ID: 924682426

View in Genome Browser
Species Human (GRCh38)
Location 1:246251390-246251412
Sequence CACCTACTAAAGCTGTAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924682426_924682430 6 Left 924682426 1:246251390-246251412 CCAGCCTACAGCTTTAGTAGGTG 0: 1
1: 0
2: 1
3: 1
4: 81
Right 924682430 1:246251419-246251441 ACACTGTGCCCGGCTTTAGTAGG 0: 25
1: 2
2: 0
3: 18
4: 192
924682426_924682432 14 Left 924682426 1:246251390-246251412 CCAGCCTACAGCTTTAGTAGGTG 0: 1
1: 0
2: 1
3: 1
4: 81
Right 924682432 1:246251427-246251449 CCCGGCTTTAGTAGGTGCCTCGG 0: 13
1: 14
2: 1
3: 0
4: 53
924682426_924682434 27 Left 924682426 1:246251390-246251412 CCAGCCTACAGCTTTAGTAGGTG 0: 1
1: 0
2: 1
3: 1
4: 81
Right 924682434 1:246251440-246251462 GGTGCCTCGGACACTGTGCCCGG 0: 13
1: 13
2: 3
3: 10
4: 156
924682426_924682428 -4 Left 924682426 1:246251390-246251412 CCAGCCTACAGCTTTAGTAGGTG 0: 1
1: 0
2: 1
3: 1
4: 81
Right 924682428 1:246251409-246251431 GGTGCCTCAGACACTGTGCCCGG 0: 1
1: 13
2: 13
3: 40
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924682426 Original CRISPR CACCTACTAAAGCTGTAGGC TGG (reversed) Intronic
905278005 1:36831440-36831462 CACATACCAAAGATGTGGGCAGG - Intronic
912880304 1:113405651-113405673 CAGTTACTAAAGGCGTAGGCAGG - Intronic
924682426 1:246251390-246251412 CACCTACTAAAGCTGTAGGCTGG - Intronic
1071818957 10:89261085-89261107 CACCTACTAAAGAACTAGCCTGG + Intronic
1073766343 10:106686817-106686839 CATCTCTTACAGCTGTAGGCGGG - Intronic
1074248131 10:111714525-111714547 CACCTGCTGCAGCTGTAGGGAGG - Intergenic
1075345526 10:121679381-121679403 CAACTACTAGGGCTGAAGGCAGG + Intergenic
1076038269 10:127219865-127219887 CACCTGCTGAAGATGTGGGCTGG - Intronic
1086187432 11:84035479-84035501 CAACTACAAAAGCTGTAGGCAGG + Intronic
1087017724 11:93570938-93570960 CAGCTATTAAAGCTGCAGTCAGG + Intergenic
1087214492 11:95480734-95480756 AACCTAATAAAGCTGAAGGAAGG + Intergenic
1088177125 11:107066387-107066409 TACCTACTGAAGCTGAAGGAGGG - Intergenic
1094422657 12:30288056-30288078 CACCTACTAAGGTTCTAGTCAGG - Intergenic
1095790229 12:46158996-46159018 CACATAAAAAATCTGTAGGCAGG - Intergenic
1097593436 12:61599591-61599613 CACCTCCTAAAGCTGATGCCTGG + Intergenic
1101033527 12:100683010-100683032 CACCTTGTGAAGCTGGAGGCAGG - Intergenic
1102136561 12:110581049-110581071 CACCTCATAAATCTGTATGCTGG - Intronic
1106839866 13:33675464-33675486 CACCTACTCAATATGTAGGTAGG + Intergenic
1107243449 13:38264976-38264998 CACCTACTAGAGCTGCAGTAAGG - Intergenic
1108640364 13:52377913-52377935 CGCGTCCTAGAGCTGTAGGCAGG + Exonic
1110285170 13:73741364-73741386 GACCTACAAAAGCTTTAGGTTGG + Intronic
1114643582 14:24241105-24241127 CACATCCTGAAGCTGTGGGCAGG + Exonic
1118101260 14:62605949-62605971 CACCTTTTAAAACTGTAAGCTGG - Intergenic
1118885318 14:69860838-69860860 CACCTATCAAAGCTCAAGGCAGG - Intronic
1121694405 14:95901105-95901127 CACCTTCTGAAGCTGTTGCCTGG - Intergenic
1122759173 14:104008590-104008612 CTCCTACTAAAGCTGGAAACAGG - Intronic
1126756989 15:51934617-51934639 ATCCTTCAAAAGCTGTAGGCAGG - Intronic
1127817055 15:62620406-62620428 CAACAACAAAAGCAGTAGGCAGG - Intronic
1128894198 15:71357601-71357623 CCCCTATTAAAACTGCAGGCGGG - Intronic
1130674600 15:85940578-85940600 AACCTAGCAAAGCTGTTGGCTGG - Intergenic
1134825499 16:17281192-17281214 CAGGTACTAGAGCTGGAGGCAGG + Intronic
1141885846 16:86891790-86891812 GACCTCCTAAAGCTTTAGGATGG - Intergenic
1148070320 17:44904852-44904874 CATCTACTATTGCTGGAGGCAGG + Exonic
1149601357 17:57895123-57895145 CACCTTGTAGAGCTGTAGGGAGG - Intronic
