ID: 924669775

View in Genome Browser
Species Human (GRCh38)
Location 1:246111800-246111822
Sequence TAAACGGTAGAGGCAGCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924669769_924669775 1 Left 924669769 1:246111776-246111798 CCCAGACTACTTCACCATGTGAG 0: 1
1: 0
2: 0
3: 8
4: 87
Right 924669775 1:246111800-246111822 TAAACGGTAGAGGCAGCAATAGG 0: 1
1: 0
2: 0
3: 5
4: 74
924669770_924669775 0 Left 924669770 1:246111777-246111799 CCAGACTACTTCACCATGTGAGG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 924669775 1:246111800-246111822 TAAACGGTAGAGGCAGCAATAGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924669775 Original CRISPR TAAACGGTAGAGGCAGCAAT AGG Intronic
904107427 1:28097639-28097661 TGAAAGGTAGTAGCAGCAATAGG + Intergenic
906238976 1:44229812-44229834 GAAAAGGAAGAGGCAGCATTAGG - Intronic
908921376 1:69197853-69197875 AAAATTTTAGAGGCAGCAATAGG + Intergenic
912367937 1:109150252-109150274 TAAACCGCAGAGACAGCAACTGG - Intronic
917251295 1:173064150-173064172 TCAAGGGAAGAGGCAGGAATTGG - Intergenic
924669775 1:246111800-246111822 TAAACGGTAGAGGCAGCAATAGG + Intronic
1063912723 10:10848745-10848767 TCATGGTTAGAGGCAGCAATCGG - Intergenic
1065271921 10:24041975-24041997 CAAACGGCAGATGCTGCAATAGG - Intronic
1065338082 10:24675596-24675618 TAAACAAAAGAAGCAGCAATAGG + Intronic
1065571837 10:27079356-27079378 GGAGAGGTAGAGGCAGCAATTGG - Intronic
1065648254 10:27859954-27859976 TAAAGGATAGAGGCAACCATAGG - Intronic
1072701382 10:97643963-97643985 TAAGTGGTAGAGGCAGGATTGGG + Intronic
1076057483 10:127387332-127387354 AAAATGGTACAGGCAGCAAAAGG - Intronic
1078171722 11:8933312-8933334 TACACACTAGAGGCAGGAATGGG + Intergenic
1080206312 11:29733845-29733867 TAATCCAGAGAGGCAGCAATGGG + Intergenic
1080952686 11:37054205-37054227 TAAACAGTAGAGGCAGGATTTGG - Intergenic
1088197070 11:107286512-107286534 TAAACTGTAGAGTCAGCTTTTGG - Intergenic
1097520005 12:60655535-60655557 CAAACTTTACAGGCAGCAATAGG - Intergenic
1107125562 13:36841911-36841933 TAAAGGAGAGAGGCAGAAATAGG - Intergenic
1107623484 13:42258716-42258738 TTAACGCTAGAGGCAACAGTAGG - Intergenic
1116328696 14:43568213-43568235 AAAAGGGTACAGGCAGTAATGGG - Intergenic
1116444638 14:44994490-44994512 TGAAAGGTAGAGGCTGCAGTGGG - Intronic
1132416434 15:101622752-101622774 TAAAAGGTAAAGGGAGCATTAGG + Intronic
1135024648 16:18989688-18989710 TAAACGGTAAAGGGACAAATAGG + Intronic
1139054948 16:63171710-63171732 GAAACAATAGAGGCAGTAATAGG + Intergenic
1140903839 16:79393754-79393776 TAAAGGGCTGAGTCAGCAATTGG + Intergenic
1147267426 17:39243327-39243349 TTTAAGGTACAGGCAGCAATGGG + Intergenic
1147491788 17:40875803-40875825 TAAAAGGCAGTGGAAGCAATGGG + Intergenic
1161001705 19:1914109-1914131 TGAGTGGTAGAGGCAGCATTTGG + Intronic
1166202753 19:41249079-41249101 TGAAGGGTAGAGGGAGCAAGTGG + Intronic
926294078 2:11554914-11554936 TAAACAGTCAAGACAGCAATGGG - Intronic
927620160 2:24647320-24647342 TAAGCGGCAGAGGAAGAAATCGG - Intronic
930367894 2:50464993-50465015 TAAAAGTAAAAGGCAGCAATGGG + Intronic
931553855 2:63477851-63477873 AAAAGGGTAGAAGCAGCAGTGGG + Intronic
947087398 2:226468858-226468880 AGAACGTTAGAGGCAGCAAATGG + Intergenic
