGGAATGGGGCAAGG - Intronic
1075943626 10:126412795-126412817 AAGATGGTATACAAAGGTCATGG - Intergenic
1077676780 11:4201693-4201715 AAGATTTTAAGGATAGGTCATGG + Intergenic
1078650077 11:13182340-13182362 AAGACGTTATGAATGGCTGAAGG - Intergenic
1080546774 11:33327371-33327393 AATATGTTATACAAAGGTCATGG + Intronic
1085649530 11:78255141-78255163 ACCATGTGATGTATGGGTCAAGG + Intronic
1086917900 11:92552742-92552764 AAGATATTATGAAAGTGTCAGGG - Intronic
1090143962 11:124298383-124298405 GAGGTGTTAGGCATGGGTCTGGG + Intergenic
1092867389 12:12775511-12775533 GAGAAGTTATGCATGTGTGAGGG + Intronic
1093629623 12:21392926-21392948 AGGAAATTATGCAGGGGTCAAGG - Intronic
1097939110 12:65284444-65284466 GAGATGTTAAGCCTGGGTGATGG + Intronic
1098356380 12:69616561-69616583 AAGATGTGATCCAGGGGTCGGGG + Intergenic
1099256422 12:80319345-80319367 AACATGTCATGCATGGTTCCAGG - Intronic
1103177127 12:118873976-118873998 CAGATGTTATTCAAGGGTCAGGG + Intergenic
1105052550 12:133067463-133067485 AATGAGTAATGCATGGGTCAGGG - Intergenic
1108413596 13:50175167-50175189 AAGGTTTTATACATAGGTCAGGG - Intronic
1108506003 13:51112924-51112946 TTGATATTATGCATGAGTCAAGG - Intergenic
1109450129 13:62502639-62502661 AAGAAGTTATTGATGGTTCACGG - Intergenic
1109747435 13:66645274-66645296 GAGATTATATGCATGGGTGATGG - Intronic
1110314523 13:74090367-74090389 AAGAGGTTATGCATGTGTGGAGG - Intronic
1110672909 13:78203398-78203420 AAGCTGTTACGCAGGGGTAAAGG - Intergenic
1111850555 13:93567953-93567975 AAGTTGCTATTCTTGGGTCATGG - Intronic
1112834000 13:103491233-103491255 AAGATGTTTTCCAAGGGACAAGG - Intergenic
1113183445 13:107658742-107658764 AAGAAGTGATGAGTGGGTCAAGG - Intronic
1115476171 14:33814975-33814997 AAGATGTTGTGCCTGTTTCAAGG + Intergenic
1116656881 14:47665325-47665347 AAGAGGTTATGCATGAATCCAGG - Intronic
1121933743 14:97997320-97997342 AAGATGTTATGCACCAGACATGG + Intergenic
1128130096 15:65221362-65221384 ATGATGTGAAGTATGGGTCAAGG + Intergenic
1129872014 15:78946490-78946512 AAGATGGTATGTAAGGGTCTGGG + Intronic
1137370934 16:47905132-47905154 CTGGTGTTAAGCATGGGTCAAGG - Intergenic
1137933787 16:52613941-52613963 ATGACTTTCTGCATGGGTCAGGG - Intergenic
1139907194 16:70374476-70374498 AAGATGTTCAGTTTGGGTCAAGG - Intergenic
1141376486 16:83535608-83535630 AAGGTGTTATGCATGGTGCTGGG + Intronic
1141942628 16:87288092-87288114 AAGATATCATGCATGTGTAATGG - Intronic
1144022746 17:11251625-11251647 TAGATGTTAGACATGGGGCAGGG - Intronic
1145966473 17:28921894-28921916 CAGATCTTAAGCATGTGTCATGG + Intronic
1146394514 17:32452931-32452953 AAGATGTTAAGCTTGGATAAAGG + Intronic
1147990289 17:44328546-44328568 GAGAGGTTATCCATGGGTGATGG + Intergenic
1153107050 18:1540023-1540045 AAGATTTGATGCATATGTCATGG + Intergenic
1159711032 18:71760697-71760719 AAGATGTTATTCAAGGTTTATGG + Intronic
