ID: 924688311

View in Genome Browser
Species Human (GRCh38)
Location 1:246319585-246319607
Sequence TTTTGTTGATGAGCTCTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924688311_924688314 -6 Left 924688311 1:246319585-246319607 CCCAACAGAGCTCATCAACAAAA 0: 1
1: 0
2: 0
3: 12
4: 246
Right 924688314 1:246319602-246319624 ACAAAAAAGGCTCTAAAATCTGG 0: 1
1: 0
2: 2
3: 21
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924688311 Original CRISPR TTTTGTTGATGAGCTCTGTT GGG (reversed) Intronic
900941058 1:5798814-5798836 TTTTGTTGAGAAGCTGTGTGGGG - Intergenic
901395584 1:8978750-8978772 TTTTCTGGATGTGCCCTGTTTGG + Intergenic
901731789 1:11285364-11285386 CTATGTTGCAGAGCTCTGTTGGG + Intronic
905316794 1:37087271-37087293 TTTTTTAGATGAGCTTTGCTTGG - Intergenic
905982762 1:42245533-42245555 TTCTGTTGATGTGATGTGTTAGG - Intronic
906176662 1:43779926-43779948 TTTTCTTGAAGAACTCTCTTTGG + Intronic
907811635 1:57876776-57876798 TTTTCTTGGTGAGTTCAGTTTGG - Intronic
907832338 1:58077051-58077073 TATTGTTGCTGAGTTCTGGTGGG + Intronic
909255051 1:73409319-73409341 TTTTGTAGATTATCTCTATTAGG - Intergenic
911194447 1:94979462-94979484 TTTTGTTGAAGAGCTGGCTTAGG + Exonic
911965327 1:104361353-104361375 TAGTGGTGATGAGCTCTTTTAGG - Intergenic
914379065 1:147100163-147100185 TCTTCCTGATTAGCTCTGTTTGG + Intergenic
915859357 1:159427403-159427425 TTTTGTTGATCATGGCTGTTAGG - Intergenic
916849169 1:168685229-168685251 TTTTATAGACTAGCTCTGTTAGG - Intergenic
917533057 1:175854365-175854387 TTTTTTTTAGGAGGTCTGTTGGG + Intergenic
919936900 1:202258564-202258586 GTTTGTTTATGAGCTTTCTTTGG + Intronic
920137105 1:203778835-203778857 TTTTGTAAATGAAGTCTGTTGGG + Intergenic
921770351 1:219030143-219030165 TTTTGTAGATGAGATTTATTAGG - Intergenic
922361891 1:224830212-224830234 TTTTTTAAGTGAGCTCTGTTAGG + Intergenic
922849011 1:228716066-228716088 TTTTGTTAATGAGCTGAGTGTGG - Intergenic
924688311 1:246319585-246319607 TTTTGTTGATGAGCTCTGTTGGG - Intronic
924767963 1:247051944-247051966 TTTTATTGATGATATGTGTTTGG + Intronic
1062984783 10:1758100-1758122 TTTTCTTGATGGGTTCTTTTAGG - Intergenic
1063069078 10:2641344-2641366 CTTTGCTGATGTTCTCTGTTTGG - Intergenic
1063348201 10:5330863-5330885 TTAGGTTGATGAGTTTTGTTGGG + Intergenic
1064761090 10:18621609-18621631 TGTTGTTGATGCACTCTATTTGG - Intronic
1065539352 10:26745427-26745449 TTTTGTTGATTACTTCTGTTAGG - Intronic
1066039500 10:31532769-31532791 TTTTGTTGATGCTCTTTATTAGG - Intergenic
1066383016 10:34917818-34917840 TTTTTTTAATGAGCTGGGTTTGG - Intergenic
1068188886 10:53623975-53623997 CTTTGGATATGAGCTCTGTTTGG + Intergenic
1070526208 10:77298139-77298161 TTTTGTTGACAAGCTCTCTCTGG - Intronic
