ID: 924683757

View in Genome Browser
Species Human (GRCh38)
Location 1:246266091-246266113
Sequence TGGGGTTCCCTTTTAAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924683757 Original CRISPR TGGGGTTCCCTTTTAAAATC AGG (reversed) Intronic
907601210 1:55772058-55772080 CTTGGTTCCATTTTAAAATCAGG - Intergenic
909134728 1:71783777-71783799 TGGGGTCACCTATAAAAATCTGG + Intronic
909973463 1:82018828-82018850 TAGGGGTCACTTTTTAAATCAGG - Intergenic
912151615 1:106865586-106865608 GATGGTACCCTTTTAAAATCTGG + Intergenic
912311205 1:108623116-108623138 TGGGTTTCCTTTTTAACATAGGG - Intronic
913214030 1:116605216-116605238 TGGGTGTGCCTCTTAAAATCTGG - Intronic
915791540 1:158677197-158677219 TTAGGTTTCCTTTTAAAACCTGG - Intronic
918091690 1:181300854-181300876 TGGGATTTGCTTTAAAAATCTGG - Intergenic
919191678 1:194229757-194229779 TGTGGTACTCTTTTAAATTCTGG - Intergenic
924683757 1:246266091-246266113 TGGGGTTCCCTTTTAAAATCAGG - Intronic
1064739207 10:18414870-18414892 TGTCGTTCCCTGTTAACATCTGG - Intronic
1065167669 10:22997075-22997097 TTGGGTCTCCCTTTAAAATCAGG + Intronic
1065241966 10:23714713-23714735 TGGGGTTCCCTTCGCAAATATGG - Intronic
1066023560 10:31327940-31327962 TGGGTTTCCCTTTCCATATCTGG + Intronic
1067139380 10:43643802-43643824 TGGGGGTACCTTGAAAAATCAGG + Intergenic
1068193557 10:53686249-53686271 TGGGGAATCCTTTTAAAATTTGG - Intergenic
1072757860 10:98032152-98032174 TGTGGGCCCCTTTGAAAATCTGG + Intergenic
1073472802 10:103733600-103733622 TGGGGCATCCTTTTAAAATAAGG + Intronic
1075997987 10:126893711-126893733 TGAAGATCCCTTTTTAAATCTGG + Intergenic
1077593661 11:3513223-3513245 TGGAGTTTCTTTTTAATATCCGG + Intergenic
1078668515 11:13345218-13345240 TGGGGTCCCATTTTAAAAAGGGG + Intronic
1079315398 11:19403849-19403871 TGGGGTGGCCATCTAAAATCAGG + Intronic
1082815271 11:57503835-57503857 TTGGGTGCCAGTTTAAAATCAGG + Intronic
1084249487 11:67885972-67885994 TGGAGTTTCTTTTTAATATCCGG + Intergenic
1084823322 11:71709517-71709539 TGGAGTTTCTTTTTAATATCCGG - Intergenic
1087138481 11:94743059-94743081 TGGGGTTCCCTTCTGGGATCTGG + Intronic
1087836401 11:102879591-102879613 TGGTGTTTCCTTTGAAAATGAGG - Intergenic
1090671958 11:128954364-128954386 TGGGGTTCCCTTTTCCTCTCTGG - Intergenic
1092033731 12:5312035-5312057 TGGGGTTTCTTTCTAATATCAGG + Intergenic
1092419770 12:8321369-8321391 TGGAGTTTCTTTTTAATATCCGG + Intergenic
1093508139 12:19893399-19893421 TCAGGTTCTCTCTTAAAATCAGG + Intergenic
1095296857 12:40536516-40536538 TGGGTTTCCCTTTTACTATAAGG - Intronic
1098424942 12:70352465-70352487 TGGTGTTCCATCTTAAAATTTGG + Intronic
1100185456 12:92134188-92134210 TGGGATTCCTTTTTAAAATGAGG + Intronic
1100554160 12:95675734-95675756 TGGGGTCCGCTTTCAGAATCAGG + Intronic
1102384655 12:112498172-112498194 CAGGGTTCCCTTTCAAAATGAGG - Intronic
1103552027 12:121744743-121744765 TGGGCCTCCATTTTAGAATCTGG + Intronic
1105217251 13:18295765-18295787 TGGGTGTGCCTCTTAAAATCTGG - Intergenic
1106137477 13:26984513-26984535 TGAGGATCCCGTTTAAAATAAGG + Intergenic
1109495598 13:63167732-63167754 TGCTGTTCACTTTTAATATCAGG - Intergenic
