ID: 924669770

View in Genome Browser
Species Human (GRCh38)
Location 1:246111777-246111799
Sequence CCTCACATGGTGAAGTAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924669770_924669774 -10 Left 924669770 1:246111777-246111799 CCAGACTACTTCACCATGTGAGG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 924669774 1:246111790-246111812 CCATGTGAGGTAAACGGTAGAGG 0: 1
1: 0
2: 0
3: 4
4: 49
924669770_924669775 0 Left 924669770 1:246111777-246111799 CCAGACTACTTCACCATGTGAGG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 924669775 1:246111800-246111822 TAAACGGTAGAGGCAGCAATAGG 0: 1
1: 0
2: 0
3: 5
4: 74
924669770_924669776 16 Left 924669770 1:246111777-246111799 CCAGACTACTTCACCATGTGAGG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 924669776 1:246111816-246111838 CAATAGGTCTGCTCAGTCTATGG 0: 1
1: 0
2: 0
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924669770 Original CRISPR CCTCACATGGTGAAGTAGTC TGG (reversed) Intronic
905339105 1:37266184-37266206 CCTGCCATGGTGAGGTATTCAGG + Intergenic
907258559 1:53198263-53198285 CCACACATGGGGAAGAAGCCTGG - Intronic
911050488 1:93666847-93666869 TCTCACATGTTGATGGAGTCTGG - Intronic
911303408 1:96204073-96204095 CGTCACATTCTGAAGTAGTTAGG + Intergenic
912747094 1:112253969-112253991 CCTCAGCTGGTGATGGAGTCAGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1063955221 10:11259212-11259234 CCTCACATGGTGCTGAAGTCAGG - Intronic
1068094475 10:52473116-52473138 CCTCACATGGTTGAGCAGTGGGG + Intergenic
1070583572 10:77743474-77743496 CCTCACATGGTAAAGGGGTGAGG - Intergenic
1074036522 10:109744880-109744902 CCTCACATGGAGAAGAACTTGGG - Intergenic
1074803340 10:117024721-117024743 CTACACATGCTGAAGTAGTTAGG + Intronic
1078961444 11:16277308-16277330 CCTCACATGGTGGAGTGGGTGGG - Intronic
1081341894 11:41938116-41938138 CCTCACATGGTCATGGAGTCTGG + Intergenic
1081852740 11:46285101-46285123 CCTCTCCTGGTGCAGTAGCCAGG - Intronic
1084635457 11:70389444-70389466 CCTCACAAGTAGAAGTCGTCAGG - Intergenic
1087488557 11:98791598-98791620 CCTTACATTGCAAAGTAGTCTGG + Intergenic
1090351449 11:126110994-126111016 CCTCACATGGTAAGGGAGGCAGG + Intergenic
1091588446 12:1829019-1829041 TCTCACATGGTGAATAATTCAGG - Intronic
1092972888 12:13715175-13715197 CCTGACAGGGTGAATTATTCTGG + Intronic
1093259181 12:16913901-16913923 CCTTGCATGGTGTATTAGTCAGG + Intergenic
1099758825 12:86892665-86892687 CCTCACCTGGTGAAGAAGAGTGG - Intergenic
1101533727 12:105598296-105598318 ACTCACATAATGAAGAAGTCCGG + Intergenic
1103281806 12:119764260-119764282 CTTCACATAGTGGAGTTGTCAGG + Intronic
1103824195 12:123723045-123723067 CCTCACCCTGTGAAGTAGGCTGG + Intronic
1112150148 13:96750395-96750417 CCTCACTGGGTGAAGGAGACAGG + Intronic
1112976326 13:105323038-105323060 CTTTACATGGTGAAGAAGTAAGG + Intergenic
1115790403 14:36871258-36871280 CCTCACATGGTGAAAGAGCAAGG - Intronic
1129757006 15:78104801-78104823 CTTCACATTGTGAAGGAGGCCGG + Exonic
1130921146 15:88345686-88345708 CCTCACATGGTAAAGGAGGAAGG + Intergenic
1132271954 15:100534045-100534067 GCTCACATGGTGACATGGTCTGG - Intronic
1138526577 16:57611517-57611539 GCTCACATTCTGAAGTACTCAGG - Intronic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1146087249 17:29841037-29841059 AATCACATGGTCAAGAAGTCAGG + Intronic
1150966917 17:69981300-69981322 CCTCACCCGGAGAAGTAGTTGGG + Intergenic
1152153277 17:78616252-78616274 TCTCACTTGGCGAAGTCGTCTGG - Intergenic
1155432909 18:25780276-25780298 CGTCACATGGTCAAGCAGTAAGG + Intergenic
1158014736 18:52770946-52770968 CCTCACATGCTGAGGAAGACGGG + Intronic
1167452973 19:49583270-49583292 CCTCACTGGGTGAAGTATCCAGG - Exonic