1071401069 10:85271367-85271389 CTTTGTTGATATCCTCTGTTTGG - Intergenic
1071879692 10:89883191-89883213 GTTTGTTTGTAAGCTCTGTTAGG + Intergenic
1072147661 10:92656788-92656810 TTTTGCTGATTGGCTGTGTTGGG - Intergenic
1073826921 10:107334848-107334870 TTTTGTTGTTGTGTTCTGTCTGG + Intergenic
1074711362 10:116180702-116180724 TTCTTTTTAAGAGCTCTGTTTGG + Intronic
1075876180 10:125807730-125807752 TCTTGTAGATGAGCTATGTGGGG - Intronic
1076663304 10:132069491-132069513 TTTTGGTGATGAGCTCCGATGGG + Intergenic
1078344559 11:10534980-10535002 TTTTGTTCATTAACTCTTTTAGG + Intronic
1079339670 11:19601610-19601632 CTTGGTTGAAGAGCTCAGTTTGG + Intronic
1080944026 11:36950935-36950957 TTCTCTTGCTGAGCTTTGTTGGG - Intergenic
1082204150 11:49411206-49411228 ATTTGTTCAATAGCTCTGTTTGG - Intergenic
1084438370 11:69157083-69157105 TTGTGCTGCTGAGCTGTGTTTGG + Intergenic
1084689264 11:70715715-70715737 ATTTGCTGATGAGCTCGGCTGGG + Intronic
1086650943 11:89289324-89289346 ATTTGTTCAATAGCTCTGTTTGG + Intronic
1086780035 11:90892791-90892813 TTTTCTTAATCAGCCCTGTTTGG + Intergenic
1087524602 11:99293984-99294006 GTTTTTTGATGAGCATTGTTAGG + Intronic
1087614413 11:100471625-100471647 TATTTGTTATGAGCTCTGTTAGG - Intergenic
1091521622 12:1250285-1250307 TTTTGTTGATGAACTCTGCCTGG + Intronic
1095117369 12:38370795-38370817 TTTTGATACTTAGCTCTGTTTGG + Intergenic
1097415733 12:59313976-59313998 TTTTGATGATTAGGTCTATTCGG - Intergenic
1098452845 12:70639827-70639849 TTTTGCAGATGAGTTTTGTTTGG - Intronic
1098532504 12:71556843-71556865 TTTTATTGTTTAGCTCTGTGGGG - Intronic
1099299989 12:80880718-80880740 TTTGCTTGATAAACTCTGTTGGG + Intronic
1100109124 12:91216286-91216308 TTTTTCTGAGGAGCTCTCTTGGG + Intergenic
1100226059 12:92556927-92556949 TTGTGTTGTTTAGGTCTGTTTGG - Intergenic
1100600800 12:96109975-96109997 TTTTGTTGCTGCTCACTGTTTGG + Intergenic
1101754289 12:107608713-107608735 TTTTTTTGATGAGCTGGGTGTGG + Intronic
1101879716 12:108617896-108617918 TTTTGTTGATTAGCTCTCACGGG - Intergenic
1104358595 12:128111209-128111231 TTTTATTAAAGAGCTGTGTTTGG - Intergenic
1105871020 13:24506330-24506352 TTTTGTTGCTGCTCACTGTTTGG - Intronic
1106983871 13:35322019-35322041 TTAGCTTGCTGAGCTCTGTTGGG + Intronic
1110890276 13:80689811-80689833 TTATCTTGCTGAGCTCTGTGGGG - Intergenic
1112990071 13:105502552-105502574 TTTTTTTTAAGAGATCTGTTTGG - Intergenic
1113146659 13:107215459-107215481 TTTGCTAGATGAGCTCTCTTGGG - Intronic
1113524124 13:110960666-110960688 TTTTTTTTTTGAGCTCAGTTGGG + Intergenic
1113896797 13:113769738-113769760 TTTTGTTGATGCACTGTTTTGGG + Intronic
1114484555 14:23055137-23055159 CTTTGATGATGAACTCTGATGGG + Exonic
