ID: 924681155

View in Genome Browser
Species Human (GRCh38)
Location 1:246235571-246235593
Sequence GTGAGCCACCTCCAGCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924681155 Original CRISPR GTGAGCCACCTCCAGCTCAC AGG Intronic
900186069 1:1333820-1333842 TTGTCCCACCTCCCGCTCACGGG + Exonic
900306959 1:2015172-2015194 GTGACTCACCTCCACCTCCCAGG + Intergenic
900639449 1:3681772-3681794 CGGAGCCACCTCCAGGTCCCGGG + Intronic
901399327 1:9005192-9005214 GTGAGTGGGCTCCAGCTCACAGG + Intronic
901708280 1:11093670-11093692 CTGAACCCCCTCCAGCTCACAGG - Intronic
902509233 1:16956790-16956812 GTCAGCGAACTACAGCTCACAGG - Intronic
903643173 1:24874281-24874303 GTGAGCCAGCTCCAACGCACTGG - Intergenic
903910755 1:26723245-26723267 GTGAGCCACGTGCAGCTGGCAGG + Intronic
904034178 1:27550216-27550238 GTGAGCACCGTCCAGCGCACTGG + Exonic
904314506 1:29651571-29651593 TTGAGCCTCCTCCAGATCCCAGG + Intergenic
904502284 1:30920718-30920740 GTGAGCCACCACTCCCTCACTGG + Intergenic
905902150 1:41588740-41588762 GGGTGGCCCCTCCAGCTCACAGG - Intronic
906797719 1:48711104-48711126 GTGATCCACCTCCAGGTCCCAGG + Intronic
906872197 1:49495274-49495296 GTGAGCCACATGCGGCCCACGGG - Intronic
907513543 1:54979655-54979677 GTTAGTCACCCCCAGCTCACTGG + Intergenic
909216422 1:72896367-72896389 GTGAGCTGCTGCCAGCTCACAGG - Intergenic
915117538 1:153610150-153610172 CTGAGCCACCTCCAACCCAAGGG - Intronic
921605730 1:217152233-217152255 GTTAGCCATTTCCAACTCACTGG + Intergenic
923126927 1:231040761-231040783 CTGTGCCACCCTCAGCTCACTGG + Intergenic
923126955 1:231040859-231040881 CTGTGCCACCCCCAGTTCACTGG + Intergenic
924370976 1:243349273-243349295 GTTAGCCAACTACAGCTCATAGG + Intronic
924681155 1:246235571-246235593 GTGAGCCACCTCCAGCTCACAGG + Intronic
1064560256 10:16588737-16588759 GTCAGCCAGCTACAGCTCAGAGG - Intergenic
1065740503 10:28792680-28792702 GGGATCCACCTGCAGCCCACAGG + Intergenic
1067525010 10:47033258-47033280 GTGACCCACCTCCATGTCAAGGG - Intergenic
1069039978 10:63685283-63685305 TTGACCAACCTCCAGCTCTCAGG - Intergenic
1070586332 10:77769633-77769655 GTTTGCAACCTCAAGCTCACAGG + Intergenic
1073878967 10:107958037-107958059 ATGAGCCACGTCCAGTTCTCTGG - Intergenic
1074034909 10:109728782-109728804 GGAAGCCACCTGCAGCTCATCGG + Intergenic
1076059186 10:127400337-127400359 CTGAGCCCCCACCCGCTCACTGG - Intronic
1076250074 10:128978429-128978451 GTGCGCCCCGGCCAGCTCACCGG + Intergenic
1076364132 10:129911174-129911196 GTGAGGGACCTCCAGCCCACGGG + Intronic
1077630788 11:3809742-3809764 CAGAGCCACTTCCAGCTCCCTGG + Intronic
1082832861 11:57632358-57632380 GTCAGCCAACTACAGCCCACAGG - Intergenic
1083988963 11:66235001-66235023 GTGAGGCTCCTCCAGGCCACCGG + Intronic
1085018856 11:73192498-73192520 GTGAGTCACCTCCACCTCCCAGG - Intergenic
