ID: 924669776

View in Genome Browser
Species Human (GRCh38)
Location 1:246111816-246111838
Sequence CAATAGGTCTGCTCAGTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924669769_924669776 17 Left 924669769 1:246111776-246111798 CCCAGACTACTTCACCATGTGAG 0: 1
1: 0
2: 0
3: 8
4: 87
Right 924669776 1:246111816-246111838 CAATAGGTCTGCTCAGTCTATGG 0: 1
1: 0
2: 0
3: 9
4: 113
924669770_924669776 16 Left 924669770 1:246111777-246111799 CCAGACTACTTCACCATGTGAGG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 924669776 1:246111816-246111838 CAATAGGTCTGCTCAGTCTATGG 0: 1
1: 0
2: 0
3: 9
4: 113
924669773_924669776 3 Left 924669773 1:246111790-246111812 CCATGTGAGGTAAACGGTAGAGG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 924669776 1:246111816-246111838 CAATAGGTCTGCTCAGTCTATGG 0: 1
1: 0
2: 0
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924669776 Original CRISPR CAATAGGTCTGCTCAGTCTA TGG Intronic
916268723 1:162918179-162918201 CAATGGGTCTGCTCAGCCTCGGG + Intergenic
919749962 1:201031414-201031436 CAAAGGGTCTCCTCTGTCTACGG - Intergenic
920248629 1:204607158-204607180 CAATAGGTTGGGTCAGGCTAAGG + Intergenic
923181345 1:231522809-231522831 CAAAAGGCCTGCTCAGTTTCAGG + Intergenic
923492150 1:234493511-234493533 CCTCAGGTCTGCTCTGTCTACGG + Intergenic
924669776 1:246111816-246111838 CAATAGGTCTGCTCAGTCTATGG + Intronic
924684021 1:246268768-246268790 CCCTAGGGCTGCTCTGTCTATGG + Intronic
1063785332 10:9377363-9377385 CAACAGCTCTGCCAAGTCTAGGG + Intergenic
1064699847 10:18007581-18007603 CAATGGGGTTGCTCTGTCTATGG - Intronic
1066735390 10:38472742-38472764 CAATATGTCTGCTGATGCTATGG + Intergenic
1072580818 10:96738816-96738838 CAATAGATTTGCTCAGTGCATGG - Intergenic
1078064024 11:8066215-8066237 CAACAGGTCTGCTCAGACGCTGG + Intronic
1079239482 11:18712453-18712475 CCAAAGGTCTGCCCAGACTAGGG + Intronic
1088212769 11:107474870-107474892 CCTTGGGTCTGCTCTGTCTATGG - Intergenic
1088670085 11:112132202-112132224 GAATAGCCCTGCTCTGTCTATGG - Intronic
1091210881 11:133858813-133858835 TAAGAAGTCTGCTCAATCTAAGG + Intergenic
1091383704 12:78602-78624 CTGTAGGTCTCCTCAGCCTACGG + Intronic
1094100497 12:26757168-26757190 CCACAGGGCTGCTCTGTCTATGG + Intronic
1096905687 12:54933277-54933299 CATTAGGGCTGCTCTGTCTATGG - Intergenic
1107393728 13:39994465-39994487 CAATACGACTGTCCAGTCTAAGG + Intergenic
1109254715 13:60065208-60065230 CAATAGGTTTGCTCAATGCAGGG + Intronic
1110930444 13:81209090-81209112 CTATAGGTCAGCTCAGAATATGG + Intergenic
1111337952 13:86846849-86846871 CAGTGGGTATGCTCAGTCTGTGG - Intergenic
1115237353 14:31220473-31220495 CAATGGATCTACTCAGTATATGG - Intergenic
1115459009 14:33638050-33638072 AAATAAGTCTGCTCAGTTTCTGG - Intronic
1116530233 14:45962903-45962925 CCAGAGGAGTGCTCAGTCTATGG + Intergenic
1120884040 14:89437728-89437750 CATCAGGGCTGCTCTGTCTATGG + Intronic
1122595672 14:102888711-102888733 CAAAACTTCTGCTCAGTCTTGGG + Intronic
1123899254 15:24859717-24859739 CCACAGGGCTGCTCTGTCTATGG - Intronic
1126511761 15:49484170-49484192 CATTAGGCCTGCTCAATCTGAGG + Intronic
1130391772 15:83462588-83462610 CAATAGTTCTGCCAAGCCTAAGG - Intronic
1133882430 16:9795446-9795468 CCTTGGGTCTGCTCTGTCTATGG + Intronic