1114810263 14:25890926-25890948 TTTTGTTTCTCAACTCTGTTTGG + Intergenic
1120826004 14:88956166-88956188 TCTTGTTTCTGAGCTCTTTTTGG - Intergenic
1123905169 15:24913726-24913748 TTTTGTTAAAGGGGTCTGTTTGG - Intronic
1124142006 15:27085674-27085696 TTTTGTTTATGAACTATGATAGG + Intronic
1124873100 15:33563286-33563308 TTTTGGTGATGTGCTGTCTTGGG + Intronic
1126385910 15:48093174-48093196 TTTTGGAGAAGAGCTCTGTGGGG - Intergenic
1127046123 15:55027243-55027265 CATTGAAGATGAGCTCTGTTAGG - Intergenic
1128191746 15:65707232-65707254 TTTAGTTTATGAGCTCTTGTGGG - Intronic
1128368117 15:67019121-67019143 TTTTATTCATGAGATCTGTCAGG - Intergenic
1129126759 15:73448216-73448238 TTAGGTTGCTGGGCTCTGTTGGG - Intronic
1129675168 15:77629330-77629352 TCTTGATGCTGACCTCTGTTTGG - Intronic
1130118938 15:81030060-81030082 TGTTCTTCCTGAGCTCTGTTTGG - Intronic
1135459129 16:22626413-22626435 TTTTGTTGATAAGGGCTGTGGGG - Intergenic
1142723415 17:1793299-1793321 TTTTGTTTATGAGGTTTTTTTGG + Intronic
1143161561 17:4875129-4875151 TTCTGTTGGGGAGCTCTGTAGGG + Intronic
1144529164 17:16019439-16019461 TTATGTTGATGAGATTTATTGGG + Intronic
1146072457 17:29695816-29695838 ACTTGTTGGTGAGATCTGTTAGG + Intronic
1147533224 17:41299610-41299632 GTTTGTTGATGTGTTCTGTGAGG - Intergenic
1150554343 17:66240291-66240313 TTTTTCTGATGAGCTCAGGTTGG + Intronic
1150920095 17:69473812-69473834 TGTTATTGATCAGATCTGTTTGG + Intronic
1155831291 18:30517490-30517512 TTTTGTTAATGAACTCTTCTTGG + Intergenic
1155924891 18:31645049-31645071 TTTTGTTGTTCTGTTCTGTTTGG - Intronic
1156686663 18:39657287-39657309 TTTTGTTTATGACATCTTTTGGG + Intergenic
1158516158 18:58131652-58131674 TGATGGTGTTGAGCTCTGTTGGG + Intronic
1160358634 18:78250780-78250802 TTTTGTAGATGAGCTCACTGGGG - Intergenic
1164210337 19:23092893-23092915 TTTTTTTGTTGTACTCTGTTGGG + Intronic
1164416630 19:28051077-28051099 TTAGCTTGTTGAGCTCTGTTGGG - Intergenic
924994365 2:343430-343452 TTTTGTTGCTGATTTCTGTCTGG - Intergenic
928239062 2:29570808-29570830 CTTTGCTGATGAGCCCTGGTTGG - Intronic
928909110 2:36400747-36400769 TTTTGTTGATAAGCTCTAGAAGG + Intronic
929186907 2:39105076-39105098 TTTTGTTTAAGAGCTTTGCTAGG - Intronic
930148992 2:48039043-48039065 TTTTGTTGTTGAGCCCATTTAGG + Intergenic
933130433 2:78665966-78665988 CTTTGCTCATGAGCTTTGTTTGG - Intergenic
933379436 2:81524203-81524225 TTTTGCTAATGACCTCTGTGTGG + Intergenic
935268765 2:101415998-101416020 TGTTGCTGAAGAGCACTGTTGGG + Intronic
936082330 2:109441037-109441059 TGTTGTTTTTGAGCTCTGTTGGG - Intronic
937260177 2:120580463-120580485 AGTTGTTGATGATCTCTTTTAGG + Intergenic
937807485 2:126162681-126162703 CTTTGCTTATGAGCTCAGTTTGG - Intergenic