1086649358 11:89268766-89268788 GTGACCCACCTCCACCTCTCTGG + Intronic
1088217711 11:107531859-107531881 GTGGGCCACATTCAGCTCTCAGG - Intronic
1090311810 11:125747723-125747745 ATGTGCCACCTCCAGTTCCCAGG + Exonic
1093926496 12:24913569-24913591 GTGAGTCATCCCCAGCTCATGGG - Intronic
1096971257 12:55668267-55668289 GAGAGCCACTTGCAGCTCAGTGG + Intergenic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1100871470 12:98914613-98914635 TTGACCTGCCTCCAGCTCACTGG + Intronic
1102132582 12:110543832-110543854 GGAAGCCACCTCCACCTCGCTGG + Intronic
1102904536 12:116664094-116664116 GTAAGCCCCCTTCTGCTCACAGG + Intergenic
1103850981 12:123933563-123933585 CTGAACCACCTCCAACTCAAAGG + Intronic
1104875978 12:132035131-132035153 GAGAGGCCGCTCCAGCTCACTGG + Intronic
1105581694 13:21704058-21704080 GTGAGTCATCCCCAGCTCATGGG + Exonic
1106587578 13:31070605-31070627 CTGAGCCCCCTCCAGCTCTCTGG + Intergenic
1111057860 13:82973486-82973508 GTTTGCCACTTCCTGCTCACTGG + Intergenic
1112444312 13:99450225-99450247 GTGGCCCAACTTCAGCTCACAGG - Intergenic
1114211883 14:20622902-20622924 CTCACCAACCTCCAGCTCACCGG - Intergenic
1119018726 14:71086737-71086759 CTGAGCCAGCTGGAGCTCACAGG - Intronic
1121078794 14:91090856-91090878 GTGAGCATCCTACAGCTCAGAGG + Intronic
1122093424 14:99354476-99354498 GTGAGCCACTTCCCTCTCTCAGG - Intergenic
1122304896 14:100757816-100757838 GTGAGGATCCTCCAGCCCACCGG + Intergenic
1122460068 14:101887427-101887449 AGGAGCCACCGCCAGCTCAGTGG + Intronic
1124018858 15:25902089-25902111 GGGATCCTCTTCCAGCTCACTGG - Intergenic
1125937546 15:43649424-43649446 GCGAGGCACCTCCAGCTCCCGGG - Intronic
1125950446 15:43746844-43746866 GCGAGGCGCCTCCAGCTCCCGGG - Intronic
1128335579 15:66783840-66783862 GGGAGGCACCTCAGGCTCACAGG + Intergenic
1128493701 15:68177334-68177356 GTGATCCTGCTCCTGCTCACAGG + Intronic
1129604429 15:77017919-77017941 GTGAGCCCCACCCAGCTGACAGG - Intronic
1129955582 15:79633914-79633936 GTGAGCCAGATGCAGCCCACAGG + Intergenic
1131756867 15:95574110-95574132 GTGACCCACCTCCAAGTCATAGG + Intergenic
1133058182 16:3157963-3157985 GTGCGGCACCTGCAGCTCCCGGG + Intergenic
1136640983 16:31564879-31564901 GTGAGCCATGTCCAGCTTAAGGG - Intergenic
1138117357 16:54371084-54371106 GTGGGCAGCCTCCAGGTCACAGG - Intergenic
1138700120 16:58853918-58853940 GTGACACACCTTCAGCTCAGGGG + Intergenic
1139098419 16:63734210-63734232 GTGAACCACCTACAACCCACGGG - Intergenic
1139276423 16:65731986-65732008 GTGAGTCACCCACAACTCACTGG + Intergenic
1139431511 16:66913358-66913380 GTGGGCCAGCTCCAGCTCTTCGG + Intronic
1140190848 16:72814869-72814891 ATTAGCCACCTGCAGCTCACTGG + Intronic
1141314905 16:82952709-82952731 GTGGGCCAACTGCAGCCCACTGG + Intronic
1142433721 16:90044201-90044223 CTGAGCCAACTCCAGCTCTCTGG - Exonic
1142433771 16:90044470-90044492 CTCAGCCCCCTCCAGCCCACTGG + Exonic