926770583 2:16370080-16370102 AAAATGTAATGCAAGGGGCAAGG - Intergenic
930942680 2:57031784-57031806 AAGATTTTATACATGAGTGAAGG + Intergenic
932115842 2:69046210-69046232 AAACTCTTATGCATGGGGCATGG - Intronic
935882969 2:107584872-107584894 AAGATTTTATGCATTGGGAATGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
938123943 2:128657297-128657319 AAGATGATATGCATGGATTTGGG + Intergenic
939904537 2:147895470-147895492 AAGGTGTTATTCAAGGTTCACGG - Intronic
940256980 2:151741551-151741573 CAGATGTAATGCCTGGGCCAGGG + Intergenic
941178265 2:162227249-162227271 AAGATATTTTGCATAGATCAAGG - Intronic
941963710 2:171279639-171279661 ATGATGTTATTCAAGGTTCATGG - Intergenic
942157798 2:173149421-173149443 AAGATGTTAACAATGGGTGAGGG + Intronic
943406065 2:187487655-187487677 AAAATGTTATCAATGGATCAGGG - Intronic
1170636060 20:18105712-18105734 CAGAGGTTATCCATGGGGCATGG + Intergenic
1177724161 21:24945501-24945523 AAGAGGTTGTGCATGTGTGAAGG + Intergenic
1180741790 22:18058485-18058507 AAGATGTTGAGCATGTGTCCTGG + Intergenic
1182102667 22:27669021-27669043 AAGATGCTTAGCATGGGTCCTGG - Intergenic
1185188186 22:49415792-49415814 AAGCAGTTCTGCATGGGCCATGG + Intronic
950642120 3:14355057-14355079 CAGATGTTCTGCAGAGGTCAGGG + Intergenic
950974774 3:17228959-17228981 AAAATATTATTCATGGGACATGG - Intronic
951184270 3:19693902-19693924 AAGAGGTTTTGCATGGCTAAAGG + Intergenic
953815954 3:46156671-46156693 GAGCCGTTATGCATGTGTCAGGG - Intergenic
956404500 3:68913506-68913528 AAGATGTGATGGAAGGGGCAGGG + Intronic
956440326 3:69274423-69274445 AAGATGTTAAGCAGGGGAGATGG + Intronic
956614878 3:71160719-71160741 AAAATGCTGTGCATTGGTCATGG - Intronic
957237936 3:77619439-77619461 AAGAAGAAATGCATGGGACAAGG + Intronic
959903612 3:111686537-111686559 AAGATGTTATCTTTGGTTCAAGG + Intronic
962003293 3:131322976-131322998 AAGATGTGATGCAGGGGAGAGGG - Intronic
963076530 3:141352585-141352607 ATGATGGTATACATGGGTGAAGG + Intronic
964496843 3:157300353-157300375 CAGATGTTCTGCATCAGTCAAGG - Intronic
965984375 3:174734146-174734168 AAGATTCTATTCATGGGTAAGGG - Intronic
971156359 4:24087503-24087525 AAGATATTATGGAGGGGCCAAGG - Intergenic
971277691 4:25213841-25213863 AAGATGTTCTGCAGAGTTCATGG + Intronic
972889521 4:43539373-43539395 TAGATGTTCAGCATGGGTCATGG - Intergenic
973886171 4:55324318-55324340 AAGATGTTATTGATAGATCATGG - Intergenic
983841520 4:172462407-172462429 AGGATGTTATGCATGAGGCCTGG + Intronic
983985267 4:174052233-174052255 AAGGAGTTATGAGTGGGTCATGG - Intergenic
985392753 4:189507565-189507587 ATGATGTTAAGCATTGTTCATGG + Intergenic
988789423 5:34593641-34593663 AAGATGGTATACATGTGTGAAGG + Intergenic
989201020 5:38763798-38763820 AAGATGTTGTGTATTAGTCAGGG - Intergenic
989386471 5:40859344-40859366 AAAATGTTATTCATGAGTAATGG - Intronic