938485778 2:131706350-131706372 ATGTGGTGATGAGCTCTTTTGGG - Intergenic
940394958 2:153178104-153178126 ATCTGTTGATGGACTCTGTTTGG + Intergenic
940907161 2:159179708-159179730 CTTTGTGGATGAGCTCTGTGTGG + Intronic
942670961 2:178376224-178376246 GCTTGTTGATGAACTCTTTTGGG - Intronic
943955332 2:194181389-194181411 TTTTGTTGATGAGCTGGGCGTGG + Intergenic
945372676 2:209038806-209038828 TTCTTTTGATAAGCACTGTTTGG - Intergenic
945801517 2:214437460-214437482 CTTTGTTGATGCGCTATCTTGGG - Intronic
946022423 2:216650232-216650254 TTCTGATGAAGAGCTATGTTTGG + Intronic
947698149 2:232210218-232210240 TTTTGCATATGTGCTCTGTTAGG - Intronic
948320779 2:237067251-237067273 TTTTGTAGAAGAGGTTTGTTGGG + Intergenic
948850915 2:240704898-240704920 TTTCTTTGATGAGGTTTGTTTGG + Intergenic
948850919 2:240704949-240704971 TTTCTTTGATGAGGTTTGTTTGG + Intergenic
1169135506 20:3194835-3194857 TGTAGTTGATGAACTCTGTCAGG + Exonic
1169732784 20:8804253-8804275 TTTTGTTGCTGTGCTCTTTCAGG + Intronic
1173135095 20:40432391-40432413 TTTTGTTCCTGTGCTCAGTTTGG - Intergenic
1175196926 20:57250675-57250697 TTTTATTGATGTGCTTTTTTTGG + Intronic
1176308754 21:5138565-5138587 TTTTTTTAATGAGAGCTGTTGGG - Intronic
1177518978 21:22192911-22192933 TTCTGTTGATGAGATCTCTCTGG + Intergenic
1178121800 21:29476785-29476807 TTTTGTGGTTGAGCCCTCTTTGG + Intronic
1179848305 21:44123467-44123489 TTTTTTTAATGAGAGCTGTTGGG + Intronic
1182141110 22:27959257-27959279 TCTTGTTTTTGAGATCTGTTCGG + Intergenic
1183167772 22:36160572-36160594 TTTTGTAGATGAGCTCAGAGAGG - Intronic
1184681184 22:46072982-46073004 TTTTTTTGGTGAGATGTGTTTGG + Intronic
949349410 3:3110367-3110389 TTTTGTTTATGTGCCTTGTTTGG + Exonic
949427253 3:3931145-3931167 TTTTCTTAATCAGCTTTGTTAGG - Intronic
950001169 3:9657455-9657477 ATTTGTTGAGTACCTCTGTTTGG + Intronic
950235151 3:11313138-11313160 ATTTGATCATGAGTTCTGTTGGG + Intronic
950885615 3:16359962-16359984 TTTTGTTTATGGGGTCTCTTGGG - Intronic
950943856 3:16923973-16923995 ATTTGTTGATCTTCTCTGTTTGG + Intronic
954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG + Intronic
956929893 3:74031055-74031077 TTTTGTTGATTACACCTGTTTGG + Intergenic
957959515 3:87231248-87231270 ATATGATGATGAGTTCTGTTTGG - Intronic
959650837 3:108749297-108749319 TCTAGTTGGTGAGCTCTGTAAGG + Intronic
960425527 3:117502345-117502367 TTTTGTTGTTAAACTGTGTTTGG + Intergenic
961020299 3:123499994-123500016 TTTTCTTGTTGAGCACTGATTGG - Intronic
961400387 3:126637385-126637407 TTTTGTTTATCAGTTCTATTTGG + Intronic
961708522 3:128808644-128808666 TTTTGATGTACAGCTCTGTTAGG + Intronic
963167593 3:142221202-142221224 TTTTTTTGATGAGCTCACTGGGG - Intronic
964054937 3:152442712-152442734 TTTTATTGATGATGTCTATTAGG + Intronic
