ID: 924689944

View in Genome Browser
Species Human (GRCh38)
Location 1:246337773-246337795
Sequence AGGTTTTAACAGAGGGGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924689944_924689950 17 Left 924689944 1:246337773-246337795 CCATAACCCCTCTGTTAAAACCT No data
Right 924689950 1:246337813-246337835 AGCCTCCTGATAGCTTACCAGGG 0: 1
1: 0
2: 0
3: 7
4: 96
924689944_924689949 16 Left 924689944 1:246337773-246337795 CCATAACCCCTCTGTTAAAACCT No data
Right 924689949 1:246337812-246337834 CAGCCTCCTGATAGCTTACCAGG 0: 1
1: 0
2: 0
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924689944 Original CRISPR AGGTTTTAACAGAGGGGTTA TGG (reversed) Intronic
No off target data available for this crispr