1143362555 17:6383719-6383741 CTGAGGCTCCTCCATCTCACAGG - Intergenic
1143483651 17:7240823-7240845 GAGACCCCCCTCCAGCTCAGGGG + Exonic
1146976919 17:37121320-37121342 GTGATGCCCCTCCAGCCCACAGG + Intronic
1148323469 17:46770941-46770963 GCGAGTCACCTCCGGCTCCCGGG - Intronic
1150156387 17:62857296-62857318 GTGAGCAACCTCCACCTCCTGGG + Intergenic
1151337215 17:73447065-73447087 CTCAGACACCTCCAGCTCCCTGG - Intronic
1152563286 17:81089287-81089309 GTGAGCCACCTCCAGTGCCTCGG + Intronic
1154285535 18:13052966-13052988 GGGAGACAACTCCTGCTCACAGG - Exonic
1156785353 18:40906241-40906263 GTGTGCCACAACTAGCTCACAGG - Intergenic
1158361952 18:56684495-56684517 ATGAGTCAACTCCAGCCCACTGG - Intronic
1158797408 18:60863726-60863748 ATGAGCCACCTCCATCTGAGAGG + Intergenic
1160042492 18:75358612-75358634 GTGAGCCACCCCCATCTCCAAGG + Intergenic
1160048716 18:75411617-75411639 GTTAGCCAGCTCCAGCACGCTGG + Intronic
1160431692 18:78817241-78817263 CTGAGCCTCCTCCAGGTGACAGG + Intergenic
1161072694 19:2270512-2270534 GTGCGCCACCCCCAGCTCCCCGG - Intronic
1161975546 19:7606220-7606242 GTGCGCCTCCTGCAGCTCTCAGG + Intronic
1163325950 19:16603360-16603382 GAGACCCACCTCCAGCTGGCTGG - Intronic
1163499752 19:17669314-17669336 GTGAAGCACTTGCAGCTCACTGG + Intronic
1163841625 19:19614557-19614579 GTGAGCAACCTCCGCCTCCCGGG - Intronic
1165328464 19:35127461-35127483 ATGAGCCACCTCCACCTCCTGGG + Intronic
1165826852 19:38710459-38710481 GGAAGCCACCCCCAGCTCCCTGG + Intronic
1166368771 19:42290403-42290425 GGCAGCCACCTCCTTCTCACTGG + Exonic
1166686582 19:44800253-44800275 GGAAGCCACCTCCAGCCCCCAGG + Intronic
1166788931 19:45386064-45386086 CTGCACCACCTCCAGCTCCCCGG + Exonic
1167309518 19:48728988-48729010 GTGGCCCAGCTCCAGCTCACGGG + Exonic
1167798107 19:51723994-51724016 ATGACCCCCCTCCAGCTCTCTGG - Intronic
1168153899 19:54462882-54462904 CTGGGCCGCCTCCAGCTCTCCGG + Exonic
925048509 2:792933-792955 GAGAGCCAACACCAGCACACAGG + Intergenic
929943755 2:46354782-46354804 GTGAGGCCCCTCCAGGACACTGG + Intronic
930259205 2:49125412-49125434 GTGTTCAACCTGCAGCTCACAGG - Intronic
933659660 2:84916879-84916901 GTGAGACACCCCCCGCCCACTGG + Intergenic
933671039 2:85007514-85007536 TTGGCCCACCTCCAGCTCCCAGG + Intronic
934681640 2:96287832-96287854 GTGACCAGCATCCAGCTCACTGG + Intronic
938568330 2:132540382-132540404 CTTAGCCATCTCCATCTCACAGG + Intronic
940688612 2:156885504-156885526 GTCAGCCACTTCCACCTCAAAGG - Intergenic
941199270 2:162489451-162489473 CTGACCCACATGCAGCTCACGGG + Intronic
941368381 2:164634439-164634461 GTGAGCCATCTGGAGCTCAGAGG - Intergenic
941843124 2:170108909-170108931 GTGAGACAAGTCCAGCTCTCAGG - Intergenic
948615587 2:239196730-239196752 GGTGGCCACCTCCAGCTCTCAGG + Intronic
1169060497 20:2657405-2657427 GTGAGCTACAACCAGCTCTCTGG - Intronic