1111256459 13:85676068-85676090 TAAAGTTCCCTTTTAAAATCAGG - Intergenic
1111744292 13:92246699-92246721 TAGAGTTCCATTTTCAAATCCGG + Intronic
1112225949 13:97540405-97540427 TGGTGTTCCCTTGTAAAACAGGG + Intergenic
1117543225 14:56769157-56769179 TGTCTTTCCCTTTTAAAATAGGG + Intergenic
1125397792 15:39269258-39269280 TGTAGTTCCCTGTAAAAATCTGG - Intergenic
1125627030 15:41116846-41116868 TGGGGCTCCCATTTAGACTCTGG + Intergenic
1127237722 15:57073668-57073690 TGGGGGTCTCTTTTATAATTTGG - Intronic
1133767706 16:8849365-8849387 TGGGGTTCCATTCCAGAATCTGG - Intergenic
1136872151 16:33816955-33816977 TGTGGTTTCCTTTTAAACTTTGG + Intergenic
1203100021 16_KI270728v1_random:1299113-1299135 TGTGGTTTCCTTTTAAACTTTGG - Intergenic
1143875241 17:9986282-9986304 TGGGACTTCCTTTTAAAATAAGG - Intronic
1144842280 17:18194649-18194671 TGGAGTACCCTTTTAAAAAAGGG + Intronic
1145234043 17:21196228-21196250 TGGGGCTCCCTTTCCAAACCTGG + Intergenic
1146722645 17:35133936-35133958 TTGGGTTCCTTTTTAAAATAAGG - Intronic
1147833091 17:43310917-43310939 TGGGGGTCCCTTTTATACTCTGG + Intergenic
1148816569 17:50332257-50332279 GGGGGGAACCTTTTAAAATCAGG + Intergenic
1151605109 17:75130978-75131000 GGTGGTTTCTTTTTAAAATCAGG + Intronic
1151840512 17:76614386-76614408 TGGGGTTCCCTTGTGAATTGTGG - Intergenic
1153999227 18:10469672-10469694 GGGGGCCCCATTTTAAAATCAGG + Intronic
1157167802 18:45374468-45374490 TGGGGTTCCAGTTAAATATCTGG + Intronic
1161819096 19:6518150-6518172 TGGGATTCCCTTTCCAAAGCGGG + Intergenic
1165522720 19:36327480-36327502 TGGAGTTTCCTTTTACTATCTGG + Intergenic
1165659004 19:37558327-37558349 TGGAGTTTTCTTTTAATATCTGG + Intronic
1166274159 19:41740183-41740205 TGGGGTTTTGTTTTAAAATGTGG - Intronic
1166296602 19:41893038-41893060 TGGGGTTCCCTTGTCATTTCTGG + Intronic
926348147 2:11968354-11968376 TGGGGATCCGTTTTGAAAGCTGG - Intergenic
932197402 2:69796433-69796455 TGTGGTTTCCTTCTAATATCAGG + Intronic
934297073 2:91750917-91750939 TGGGTGTGCCTCTTAAAATCTGG + Intergenic
936513214 2:113165064-113165086 TGTGGTGCCCTTTTGAACTCTGG + Intronic
936924920 2:117726716-117726738 TGGCTTTCCCTTGTAAAATGGGG + Intergenic
937597442 2:123687972-123687994 TGGAGTTTTCTTTTAATATCTGG - Intergenic
938757027 2:134390244-134390266 TGAGGTTCACTTTTTAGATCAGG + Intronic
943332661 2:186578099-186578121 TGGGGTTCTCTTTTACCCTCAGG + Intergenic
944104980 2:196069813-196069835 TGGGGTTCCTTGTTAATTTCAGG - Intergenic
945590323 2:211721034-211721056 TGTGCTTCCCTTTGGAAATCTGG + Intronic
1170901383 20:20466574-20466596 TCGAGGTCCCTTTTAAAATGTGG + Intronic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1174874444 20:54211758-54211780 TGTGGATCCCTTTGAGAATCTGG + Intronic
1175975381 20:62708221-62708243 TGGTGATTCCTTTTAAAATCTGG - Intergenic
1179409087 21:41148408-41148430 CGGGGTTCCTTTTTAGAATATGG - Intergenic
1182154266 22:28054437-28054459 TTGGGTTTCATTTTAAAATCAGG + Intronic
1183648479 22:39140419-39140441 TGTTCTTTCCTTTTAAAATCAGG - Intronic
950226579 3:11240364-11240386 TTGTGTTTCCTTTTAAAAACAGG + Intronic
951362179 3:21738366-21738388 TGGTCTTCCCATTTAAAAACAGG + Intronic
951365224 3:21773324-21773346 TAGGTTTCTCTTTTAAAAACAGG + Intronic
