ID: 924669774

View in Genome Browser
Species Human (GRCh38)
Location 1:246111790-246111812
Sequence CCATGTGAGGTAAACGGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924669770_924669774 -10 Left 924669770 1:246111777-246111799 CCAGACTACTTCACCATGTGAGG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 924669774 1:246111790-246111812 CCATGTGAGGTAAACGGTAGAGG 0: 1
1: 0
2: 0
3: 4
4: 49
924669769_924669774 -9 Left 924669769 1:246111776-246111798 CCCAGACTACTTCACCATGTGAG 0: 1
1: 0
2: 0
3: 8
4: 87
Right 924669774 1:246111790-246111812 CCATGTGAGGTAAACGGTAGAGG 0: 1
1: 0
2: 0
3: 4
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924669774 Original CRISPR CCATGTGAGGTAAACGGTAG AGG Intronic
918849121 1:189661596-189661618 CAATGTTAGGTAAAGGGTACAGG + Intergenic
919690590 1:200525110-200525132 CCATGTGATGTGATCGCTAGGGG - Intergenic
924391147 1:243559919-243559941 CCATCTGAGGTAAAAGGAAGAGG + Intronic
924669774 1:246111790-246111812 CCATGTGAGGTAAACGGTAGAGG + Intronic
1068036423 10:51765643-51765665 CCAGGTGAGGTTAATGGTATGGG - Intronic
1070215782 10:74379037-74379059 CAATGAGAGGTAAAGGGAAGTGG + Intronic
1075681346 10:124335092-124335114 CCATGTGAGGTTACAGGGAGAGG - Intergenic
1077201816 11:1311393-1311415 CCATGAAAGGAAAACGGTGGGGG - Intergenic
1079494382 11:21025146-21025168 CCATGTCAGGTACAGGGAAGCGG - Intronic
1085214499 11:74816777-74816799 CCATGTGTGGGAACTGGTAGGGG + Intronic
1100768886 12:97899393-97899415 CGATGTGAAGTAAATGGAAGGGG - Intergenic
1106642379 13:31597934-31597956 TCATTTGAGGTAAACTGTTGTGG + Intergenic
1111647819 13:91053642-91053664 CCATGTGAGGTAGACAGGATAGG - Intergenic
1115193310 14:30769963-30769985 CCCTGTGAGGTGAACGGTCAGGG - Intergenic
1117500733 14:56348580-56348602 CCATGTAAGGTAAATTATAGGGG + Intergenic
1120381253 14:83782375-83782397 ACTTGTGAGGTAAAGGGGAGGGG + Intergenic
1121859006 14:97298955-97298977 CCATGACAGGGAAGCGGTAGCGG - Intergenic
1125633284 15:41166167-41166189 CCATGTGGGAAAAACAGTAGAGG + Intergenic
1126238522 15:46414240-46414262 GCATGTGATGTATATGGTAGAGG + Intergenic
1129187744 15:73920694-73920716 CTATGTGAGCTAAAAGGAAGGGG - Intergenic
1141687506 16:85578721-85578743 CCATGTGTGGTGAGGGGTAGTGG - Intergenic
1149166146 17:53755184-53755206 CAGTGTAAGGCAAACGGTAGAGG + Intergenic
1157219769 18:45820098-45820120 CCATGTGATGGATAGGGTAGAGG + Intergenic
1158681840 18:59575026-59575048 CCATGTGAGGATAAAGGCAGAGG + Intronic
1162963339 19:14142029-14142051 ACATGTGAGGAAAAAGGAAGAGG - Intergenic
1168587056 19:57602198-57602220 CCATGTGAGGAAAAAGCAAGAGG - Intronic
925872730 2:8285068-8285090 CCTTGTGAGCTAAACAGTAAAGG + Intergenic
926111427 2:10186814-10186836 CCATGTGAGGGGAGGGGTAGTGG - Intronic
927156038 2:20222398-20222420 CCATGTTAGGTTAAAGGTGGGGG - Intronic
929631391 2:43466347-43466369 CCAAGTGAAGAAAACTGTAGGGG - Intronic
948695328 2:239730252-239730274 CCATGTGATGTCCAGGGTAGAGG - Intergenic
948726057 2:239934832-239934854 CCATGTGTGGAAAACGGGTGGGG - Intronic
1170044630 20:12072245-12072267 CCATGTGAGGTCAGAGGCAGAGG + Intergenic
1170534713 20:17328616-17328638 CTATGTATGGTAAACGGAAGAGG + Intronic
1177054864 21:16289182-16289204 CTATTTGAGATAAATGGTAGTGG - Intergenic
1179408349 21:41143397-41143419 CCAGGTGAGGTCACCTGTAGAGG - Intergenic
1185162403 22:49237870-49237892 CCAGGTCAGGAAAACGGTGGGGG - Intergenic
951376301 3:21922606-21922628 TCATGTGTGGTAAAAGGAAGGGG - Intronic
971901097 4:32658696-32658718 CCACGTGAAATATACGGTAGAGG - Intergenic
978197777 4:105990900-105990922 CCCTGTGAGGGAAAAGGGAGAGG - Intronic
978259350 4:106735515-106735537 CCATGTGAGCAAAAAGGAAGTGG - Intergenic
982504095 4:156196586-156196608 CCATGGGAGAAATACGGTAGGGG + Intergenic
1000418747 5:161012861-161012883 CTATGTGAGGTATACGGTATGGG - Intergenic
1001123185 5:168996749-168996771 CCATGTGAGGTGATAGGAAGTGG + Intronic
1004669667 6:17783964-17783986 CCATGAGAGGTAAAGGGAAGGGG + Intronic
1005024412 6:21448834-21448856 CCAAGAGAGGTAAGAGGTAGGGG - Intergenic
1005072571 6:21875077-21875099 CCATGTGAGCCAAACTGCAGTGG - Intergenic
1024851383 7:53721241-53721263 CCATGGGAGGTGGAGGGTAGTGG + Intergenic
1040441641 8:47449416-47449438 CCATGTGTGGTAATTGGTAGAGG + Intronic
1041734018 8:61091026-61091048 CCATGTGAGGTAACGGGCACAGG - Intronic
1044690965 8:94878075-94878097 CCAGGTGAGGTAAAGGATAAAGG - Intronic
1060607939 9:124934344-124934366 CCAGGAGGGGTAAAGGGTAGGGG + Intronic
1198038801 X:132828254-132828276 CCATGTGCGGTAGCAGGTAGGGG - Intronic
1201401385 Y:13607809-13607831 CCATGTGAGGAACACTGCAGTGG + Intergenic