990204080 5:53410124-53410146 ATGATGTGATGTAAGGGTCAAGG + Intergenic
990690774 5:58361332-58361354 AAGGAGTGATGCATGGGTCTAGG - Intergenic
991688309 5:69201998-69202020 GAGAGGCTATGCATGTGTCAGGG + Intronic
992288885 5:75264133-75264155 AAAATGTTAGGCATGTGTCCTGG - Intergenic
999827143 5:155284604-155284626 AACAAGTTATGGAAGGGTCAAGG - Intergenic
1001009623 5:168086057-168086079 AAGATGTTATTACTGGGTCCAGG - Intronic
1004364463 6:15000130-15000152 AAAATGTTATGCATGGGGCTGGG - Intergenic
1005423996 6:25682234-25682256 CAAATGTTATGGATGGGTCATGG + Intronic
1006294919 6:33166018-33166040 AAGAGGTCAAGCATGGATCAAGG + Intronic
1010946664 6:81982224-81982246 TATATGTTATGCCTGGTTCATGG + Intergenic
1018199800 6:161384205-161384227 AATATGTTAGGCATGGTTCTAGG - Intronic
1021342572 7:19482599-19482621 AAGAGATTATGCATCTGTCAAGG - Intergenic
1025864650 7:65369835-65369857 ATTATGTTATTCATAGGTCATGG - Intergenic
1030954592 7:115836461-115836483 AAGATTTTATGCAAAGGTTAGGG - Intergenic
1032656095 7:133931710-133931732 AAGATGTTAATCACAGGTCAAGG - Intronic
1032656606 7:133937187-133937209 AAAATGTTTTGCAGGGGGCAGGG - Intronic
1036220960 8:6921412-6921434 TTGATGTTATGCCTGGGCCATGG - Intergenic
1036333753 8:7851981-7852003 AAGGTGTTATGCCTGGGATAGGG + Intronic
1038278035 8:26138382-26138404 AAGATGATATGCAATGGGCATGG + Intergenic
1040590977 8:48791644-48791666 AAGCTGTTATGCATGAGTAGGGG + Intergenic
1044468821 8:92541050-92541072 CACATGTTCTGCATGGTTCAGGG - Intergenic
1044538459 8:93383788-93383810 AAGATGATATACATGGGTCATGG + Intergenic
1047870640 8:129078042-129078064 AAGAACTTCTGCCTGGGTCATGG + Intergenic
1049028831 8:140017399-140017421 CAGATGTGATGTATGGGTGAAGG + Intronic
1050112687 9:2232983-2233005 AGGAGGTTATGCATAGGTGAAGG + Intergenic
1050463910 9:5900716-5900738 AAGATGTTTTCCAGGGCTCAGGG - Intronic
1058189743 9:101898800-101898822 GAGAAGCTATGCATGTGTCAGGG + Intergenic
1186802253 X:13105267-13105289 AAGATGTTTAGCAAAGGTCATGG + Intergenic
1187315887 X:18194805-18194827 CAGGTGTTAGGGATGGGTCATGG + Intronic
1187477460 X:19624880-19624902 AAGAAGTTAAGCATAGGTCTGGG - Intronic
1188698825 X:33233631-33233653 CACATGTTAGGCATGGGACAGGG + Intronic
1188712882 X:33423275-33423297 ATGATGTTATGCAGGGTTTATGG + Intergenic
1195681871 X:107553279-107553301 AGGCTGTTATGGAAGGGTCAGGG + Intronic
1196321394 X:114344608-114344630 ATGATGTTATGCATGGAAAAAGG - Intergenic
1196771070 X:119293878-119293900 AAGATGTGATATATAGGTCAAGG + Intergenic
1197826531 X:130596223-130596245 AAAATGGCATGCATGGGTCATGG - Intergenic
1197994584 X:132359559-132359581 AAAATATAATGCATGGGACATGG - Intergenic
1198327766 X:135591211-135591233 AAAATGTTTTGAATGGGACAAGG + Intergenic
1198824217 X:140682355-140682377 AAAATGTTGTGCATAGGTGAAGG + Intergenic