952423879 3:33155199-33155221 TGGGAGTCCTTTTTAAATTCTGG - Intronic
952528986 3:34243822-34243844 TGGGTTTCCCTTTCTTAATCTGG - Intergenic
954055199 3:48017437-48017459 TTGGGGTCCCTTTAAAGATCAGG - Intronic
957063727 3:75503929-75503951 TGGAGTTTCTTTTTAATATCCGG + Intergenic
960760364 3:121066789-121066811 TGGTGTTCCCTCTTAAAATTTGG + Intronic
961064663 3:123865069-123865091 TGGGGTTCCCTACTCCAATCTGG + Intronic
961897456 3:130180560-130180582 TGGAGTTTCTTTTTAATATCCGG + Intergenic
962880853 3:139575096-139575118 TGGGGTCCCTTTTCACAATCTGG - Intronic
963427202 3:145146531-145146553 TGGAGTTACCTGTGAAAATCTGG - Intergenic
963525266 3:146408609-146408631 TGGAGTTTTCTTTTAATATCTGG + Intronic
965266819 3:166554132-166554154 TGGGGTGACTTTTTAAAACCCGG - Intergenic
967184271 3:186931422-186931444 TTGGTTTCCCTTTTTAAGTCTGG - Intronic
968601014 4:1509352-1509374 TGGGGTCTCCTTTTAAAAGCAGG + Intergenic
969007623 4:4034132-4034154 TGGAGTTTCTTTTTAATATCCGG + Intergenic
969652022 4:8473694-8473716 TGTGGTTCCATTTCAAAATGAGG + Intronic
969745985 4:9071931-9071953 TGGAGTTTCTTTTTAATATCCGG - Intergenic
969805345 4:9603360-9603382 TGGAGTTTCTTTTTAATATCCGG - Intergenic
970138148 4:12949262-12949284 TTGTGTTCCCTTTTAAAAGCAGG - Intergenic
971417890 4:26450422-26450444 TGGGCTTCCCTTGCAAAAGCAGG - Intergenic
972789739 4:42359732-42359754 TGGGGTTCCATTTTAAAACCGGG + Intergenic
973194512 4:47424350-47424372 TGGGATGGCCTTTTAAAATAGGG + Intronic
974590447 4:63942402-63942424 TGGGGTTCCCTTCCACAATGTGG - Intergenic
981597109 4:146437951-146437973 TAGGGTTTCCTTTTAAGATCAGG + Intronic
982877761 4:160668978-160669000 TGGGGTTGCACTTCAAAATCTGG + Intergenic
983635063 4:169889516-169889538 TGGGGTTCCTTTTTGAAATTAGG + Intergenic
983684642 4:170393989-170394011 TGGGCTTCCCTGTTGAGATCAGG + Intergenic
986380479 5:7180547-7180569 TGGGCTTTCCTTTTAAGATTTGG - Intergenic
990332640 5:54742768-54742790 TGGAGTTCCCCTGTAGAATCAGG + Intergenic
994081244 5:95710922-95710944 TGGAGTTTTCTTTTAATATCTGG + Intergenic
994853238 5:105084167-105084189 TGTGGTTTTCTTTTAAAATTTGG + Intergenic
996294502 5:121895615-121895637 TAGGGTCCCCTTTTACATTCAGG + Intergenic
997590142 5:135067377-135067399 TGGGGTTCCTTTTTATTAACAGG - Intronic
1005633199 6:27728339-27728361 CGGGGCTCCCTCTTTAAATCTGG + Intergenic
1005738805 6:28772600-28772622 TGGAGTTTTCTTTTAATATCAGG + Intergenic
1006730452 6:36232112-36232134 GTTGGTTCCCTTTTAAACTCTGG - Exonic
1006822711 6:36911124-36911146 TGGAGATCCCTTTAAAAAGCAGG - Intronic
1007601406 6:43084101-43084123 TGCAGTTTCCTTTTGAAATCTGG - Intronic
1007875090 6:45089318-45089340 TGTTCTTCCCTTTTACAATCAGG + Intronic
1007896624 6:45368242-45368264 TTGGGTTCACATTTAAACTCTGG - Intronic
1007909036 6:45494703-45494725 TGGGCTTTCCTTTAAAAATTGGG - Intronic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1013310351 6:108888106-108888128 TCTGGATCCCTTTTAAAGTCTGG - Intronic
1016689238 6:146916765-146916787 TTGGTTTTCCTTTTAAAATCTGG - Intergenic
1019018857 6:168900885-168900907 TGGGGTTCCGGCTTAAAATAAGG - Intergenic
1019128593 6:169857847-169857869 TGTGGTTCCATTTTTAAAGCTGG + Intergenic