1151917486 17:77129086-77129108 AACCAACTAGAGCGGTAGGCGGG + Intronic
1154227466 18:12519843-12519865 CAACTACTAAACCTCTAGGAAGG + Intronic
1157417966 18:47521712-47521734 CACCTATTTAAGCTGTAGAGGGG + Intergenic
1160064650 18:75563597-75563619 CACCTACAAATGCAGTGGGCGGG - Intergenic
1161889863 19:7027090-7027112 CAAAAACAAAAGCTGTAGGCTGG - Intergenic
1161891589 19:7043656-7043678 CAAAAACAAAAGCTGTAGGCTGG + Intergenic
930632695 2:53771216-53771238 CCCCTAATAAAACTATAGGCCGG + Intronic
941933984 2:170969088-170969110 CACCTACTAAAGCTCAAAGATGG + Intergenic
944383502 2:199139176-199139198 CACCTATTAGAGCTGTAGAATGG - Intergenic
945964783 2:216175174-216175196 CCCCCACTACTGCTGTAGGCAGG + Intronic
946496120 2:220197207-220197229 CACCAACAGAAGCAGTAGGCAGG + Intergenic
946633021 2:221692183-221692205 GACATACTAAATCCGTAGGCTGG + Intergenic
948396567 2:237649231-237649253 CAGCTACGAACACTGTAGGCCGG + Intronic
1169002747 20:2179713-2179735 CTTCCACTAAAGCCGTAGGCTGG - Intergenic
1169021907 20:2336506-2336528 CCCCTCCTTAAGCTGTAAGCTGG + Intronic
1173012555 20:39195474-39195496 CATCTCCTAAGGCTGCAGGCAGG - Intergenic
1173139203 20:40467457-40467479 CACCTCCAAATGCTCTAGGCTGG + Intergenic
1175692055 20:61072663-61072685 CACCTCCTACAGCTGGAGACTGG + Intergenic
1182872068 22:33656535-33656557 AGCCCACTAAAGCTGCAGGCAGG + Intronic
1183801391 22:40167926-40167948 CCCCTCCTAAAGCTCTAGGAGGG - Intronic
1184197501 22:42940078-42940100 CTCCTCCGAAGGCTGTAGGCAGG + Intronic
949174504 3:1043147-1043169 CACAGTCTAAAGATGTAGGCTGG + Intergenic
950336563 3:12199037-12199059 GACCTACTGAACCTGTAGGGGGG + Intergenic
964062173 3:152537838-152537860 CACAAGCTAAAGCTGTTGGCAGG + Intergenic
970221816 4:13819408-13819430 CACTTAATAAAGATGGAGGCTGG + Intergenic
970506302 4:16734096-16734118 CACCTTTTAAAGTTGTTGGCTGG + Intronic
990694464 5:58400477-58400499 CACCTACTAAAGGGTTAGGGTGG - Intergenic
990694548 5:58401488-58401510 CACCTACTAAAGGGTTAGGGTGG - Intergenic
993606559 5:89997596-89997618 CACTGACTAAAGCTAGAGGCTGG - Intergenic
996144071 5:119951879-119951901 CAGCTACTAAAGCTATACACTGG - Intergenic
998900143 5:146844460-146844482 CACCTACACAAACTGTTGGCAGG + Intronic
1000200335 5:159003757-159003779 CACCTACTAGAGCTGAAGTGTGG - Intronic
1001448223 5:171803893-171803915 TACCTACTAAAGCTGAACACAGG + Intergenic
1014373810 6:120646202-120646224 CACCCACTGAGGCTGTAGGAGGG - Intergenic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1020889178 7:13857461-13857483 CACCGAAGAAAGATGTAGGCTGG + Intergenic
1028419041 7:90611712-90611734 CACCTTTTAAAGCAGTAAGCAGG - Intronic
1030128703 7:106178855-106178877 CACCTACTAAAGTAGTAGTCAGG - Intergenic
1034262176 7:149764081-149764103 CACCGACTAGAGCTGAAGGGGGG - Intergenic
1038993133 8:32891694-32891716 CACCTGCTAAAGCTCTGAGCAGG - Intergenic
1040472073 8:47742282-47742304 CACCTGATAAAAATGTAGGCTGG - Intergenic
1045445258 8:102255893-102255915 CACAAACTAAAGCTGTTGACAGG + Intronic
1060183603 9:121550762-121550784 CACCTGGTAAGGCTGTCGGCGGG - Intergenic
1062196635 9:135277863-135277885 AACCTACTAAATCTCTTGGCTGG + Intergenic
1185932509 X:4218789-4218811 CAACAACAACAGCTGTAGGCAGG + Intergenic
1191869945 X:65737333-65737355 CAGCTGGTAAAGCTGTAGGGTGG + Exonic
1192308371 X:69987720-69987742 GTCCCACTGAAGCTGTAGGCTGG - Intronic
1195104764 X:101593420-101593442 CACCTCTTAAGGCTGAAGGCTGG + Intergenic
1195798376 X:108679195-108679217 CAACTAATAAAACTGTAGGAAGG + Intronic
1199312521 X:146337870-146337892 CAACTGCAAAAGCTGTAGGAGGG + Intergenic