1169331871 20:4722706-4722728 GTCAGCCTCCTCCAGCTCTGGGG + Intronic
1171449014 20:25223305-25223327 GGCAGCCACCTGCAGGTCACAGG - Intronic
1172196134 20:33092779-33092801 TTGACTCACCTCCAGCTCATGGG + Intronic
1172617546 20:36299106-36299128 TGGAGCGATCTCCAGCTCACAGG + Intergenic
1172618180 20:36303580-36303602 GTGAGCCTCCTCAGCCTCACAGG + Intergenic
1172670562 20:36632183-36632205 GTGAGCAAGCTCCAGCACAGAGG - Intronic
1174035725 20:47667276-47667298 GTGGGCAGCCTCCAGCTCTCTGG - Intronic
1175095489 20:56538161-56538183 GTCAGCAAGCTACAGCTCACAGG + Intergenic
1175813032 20:61868911-61868933 CTGTGGCACCTGCAGCTCACAGG + Intronic
1176265256 20:64205863-64205885 GTGAGCCCCTCCCCGCTCACAGG - Intronic
1178377059 21:32075535-32075557 GTGAGCCACCCCCCGCCCCCCGG + Intergenic
1179190000 21:39115563-39115585 GTGACCCACAACCAGCTCCCAGG + Intergenic
1179896692 21:44367130-44367152 CTGAGCCATCTCCAGCCCACAGG - Intronic
1180179870 21:46113194-46113216 GTGTCCCAGCTCCAGCTCTCAGG + Intronic
1180679555 22:17615615-17615637 GTGAGCCACCTCTATCGCCCAGG - Intronic
1181459483 22:23077847-23077869 GTGAGGTACCACCAGTTCACAGG - Intronic
1182473806 22:30564862-30564884 CTGAGCCACGTCCAACTCCCAGG + Exonic
1182713316 22:32335881-32335903 GCGAGCATCCTCCAGCCCACGGG + Intergenic
1184400572 22:44271462-44271484 GTGAGCACCCTCCAGCCCATGGG + Intronic
1184485461 22:44776031-44776053 GTGAGTCACCTCCAGATTTCAGG + Intronic
959833551 3:110892517-110892539 CTGAGCCACCGAGAGCTCACAGG + Exonic
962728169 3:138254991-138255013 GTGATACAGCTCCAGCTCCCAGG + Intronic
962932823 3:140053276-140053298 TTCAGCCACCACCAGCACACAGG + Intronic
964439342 3:156689826-156689848 GTGAGCCAGGTCCAGCTACCAGG - Intronic
966631578 3:182081737-182081759 CTGCTCCATCTCCAGCTCACTGG - Intergenic
966877414 3:184331020-184331042 GTGAGCCACCGCCCGCTCCTGGG + Intronic
968506941 4:975006-975028 GTGAGCCACCTCCTCCTCATGGG - Intronic
968668658 4:1835689-1835711 GTCAGCCAGCTGCAGCCCACAGG - Intronic
968727693 4:2255898-2255920 CTGGGCCACCCCCAGCTCCCCGG - Intronic
969505487 4:7584474-7584496 GTGAGACCCCTCCACCTCACAGG + Intronic
975377478 4:73662671-73662693 CTGACCCACTTCCAGCTCAGGGG - Intergenic
984134680 4:175920771-175920793 GTGAGCCACCACCGCCTCCCGGG - Intronic
986946758 5:13030186-13030208 GTGGCCCACCTGCAGCTCAATGG + Intergenic
989539208 5:42599312-42599334 GTGAGCCAAATCTAGCTCATGGG + Intronic
994090606 5:95806591-95806613 GAGAGGCACCTCCAGCTTAGAGG - Intronic
996336395 5:122388311-122388333 GTGGGCCAGATTCAGCTCACAGG + Intronic
996607215 5:125337548-125337570 GCAAGGCATCTCCAGCTCACCGG + Intergenic
996707154 5:126508867-126508889 GTGACCCAAATCCAGCTCACAGG + Intergenic
997313247 5:132908844-132908866 CTCTGCCACCTCCAGCTCCCAGG + Intronic
1001246588 5:170109484-170109506 TTCAGCCATCTCCAGCTCACTGG - Intronic