1020328145 7:6992261-6992283 TGGAGTTTCTTTTTAATATCTGG + Intergenic
1021303188 7:18998119-18998141 TGAGTTTCCTTTTTAAAATGGGG - Intronic
1022607671 7:31832480-31832502 TTGGGTTACATTTTAAAATAAGG - Intronic
1023003089 7:35831707-35831729 TGGGCTTCGTTTTTAAAATTTGG + Intronic
1023466219 7:40457976-40457998 TGGTGTTGGTTTTTAAAATCCGG + Intronic
1028710865 7:93906239-93906261 TATGGTTCCCTTTTAATACCAGG + Intronic
1033493065 7:141863306-141863328 TTGGGTTCCTTTTTCAAATCTGG + Intergenic
1033495266 7:141887599-141887621 TGGGGTTTCTTTCTGAAATCTGG + Intergenic
1033497293 7:141911894-141911916 TTGGGTTCCTTTCTGAAATCTGG + Intronic
1033498046 7:141919327-141919349 TTGGGTTTCTTTTTCAAATCTGG + Exonic
1033663929 7:143423600-143423622 TGGGGTCCCCTTTCACAATGTGG - Intergenic
1034405611 7:150900736-150900758 TGGGTTTACCTTTTAAGGTCAGG - Intergenic
1034645280 7:152640848-152640870 TGGAGATGCCTTTTAAAATAAGG - Intergenic
1036793780 8:11741039-11741061 TGGGATACCATTTTAAAAACAGG - Intronic
1037714224 8:21383381-21383403 TGGGGATCTCTATTAAAATCAGG - Intergenic
1038024081 8:23573678-23573700 TGGAGTTCCTTTTTCAGATCAGG + Exonic
1039378406 8:37060827-37060849 TGCACTGCCCTTTTAAAATCAGG + Intergenic
1039403384 8:37292453-37292475 TGGTGTTCCTTTTTCATATCAGG - Intergenic
1039634900 8:39153794-39153816 TTGGGTTTCCTTTGAAAATCAGG + Intronic
1041228413 8:55724201-55724223 AAGGGTCCCCTTTTAAAAGCTGG - Intronic
1041817135 8:61986647-61986669 TGGTGTACCATTTTCAAATCTGG - Intergenic
1044084647 8:87928872-87928894 TGGGGTGCACATTTAGAATCCGG + Intergenic
1044534390 8:93342860-93342882 TCGGGTTCCCTTCTAATGTCAGG + Intergenic
1045694714 8:104795496-104795518 TAGGGATGCATTTTAAAATCTGG - Intronic
1046193044 8:110823198-110823220 TATGGTTCCCTTTTATAAGCAGG + Intergenic
1049010643 8:139884814-139884836 TGGGTTTCCATTTTACACTCGGG - Intronic
1050039468 9:1474063-1474085 TGTTTTTCCTTTTTAAAATCTGG - Intergenic
1052431359 9:28370934-28370956 TGGGCTTCCCTTTTATAAGAAGG + Intronic
1053230473 9:36403517-36403539 TGAGGCTCCCTTTAAAAAACTGG + Intronic
1056306938 9:85299806-85299828 TTAGATTCCCTATTAAAATCTGG - Intergenic
1056498966 9:87189459-87189481 TGGGGTTCCCTCTTACACTTTGG + Intergenic
1056914167 9:90730253-90730275 TGGGGTCCCCTTCCAAAATGTGG + Intergenic
1057988501 9:99742529-99742551 AGGGTTTCCCTTTTTGAATCTGG + Intergenic
1059850667 9:118335217-118335239 AGGGGCTCCTATTTAAAATCTGG + Intergenic
1061804125 9:133128640-133128662 TGGGGAACTCTTTTAAGATCTGG + Intronic
1186108287 X:6228590-6228612 TCGGGTTCCCTAGAAAAATCTGG - Exonic
1186455472 X:9707116-9707138 TGGGGGTCCCTTGTTAAAGCAGG + Intronic
1186615122 X:11178034-11178056 TGGTATGCCCTTTTAAAATAGGG + Intronic
1186950183 X:14615711-14615733 TGGGCTACACTTTTAAAATAAGG + Intronic
1189592597 X:42530836-42530858 TGGGGTCCCCTTTTAATATAGGG + Intergenic
1189630881 X:42952060-42952082 TGGGGTTCCATTTGGAAAACAGG + Intergenic
1193101014 X:77612311-77612333 TGGGGGTACTTTTTAAATTCTGG + Intronic
1195599557 X:106729870-106729892 TAGGGTTTCCTTTTAACCTCTGG + Intronic
1198800045 X:140439379-140439401 CGGCGTTCCCTTTGAAAATCTGG - Intergenic