1137413675 16:48251519-48251541 CTTTAGCTCTCCTCAGTCTATGG + Intronic
1138165152 16:54794383-54794405 CCTTGGGTCTGCTCTGTCTATGG - Intergenic
1139372285 16:66476532-66476554 CACGAGGTCTCCTCAGTCCAGGG - Intronic
1140499346 16:75419870-75419892 CCTTGGGTCTGCTCTGTCTATGG + Intronic
1140936393 16:79674465-79674487 CAATATGTCTTCCCAGCCTATGG - Intergenic
1151789701 17:76297085-76297107 CCATAGGTGTGTTCAGTCTAGGG - Intronic
1152107414 17:78338776-78338798 GAATATGTCTGCTCAATCTTGGG - Intergenic
1154102582 18:11489728-11489750 CACAGGGTCTGCTCAGTCTTGGG + Intergenic
1154487697 18:14889019-14889041 CATTAGGCCTGCTCAATCTGAGG - Intergenic
1159437527 18:68438335-68438357 CAATACCTCTGCTCTGCCTATGG - Intergenic
1159602941 18:70445976-70445998 CTTTAGGGCTGCTCTGTCTATGG + Intergenic
925158175 2:1662811-1662833 CTAGAGGTCTGCACAGTCTCAGG + Intronic
932857315 2:75249638-75249660 CAATGTGTCTGGTCAGTCAAGGG - Intergenic
936501151 2:113067363-113067385 CATGATGTCTGCTCAGTCTCAGG + Intergenic
937736121 2:125292653-125292675 TAATAGGTATGCTCACTCTATGG + Intergenic
938955106 2:136290027-136290049 CCATAGGGCTGCTCAGAATATGG + Intergenic
940875385 2:158892791-158892813 CAATATGTCAGCTCAGCCTCTGG + Intergenic
943080938 2:183258305-183258327 AAATTGGTCTGCTCACTTTATGG - Intergenic
945036620 2:205709022-205709044 CAATGGGTCAGCACAGTGTATGG - Intronic
946624989 2:221601787-221601809 CATTAGCTCTTCTCAGTCAATGG - Intergenic
947498367 2:230655249-230655271 CAGCAGGGCTGCTCTGTCTATGG + Intergenic
1169286331 20:4310465-4310487 CCTTAGGGCTGCTCTGTCTATGG - Intergenic
1173288212 20:41691878-41691900 GGATAGCTCTGCTCTGTCTACGG + Intergenic
1176281448 20:64316118-64316140 CTGTAGGTCTCCTCAGCCTACGG - Intergenic
1176793581 21:13350313-13350335 CATTAGGCCTGCTCAATCTGAGG + Intergenic
1177860263 21:26444505-26444527 CAATGTGTATGCTCACTCTATGG + Intergenic
950252144 3:11474837-11474859 GAATAAGCATGCTCAGTCTAAGG + Intronic
951757393 3:26106201-26106223 GATTAGTTCTGCTCAGTTTATGG - Intergenic
955190834 3:56759993-56760015 CAATAGGTCTGTCCAGACTATGG - Intronic
964705597 3:159615551-159615573 CAATGGGACTTCTCAGTCCAAGG - Intronic
974794216 4:66728092-66728114 AAATAGATCTAATCAGTCTAAGG - Intergenic
976644060 4:87368937-87368959 CCTTAGGGCTGCTCTGTCTATGG + Intronic
977500910 4:97835411-97835433 CCCTAGGGCTGCTCTGTCTATGG + Intronic
978864119 4:113486767-113486789 CAATAGTTGTGTTCAGTCCAGGG - Intronic
979261746 4:118655703-118655725 CAATATGTCTGCTGATGCTATGG + Intergenic
983150083 4:164267622-164267644 CAATATGTCTGCTGATGCTATGG - Intronic
986073910 5:4314746-4314768 GACTAGGTCTGCTCAGGTTAAGG + Intergenic
987261200 5:16205274-16205296 CATTAGGTCTGCTCAGTGGATGG + Intergenic
988050734 5:26027682-26027704 AAATGGCTCTGCTCAGCCTAGGG + Intergenic
988182763 5:27818113-27818135 CCTCAGGGCTGCTCAGTCTACGG + Intergenic
990290505 5:54345876-54345898 CACTAGGGCTGCTCAGGGTAAGG + Intergenic
991363454 5:65844343-65844365 CCTTAGGGCTGCTCTGTCTATGG - Intronic
991432619 5:66563862-66563884 CCTTAGGACTGCTCTGTCTATGG + Intergenic
993980554 5:94539290-94539312 CCATGGGGCTGCTCTGTCTATGG + Intronic
993981041 5:94543982-94544004 CCACGGGTCTGCTCTGTCTATGG + Intronic
993990041 5:94645046-94645068 GAATAGGTCTGCTTGGACTATGG + Intronic