925456598 2:4021678-4021700 CCTCACATGGTGGAAGAGTGGGG + Intergenic
930851743 2:55968471-55968493 CCTCACATGGTGGAGGGGTGGGG - Intergenic
933833787 2:86230316-86230338 CCTCCCCTGGTGAATTATTCAGG - Intronic
935040009 2:99417111-99417133 AGTCACATGGTGAAGTACTGGGG - Intronic
935697229 2:105780770-105780792 CCTCACATGCTGAAGGGGTGAGG - Intronic
938619000 2:133030239-133030261 CATCTCATGATGAAGTATTCTGG + Intronic
939204342 2:139080827-139080849 CCTTACAGGGTGCATTAGTCAGG + Intergenic
939633792 2:144556978-144557000 CCTCACTTGCTAAAGTAGTGTGG - Intergenic
1176080188 20:63268666-63268688 CCTCACATGGGAAAGGCGTCGGG + Intronic
1176226192 20:64001069-64001091 CCTCACAGAGTGAAGATGTCTGG + Exonic
1182847598 22:33444497-33444519 CCTTGCATGGCGAAGTGGTCAGG + Intronic
950859472 3:16135036-16135058 CCTCTCATGTTGCTGTAGTCAGG + Intergenic
953704314 3:45219821-45219843 CCACACATGGTGAAGGGGTTCGG + Intergenic
965184592 3:165446700-165446722 GCACACCTGGTTAAGTAGTCAGG - Intergenic
966982219 3:185148260-185148282 CCTCACATGGTGATGTCGGTAGG - Intronic
968853533 4:3101417-3101439 CCTCAGATGCTGTAGTTGTCAGG + Intronic
971734459 4:30428297-30428319 ACTCACATGATGAAGGAGGCTGG - Intergenic
972304094 4:37815077-37815099 CCTCAAATGGTGGAGGAGTGAGG - Intergenic
975546795 4:75568529-75568551 AGTCACATGGTGAAGTATTGAGG + Intergenic
982560632 4:156924954-156924976 CCTCACACAGTGAAAGAGTCAGG + Intronic
984808645 4:183774208-183774230 CCTCACAAGAGGCAGTAGTCAGG + Intergenic
985419292 4:189767519-189767541 CCACAAATGGTGATGTGGTCAGG + Intergenic
992888552 5:81183159-81183181 TCTCACATGGTGAACTACCCAGG + Intronic
994941314 5:106327398-106327420 ACTCACATAGTGAAGTTTTCTGG - Intergenic
1000367086 5:160501748-160501770 CATCAAAAGGTGAAGTAGACAGG + Intergenic
1000679721 5:164168453-164168475 GATGACATGGTGAATTAGTCAGG + Intergenic
1001111577 5:168901037-168901059 CATCACAGGGTGATGAAGTCAGG - Intronic
1005051698 6:21689985-21690007 CCTCACATGTTGAAATAATGAGG + Intergenic
1007928186 6:45667214-45667236 ACTCACATGGTGTATGAGTCCGG + Intergenic
1017631801 6:156403259-156403281 CATCACATGGTGATATAGTTTGG + Intergenic
1018723996 6:166596792-166596814 CCTCACAGAGTGTATTAGTCAGG - Intronic
1019703792 7:2487979-2488001 CCTCACCTGGAGAAACAGTCTGG + Intergenic
1019823309 7:3262557-3262579 CCACACATGGGGAAGCAGACAGG - Intergenic
1024360875 7:48466854-48466876 CCTCACATTGTGCCCTAGTCAGG - Intronic
1024390588 7:48807204-48807226 CCTCACATGGTGAAGGGGCAAGG - Intergenic
1026086112 7:67264605-67264627 CTTCACATAGTGAAGTACCCAGG + Intergenic
1026691044 7:72550204-72550226 CTTCACATAGTGAAGTACCCAGG - Intergenic
1032177998 7:129648690-129648712 CCTTACATGGTGAGGGAGTCAGG - Intronic
1033004396 7:137545894-137545916 ACTCACATGGTGAAGGAGCCGGG + Intronic
1034949835 7:155289838-155289860 CCTCACATGGTGAAGGGGCCAGG + Intergenic
1042820227 8:72922565-72922587 CCTCACATGGTGGAAAAGGCAGG + Intronic
1045116380 8:98986906-98986928 TTTCACTTGGTGAAGGAGTCAGG + Intergenic
1048622977 8:136154989-136155011 CCTCACCTCATGAAGTAGTTTGG - Intergenic
1185938702 X:4288777-4288799 CCTCACTTGGTGATGTGGTTTGG + Intergenic
1186570908 X:10713851-10713873 CCTCTCTTGATGAAGTACTCCGG + Intronic
1192269002 X:69561004-69561026 CATCACATGATGAAGTAGAATGG + Intergenic
1192429733 X:71103727-71103749 CCTCCCAAGGGGAGGTAGTCTGG + Intergenic
1193423148 X:81308435-81308457 GCTCCCATGGTGAAGTGGACAGG + Intergenic
1198251945 X:134887857-134887879 CCTCACATGGTTAAACAGTGAGG + Exonic
1198363173 X:135915660-135915682 CCTCACATGTTGAAGAAGCATGG - Intergenic
1202039090 Y:20664221-20664243 GCTTACATAGTGATGTAGTCTGG - Intergenic