1170582431 20:17709563-17709585 TAAACAGGAGATGCAGCAGTTGG - Intronic
1173025510 20:39304071-39304093 TAAGAGGAAGAGCCAGCAATTGG + Intergenic
1177305523 21:19310326-19310348 TACACAGTAGAGGAAGCACTTGG - Intergenic
1179107590 21:38416907-38416929 AAAACGGCAGAGGCTGCAAAGGG + Intronic
1185411250 22:50684102-50684124 TAGAAGGTGGAGGCAGCAGTGGG + Intergenic
950185183 3:10940321-10940343 GAACCGGTAGCAGCAGCAATGGG - Exonic
950523669 3:13510843-13510865 TGGAGGGTAGAGGCAGCAGTGGG - Intergenic
952049399 3:29364860-29364882 AAAACTGTGGAGGAAGCAATTGG - Intronic
952486798 3:33820208-33820230 CAAGAGGTAGAGGCTGCAATGGG + Intronic
953382107 3:42479894-42479916 TAAAAAGTAGAGGTAGCAGTGGG + Intergenic
954962540 3:54579007-54579029 TACACGGTAGAGGCAGGACTTGG + Intronic
957029241 3:75221135-75221157 TCAACCCTAGAGGCAGCCATGGG - Intergenic
957140680 3:76351566-76351588 TATACTGTAGAGGCAGGAAATGG - Intronic
961207279 3:125094696-125094718 TATAAGGGAGAGACAGCAATAGG - Intronic
967804319 3:193701670-193701692 GAAATGGCAGAGGCAGCAAATGG - Intergenic
968311317 3:197685832-197685854 AAAACAGTAGAGGCAACAGTAGG + Intronic
968341260 3:197957873-197957895 TAAAGTGTAGAGGAAGAAATAGG + Intronic
969138508 4:5050329-5050351 TAAATGGTAGAGCCAGCTCTGGG + Intergenic
971945438 4:33269579-33269601 TAAAAGCTACAGGCAGCTATTGG + Intergenic
974753791 4:66176963-66176985 TAAAAGAGAGACGCAGCAATTGG + Intergenic
977691962 4:99922234-99922256 AAAAAGGTAGAAGAAGCAATTGG - Intronic
978061980 4:104350365-104350387 TAGAAGGTAGAGGCTGCAGTGGG + Intergenic
979845823 4:125510419-125510441 TAAACAGTTAAAGCAGCAATAGG - Intergenic
990335842 5:54772046-54772068 TAAACGGTGGATGTAGCAAATGG + Intergenic
992258633 5:74947877-74947899 TAAGTGGTAGAAACAGCAATGGG - Intergenic
996695109 5:126385775-126385797 TAGAAGGCAGAGGGAGCAATGGG + Intronic
998838300 5:146225934-146225956 TGAAAGGTAGAGGTTGCAATGGG - Intronic
999089582 5:148924271-148924293 TGAACAGTAGAGCCAGTAATAGG - Intronic
1002941013 6:1716250-1716272 TAAAAGGCAGAGCCAGGAATAGG - Intronic
1005142976 6:22655227-22655249 TAAACAGTAGAGCCAACAAGAGG - Intergenic
1008609779 6:53174994-53175016 TAAATGCTAGAGGGAGAAATAGG - Intergenic
1008950947 6:57158618-57158640 TGAAAGGTAGAGGAAGCAATGGG - Intronic
1014971959 6:127827753-127827775 TATACAGTAGAGACATCAATGGG - Intronic
1017215514 6:151901613-151901635 TAAAGGGTAGAGAAAGCAAGGGG - Intronic
1020778084 7:12481631-12481653 AAAATGGTAGAGGAAGCAGTTGG - Intergenic
1031453643 7:121953015-121953037 AAGAGGTTAGAGGCAGCAATAGG + Intronic
1037404925 8:18532177-18532199 TACATGATAGAGGGAGCAATAGG + Exonic
1042679506 8:71366802-71366824 TAAACAGTAGATGGAGCAATGGG + Intergenic
1057267336 9:93627545-93627567 TAAACAGAAGTGGCAACAATAGG + Intronic
1057878164 9:98773322-98773344 TAGATGGTAGATGCAGCAAATGG - Intronic
1059341410 9:113599577-113599599 AAAATGGTAGAGGCAGTACTGGG + Intergenic
1187287772 X:17922609-17922631 TAAATGGAACAGGCAGCGATTGG + Intergenic
1187680860 X:21766800-21766822 TGAAGGGTTGAGGCAGCAAGTGG + Intergenic
1188587509 X:31795927-31795949 TAAAGTATAAAGGCAGCAATTGG + Intronic
1197585840 X:128347027-128347049 TAAAGAGTGGAGGCAGCAATAGG + Intergenic