1005545464 6:26864162-26864184 GTGAGCGATCTCCAGCTGCCAGG - Intergenic
1005849998 6:29814033-29814055 ATGAGTCACCACCACCTCACTGG + Intergenic
1007207224 6:40162778-40162800 CTGAGCCACCTCCAGGCCCCTGG + Intergenic
1007627692 6:43255514-43255536 GGGAGTCACCTGCAGCTCTCAGG - Intronic
1012622019 6:101356805-101356827 GTGAGCCTCCACCAGCACAAAGG + Intergenic
1013284281 6:108667032-108667054 GTGAGCTCACTCCAGCTCACGGG + Intronic
1014473019 6:121839107-121839129 CTGAGCCAACCACAGCTCACTGG + Intergenic
1015926899 6:138319835-138319857 GTGCTCCACCACCAGCTCACAGG - Exonic
1017540388 6:155396474-155396496 GTCAGCAAGCTCCAGCCCACAGG + Intronic
1021602545 7:22378671-22378693 GTCAGCAAATTCCAGCTCACAGG + Intergenic
1021844577 7:24752169-24752191 CTGGGCCATCTCAAGCTCACTGG - Intronic
1021945233 7:25719841-25719863 GTGAGCCACCGCCACCTGCCCGG - Intergenic
1024543733 7:50500132-50500154 GCGAGCCACCCTCACCTCACAGG + Intronic
1024785019 7:52897835-52897857 GTCAGGCCCCTCCTGCTCACCGG + Intergenic
1027266606 7:76498291-76498313 GTGTCCGACCTCCAGCCCACAGG + Intronic
1027317987 7:76996409-76996431 GTGTCCGACCTCCAGCCCACAGG + Intergenic
1027775542 7:82460137-82460159 CTGAGCCACATGCAGCCCACAGG + Intergenic
1029449842 7:100634681-100634703 CTGAGCTACATCCACCTCACCGG + Intronic
1030282840 7:107794754-107794776 AAGAGCCACGTCCAGCTCACTGG - Intronic
1033264352 7:139871984-139872006 GTAAGGCATCTCCAGCTCAGAGG + Intronic
1034265946 7:149780692-149780714 GGGGGTCACCTCCAGCTCAGGGG + Intergenic
1035243458 7:157547269-157547291 CAGAGCCACCTGAAGCTCACGGG + Intronic
1036195368 8:6708888-6708910 GTGAGCCGCCTCCCGCTCCCGGG + Intronic
1036223518 8:6940171-6940193 GTGAGCCAACTCCATGTCCCGGG + Intergenic
1036588609 8:10147705-10147727 GTGCTCAACCACCAGCTCACAGG + Intronic
1042282030 8:67064973-67064995 GTCAGCCACCTCCAGGGCCCGGG + Intronic
1048330263 8:133466215-133466237 GTGAGCCGCCTCCATCTCCGGGG - Intronic
1049575250 8:143386847-143386869 CTTAGCCACCTCCAGGGCACTGG + Intergenic
1052398608 9:27972559-27972581 GAGAGCCAAGTCCAGATCACAGG - Intronic
1056698432 9:88880364-88880386 GTGTGACACCTCCAGCTGCCTGG - Intergenic
1057725278 9:97564006-97564028 GTGAGCCACCTCCCTTTCATCGG + Intronic
1059194754 9:112360240-112360262 GTGATGCACTTACAGCTCACTGG + Intergenic
1059323720 9:113488874-113488896 GTCTGCCTCCTCCAGCTCAGAGG - Intronic
1060839368 9:126781867-126781889 GTTTGCCAACTCCAGCTCCCAGG - Intergenic
1061358520 9:130124682-130124704 GCAAGCCAACTCCAGCTCATGGG + Intronic
1189982083 X:46521109-46521131 CTGAGCAACCTCCACCTCCCGGG - Intronic
1190857293 X:54308987-54309009 GTGAGCCACATTCATCCCACTGG + Intronic
1191817629 X:65265417-65265439 GTGAGCCATATCCAGCCTACTGG + Intergenic
1199708781 X:150453207-150453229 GTGAGCTAAATCCAGCCCACGGG + Intronic