965157043 3:165074518-165074540 TTTTGCTGCAGACCTCTGTTGGG + Exonic
965922755 3:173938960-173938982 TTGTGTTGACAAGCTCGGTTTGG - Intronic
967136584 3:186517573-186517595 TTTCCTTGATTATCTCTGTTGGG - Intergenic
967616904 3:191580835-191580857 ATTTTTTGATTAGCTCTGCTTGG + Intergenic
967703377 3:192620665-192620687 TTTTCTTTATGAGGTCTATTTGG + Intronic
972019177 4:34287846-34287868 TTTCTTTCATGAGCTCTTTTTGG + Intergenic
973085258 4:46051261-46051283 TTTTCTTGGTGAGCAATGTTAGG + Intronic
973087389 4:46082611-46082633 TGGTGTTGATTAGCTTTGTTAGG - Intronic
974324728 4:60398778-60398800 TTTTGTGCTTCAGCTCTGTTTGG - Intergenic
974491637 4:62571836-62571858 TTAGTTTGCTGAGCTCTGTTGGG + Intergenic
974859932 4:67507802-67507824 TTTTGTTGAGGGGTTCTGATCGG - Intronic
975272550 4:72452870-72452892 TTTAGTTGATGATCTCTGAAGGG + Intronic
975395993 4:73873973-73873995 GCTTGTTGTTGAGCTTTGTTAGG + Intergenic
975861630 4:78683433-78683455 TTTTATTGATGAGCTCTTGGAGG - Intergenic
976005814 4:80429077-80429099 TTTTCTTGATGAGCTTTCTCTGG + Intronic
976868382 4:89759282-89759304 TTTTTTGGAAGAGCTCTCTTAGG - Intronic
978875414 4:113635013-113635035 TTTTGTTGATAACCTCTCATAGG - Intronic
978998711 4:115189343-115189365 TTTTGTTGAAGAGCAGTTTTAGG + Intergenic
980115337 4:128673499-128673521 TTTTGTTGCTGCTCACTGTTTGG + Intergenic
980339951 4:131532081-131532103 TTTTCTTGCTGACTTCTGTTTGG - Intergenic
980573164 4:134649939-134649961 TTTTGTTGATGTAATCTTTTAGG - Intergenic
980856984 4:138452382-138452404 TTGTGTGGATGTTCTCTGTTGGG - Intergenic
981231754 4:142364770-142364792 GTTTGTTGGAGGGCTCTGTTGGG - Intronic
981946747 4:150354726-150354748 TTTTTTTAATGAGATCTATTAGG + Intronic
982041505 4:151401802-151401824 TTTAGTTGATGTCCTCTGTTAGG - Intergenic
982095638 4:151919703-151919725 TTTTCTTGATTTACTCTGTTGGG + Intergenic
983964834 4:173797457-173797479 CTTTGCTGATGATCTCTGATTGG + Intergenic
984013930 4:174403875-174403897 TTTTGTTACTGAGATCTTTTGGG - Intergenic
984266213 4:177500261-177500283 TTTTGTTGCTGCTCACTGTTTGG + Intergenic
986062088 5:4201451-4201473 TTTTGATGATGAGAGCTGATTGG + Intergenic
986581647 5:9272082-9272104 TTAGGTTGCTGAGCTCTGTGGGG - Intronic
986812691 5:11376926-11376948 TTTTGAGAATGAGCTCTGTCTGG - Intronic
987072146 5:14347864-14347886 ATTTGGTGCTGAGATCTGTTGGG - Intronic
987724291 5:21677902-21677924 TTTTATTGATATTCTCTGTTTGG + Intergenic
987900178 5:24000815-24000837 TATTGGTGATGAGCTCTATATGG - Intronic
988299257 5:29402137-29402159 TTTTGTAGATGACCTTTGTCAGG - Intergenic
988346962 5:30049286-30049308 TTTCTTTGATGAACTCAGTTTGG + Intergenic
988642527 5:33057045-33057067 CTTTGTCAATGAGCTCTGTTTGG + Intergenic