997756533 5:136404932-136404954 GAATAGTTCTGGCCAGTCTATGG + Intergenic
1004596023 6:17100566-17100588 GAAGGGGTCTGTTCAGTCTATGG + Intergenic
1008331873 6:50255110-50255132 ACACAGATCTGCTCAGTCTAGGG + Intergenic
1010104112 6:72147960-72147982 CAATAGGGCTCCACAGTGTAGGG - Intronic
1010437789 6:75855155-75855177 GAATAAATCTGCTCAGTCTTTGG + Exonic
1013811330 6:114048238-114048260 CACTAGGCCTGTTCAGTCTTAGG + Intergenic
1018658986 6:166067707-166067729 TGATAGCCCTGCTCAGTCTATGG + Intergenic
1018658992 6:166067751-166067773 TGATAGCCCTGCTCAGTCTATGG + Intergenic
1022711930 7:32859349-32859371 CCAGAGCACTGCTCAGTCTAGGG + Intergenic
1023024563 7:36038915-36038937 CCTTAGGGCTGCTCTGTCTATGG + Intergenic
1023855771 7:44182824-44182846 CAGTAGGTCTGAGCAGTCAAGGG + Intronic
1026306672 7:69148417-69148439 CCTCAGGTCTGCTCTGTCTATGG - Intergenic
1027190512 7:75993531-75993553 GACTGGGTCTGCTCAGTCTCTGG + Intronic
1027709895 7:81586930-81586952 CAACAGGTCTGTTCTGTCAAGGG - Intergenic
1029572571 7:101379937-101379959 CCTTAGGGCTGCTCTGTCTATGG + Intronic
1030222201 7:107108946-107108968 GGATAGCTCTGCTCTGTCTATGG - Intronic
1030601299 7:111596301-111596323 CCATGGGGCTGCTCTGTCTATGG - Intergenic
1035982716 8:4391331-4391353 CCATAGCTCAGCTCAGTCAAGGG - Intronic
1036014214 8:4763543-4763565 CAATAGATCTGCTCTTTCTATGG - Intronic
1037380036 8:18275199-18275221 CCTTAGGACTGCTCTGTCTATGG + Intergenic
1037599159 8:20379339-20379361 TAATAGGACTGCTCGGTCTAAGG - Intergenic
1038424578 8:27456254-27456276 CAATAGGCTTGCTCATTGTAGGG - Intronic
1041437097 8:57854092-57854114 CAATCGGTTTGTTCAATCTATGG + Intergenic
1044523113 8:93222665-93222687 CCCTAGGGCTGCTCTGTCTATGG + Intergenic
1051011593 9:12421559-12421581 CTAAATTTCTGCTCAGTCTAGGG - Intergenic
1052900258 9:33787659-33787681 AACTGGGTCTGCTTAGTCTATGG - Intronic
1053621053 9:39817855-39817877 CATTAGGCCTGCTCAATCTGAGG - Intergenic
1053884050 9:42626478-42626500 CATTAGGCCTGCTCAATCTGAGG + Intergenic
1053888618 9:42667816-42667838 CATTAGGCCTGCTCAATCTGAGG - Intergenic
1054223070 9:62433924-62433946 CATTAGGCCTGCTCAATCTGAGG + Intergenic
1054227640 9:62475263-62475285 CATTAGGCCTGCTCAATCTGAGG - Intergenic
1054263109 9:62889582-62889604 CATTAGGCCTGCTCAATCTGAGG + Intergenic
1055197708 9:73616717-73616739 CAATAGGTCTAGTCAATATAAGG + Intergenic
1055389288 9:75801507-75801529 CAATAGGGCAGAGCAGTCTAAGG + Intergenic
1058007775 9:99937940-99937962 CTATAGCGCTGCTCAGTCTGTGG + Intronic
1062155968 9:135048691-135048713 CAATGAGGCTGCTTAGTCTATGG + Intergenic
1187367282 X:18675572-18675594 CGTTAGGTCTCCTTAGTCTAGGG + Intergenic
1188079981 X:25827064-25827086 CTAGAGGAGTGCTCAGTCTAGGG - Intergenic
1189399449 X:40652956-40652978 CCAAAGGTCTGCCCAGTCCAAGG + Intronic
1189994112 X:46622833-46622855 CAAAAGGTCTTCTCAGGCTACGG + Intronic
1192561373 X:72130195-72130217 CCATAGGTCTCCTCAGTCCCTGG + Exonic
1195669766 X:107459701-107459723 CAGTAGTTCTGCTCAGGCTGTGG + Intergenic
1196321303 X:114343346-114343368 CAATAGGTTTGCTGGGTCAAAGG + Intergenic
1202383833 Y:24304166-24304188 CAATATGTCTGCTGATGCTATGG + Intergenic
1202486950 Y:25365954-25365976 CAATATGTCTGCTGATGCTATGG - Intergenic