ID: 924690935

View in Genome Browser
Species Human (GRCh38)
Location 1:246349494-246349516
Sequence ATTTGAGGAGGTGCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 431}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924690928_924690935 11 Left 924690928 1:246349460-246349482 CCAGGCATGGTAGTGCACGCCTG 0: 54
1: 1602
2: 11832
3: 42291
4: 118014
Right 924690935 1:246349494-246349516 ATTTGAGGAGGTGCTGAGGAAGG 0: 1
1: 0
2: 1
3: 31
4: 431
924690929_924690935 -8 Left 924690929 1:246349479-246349501 CCTGTAGTCCCAGCTATTTGAGG 0: 9
1: 362
2: 5970
3: 63460
4: 212232
Right 924690935 1:246349494-246349516 ATTTGAGGAGGTGCTGAGGAAGG 0: 1
1: 0
2: 1
3: 31
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924690935 Original CRISPR ATTTGAGGAGGTGCTGAGGA AGG Intronic