991273243 5:64811717-64811739 TTTTGCTCAGGAGTTCTGTTAGG + Intronic
991326900 5:65443827-65443849 CTTTGTTGATGCGCTTTGTCTGG - Intronic
996397776 5:123031009-123031031 TTTTGCTGAAGAGTTATGTTGGG - Intronic
996471907 5:123871130-123871152 TTTTCTTGATGAGCTGTGGCAGG - Intergenic
996622413 5:125523705-125523727 TTTTGTTGATGACATGTTTTAGG - Intergenic
1001359292 5:171064964-171064986 TTTTGTTAATGAGTTTTCTTTGG + Intronic
1001867523 5:175118127-175118149 TTTTCCTGATGCCCTCTGTTAGG + Intergenic
1002333565 5:178462266-178462288 TTTTGTTTAAAAGCTGTGTTGGG - Intronic
1003713519 6:8619735-8619757 TTAGGTTGCTGGGCTCTGTTGGG + Intergenic
1005839790 6:29736027-29736049 TTTTATTGATGTTCTCTATTTGG + Intronic
1005926085 6:30446940-30446962 GCTTGTTGATGAACTCTGTTGGG + Intergenic
1006704487 6:36006989-36007011 TTTTGTTGATGTCCTTTATTAGG - Intronic
1007544732 6:42684941-42684963 TTTTGTTGTTGTTCTTTGTTTGG + Intronic
1010060837 6:71620775-71620797 TTGTATTGTTAAGCTCTGTTTGG + Intergenic
1010075767 6:71795867-71795889 TTCTGTAGATGAGCTCTCTGTGG + Intergenic
1010103208 6:72135194-72135216 TTTTATTAATGAACTCTTTTGGG - Intronic
1011392659 6:86871207-86871229 TTTTGTTGATGATTTTTGTGTGG - Intergenic
1011801051 6:91016735-91016757 CTTGGTTGATGTGCTCTGTTTGG - Intergenic
1011807830 6:91092795-91092817 TCATGTTGATGAGCTTTTTTGGG + Intergenic
1012500683 6:99884853-99884875 CTTTGTTGATGTCCTCAGTTTGG + Intergenic
1015765576 6:136712462-136712484 TTGTGTTAAGAAGCTCTGTTAGG - Intronic
1017561463 6:155632846-155632868 TTTAGTTCATGAGCAGTGTTTGG - Intergenic
1019230500 6:170557211-170557233 TTTTGTTGAGAAGTTCTATTAGG + Intronic
1020315284 7:6901367-6901389 TTGTGTTAATCAGCTCAGTTAGG - Intergenic
1021254089 7:18368449-18368471 TTCTGTTTCTGAACTCTGTTTGG + Intronic
1022270031 7:28797932-28797954 TTTTGTGGATCAACTGTGTTTGG + Intronic
1022518961 7:30993620-30993642 TCTTGTTGCTGTTCTCTGTTTGG - Intergenic
1023653055 7:42390632-42390654 CTCTGTTGGTCAGCTCTGTTGGG + Intergenic
1024457350 7:49624742-49624764 TATTGTTAATGAGCTCTCCTTGG + Intergenic
1024762459 7:52616020-52616042 TTATAATGATGAGCTATGTTTGG - Intergenic
1025739963 7:64186570-64186592 TTTTGTTGACGAGGACTGTGAGG - Intronic
1027689664 7:81328032-81328054 CTTTGTACATGAGGTCTGTTGGG + Intergenic
1027936160 7:84605484-84605506 TTTTGATGAGGAGATGTGTTAGG + Intergenic
1028005094 7:85555858-85555880 TTGTGTTGTTGAGCTGTTTTAGG + Intergenic
1028873560 7:95795186-95795208 TTTTGTTTAAGAGCTTTCTTTGG + Intronic
1029171120 7:98629582-98629604 TTTTCTTGAGGAGTTCTGTAGGG - Exonic
1029340805 7:99942998-99943020 TTTTGTTGATTAGGTCAATTTGG - Intergenic
1032555211 7:132825751-132825773 TCTTGTTCAAGAGCTCTGCTTGG + Intronic
1035062731 7:156081161-156081183 TGTTGGTGATGAACCCTGTTTGG + Intergenic
1035388002 7:158487506-158487528 TTTTATTAATAACCTCTGTTGGG + Intronic
1038424812 8:27458326-27458348 TCTTGTTGATGAGCTCTGCCAGG - Exonic
1040532281 8:48275605-48275627 TATTATTGTTGAGTTCTGTTAGG + Intergenic
1040583214 8:48714484-48714506 TTTTGTTGTTGACATCTTTTAGG + Intronic
1042571490 8:70170271-70170293 TTTTGTTCATCAGCTCTTCTTGG + Exonic
1042757401 8:72230856-72230878 TTATGTTAATAAGTTCTGTTAGG + Intergenic
1042822241 8:72942805-72942827 TTTTGTTGTTGTGCTGTTTTGGG - Intergenic
1044527923 8:93273219-93273241 TTTTTTTAATGAGCTCAGTGAGG - Intergenic
1045138527 8:99251295-99251317 TTTTGTAGATGATCTTTCTTAGG + Intronic
1046030858 8:108782558-108782580 TTATGTGGATGAGCTCTCATGGG - Intronic
1047611475 8:126524982-126525004 TTTTATTGATAATCTCTATTTGG - Intergenic
1049099455 8:140568711-140568733 TTTTGGTGCTGAGGTCTTTTGGG - Intronic
1049108971 8:140631120-140631142 TTTTGTTGAGGGGGGCTGTTTGG - Intronic
1052444094 9:28537168-28537190 TTCTGATGTTGAGGTCTGTTTGG - Intronic
1055684100 9:78752125-78752147 GTGTCTTGGTGAGCTCTGTTTGG + Intergenic
1057172535 9:92971751-92971773 TTTTCTTGATCAGCCCTGTGAGG + Intronic
1059900025 9:118913796-118913818 GTTTGGTGATTAGCACTGTTTGG - Intergenic
1059916623 9:119110413-119110435 TTCTTTTGATGAGCTCTCTGAGG + Intergenic
1060028590 9:120194085-120194107 TTTTGCTGATAACCACTGTTTGG - Intergenic
1061174859 9:128988914-128988936 TTTTGTTGTTTTGTTCTGTTTGG + Intronic
1061694395 9:132360867-132360889 ATTTTTTGAGGGGCTCTGTTAGG + Intergenic
1187198293 X:17109445-17109467 TTTTATTGATGAGTTCTTATAGG + Intronic
1188964217 X:36530927-36530949 TTTTGTTAATGAACTCTTATAGG - Intergenic
1190587048 X:51955979-51956001 TTTTGTTGAAGATTTTTGTTAGG - Intergenic
1190834444 X:54087372-54087394 TTTTGTAAAGGAGCTGTGTTTGG - Intronic
1191072642 X:56418405-56418427 TTTGGTTGAGGACCACTGTTGGG - Intergenic
1191707403 X:64108559-64108581 TTTTGTAGATGTCCTCTGTCAGG + Intergenic
1192723277 X:73722950-73722972 TTTTGTTTTTCAGCTCTGTCAGG + Intergenic
1192788707 X:74358628-74358650 GTTTGTTGATGAGCAATGTTAGG - Intergenic
1193966218 X:87989704-87989726 TCTTGTGAATGAGCACTGTTTGG - Intergenic
1194635483 X:96341573-96341595 TTTTGTTTTTCAGCTCTGTTAGG + Intergenic
1195104753 X:101593372-101593394 TTTTGTTGAGCAGCTGTGCTGGG + Intergenic
1196273490 X:113739555-113739577 TTTTGCTGATGACATCTGTGAGG + Intergenic
1196635418 X:117996430-117996452 TTTTGTTGTTGAGGTCAGTATGG - Intronic
1197450766 X:126613794-126613816 TTTTCTTGATGATTTATGTTTGG - Intergenic
1198021491 X:132662911-132662933 TGATTCTGATGAGCTCTGTTTGG - Intronic
1199392427 X:147296620-147296642 TTCTGATGACGAGCTCTCTTTGG + Intergenic