ID: 924698057

View in Genome Browser
Species Human (GRCh38)
Location 1:246420336-246420358
Sequence CTGCTCCTACAGCTTGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924698053_924698057 -8 Left 924698053 1:246420321-246420343 CCATCATGCAAGAGACTGCTCCT 0: 1
1: 0
2: 1
3: 8
4: 126
Right 924698057 1:246420336-246420358 CTGCTCCTACAGCTTGGGGTTGG 0: 1
1: 0
2: 0
3: 30
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924698057 Original CRISPR CTGCTCCTACAGCTTGGGGT TGG Intronic
900993874 1:6109979-6110001 CTGCTCCAGCAGCTGGGGGCGGG + Exonic
901953631 1:12768910-12768932 CAGCTCCCAGAGCCTGGGGTTGG - Intergenic
902321674 1:15672052-15672074 CTGTGTCTACAGCTTGGGGGAGG + Intergenic
902469500 1:16638647-16638669 CTGCTCCTACAGCTCAGGGCTGG - Intergenic
903167814 1:21533284-21533306 GTGCTCCTACACTTTGAGGTAGG - Intronic
903646201 1:24897691-24897713 CAGCCCCCACAGCTTGAGGTTGG - Intergenic
904751566 1:32743732-32743754 CTGCTCCAACAGCCTGGGTTTGG + Intronic
905950309 1:41945299-41945321 CTCCTCCCACAGCTTGGAGGGGG - Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
906518555 1:46453754-46453776 GAGTTCCTACAGCTGGGGGTGGG + Intergenic
907316018 1:53573203-53573225 CTGCTCCCACACTTTGGGGATGG + Intronic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
909981391 1:82105709-82105731 CTGGTCCTCCAGCTTGTGGATGG - Intergenic
910590954 1:88927661-88927683 CTCCTCCTACTGCTTGGAGGGGG - Intergenic
911706568 1:101020593-101020615 CTGCTGCTAGAGCTTGGGATGGG - Intronic
911822339 1:102437675-102437697 GTGGTCCTACTTCTTGGGGTTGG - Intergenic
912947213 1:114095422-114095444 CAGCGGCTACAGCTGGGGGTGGG - Intronic
913370746 1:118096292-118096314 CTGTTTCTACAGCTGAGGGTAGG - Intronic
915092175 1:153434299-153434321 CTGCTCCTACATAATGGGGTAGG + Intergenic
915602449 1:156930713-156930735 CTGCTGCCACAGCATGGGGCTGG - Intronic
915768853 1:158396766-158396788 CTGCCCCTACAAGTTGGGGTGGG - Intergenic
917789708 1:178491824-178491846 CTGCTCATCCATCTAGGGGTGGG - Intergenic
918334009 1:183489418-183489440 TAGGTCCTACAGCTTGGGCTGGG + Intronic
918518793 1:185391733-185391755 CTGCTCCTACTGCCTGGAGGAGG - Intergenic
919835135 1:201568183-201568205 CTGCTCCTCCAGCTTGGTGATGG + Intergenic
919844844 1:201635549-201635571 CTGCTCCTGCTCCTTAGGGTGGG - Intronic
920030492 1:203034706-203034728 CTCCTCCTCCAGCCTGGGGAAGG - Intronic
923678819 1:236102673-236102695 CTGCCCCGGCAGCCTGGGGTGGG + Intergenic
924698057 1:246420336-246420358 CTGCTCCTACAGCTTGGGGTTGG + Intronic
1066298253 10:34074979-34075001 CTGCTCCTGCAGCTAGGAGTGGG + Intergenic
1070665960 10:78343623-78343645 CTGCTCCTACAGCACGGTTTGGG - Intergenic
1072356248 10:94614538-94614560 CTGCTCCTGAAGCTGGAGGTGGG - Intergenic
1072717647 10:97762304-97762326 CAGCTCCCACAGCCTGGCGTGGG + Intergenic
1072796737 10:98361725-98361747 CTTCTCTGACAGCCTGGGGTCGG + Intergenic
1075473814 10:122715716-122715738 CTCCTCCTAGAGGTTGGGGAGGG + Intergenic
1076790695 10:132775286-132775308 CTGCGCCTACAGCGTGGGAGCGG - Intronic
1076995430 11:295326-295348 CCTCTGCTACAGCGTGGGGTGGG + Exonic
1077108317 11:851336-851358 CAGCTCCTGCAGCTGGGAGTCGG + Intronic
1077514701 11:2994469-2994491 CTGCTCCTGGATGTTGGGGTTGG + Intergenic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1078141919 11:8699225-8699247 CAGCTCCTTCAGTTTGGGGAGGG + Exonic
1078333818 11:10448207-10448229 GTGCTGCTACTGCTTGGGGTTGG - Intronic
1078405220 11:11064946-11064968 GTGGTCCTCCAGCTTGGGGCTGG + Intergenic
1081579762 11:44344277-44344299 CTGCCCCTTCAGCTTTGAGTAGG + Intergenic
1083950639 11:65953713-65953735 CAGCTCCTCCAGCTTGCGCTGGG - Exonic
1084185079 11:67467311-67467333 CTGCTCCTGCTGCTGGGGCTGGG - Exonic
1084570573 11:69957166-69957188 CTGCCCCTGCAGGCTGGGGTGGG - Intergenic
1085324338 11:75595138-75595160 CTGCTCGCACTGCCTGGGGTGGG + Intronic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1091335309 11:134762112-134762134 CTGCTCCCACAGCTGGGGAGTGG - Intergenic
1091389544 12:117679-117701 CTGCTCCTAAAGGTGTGGGTGGG - Intronic
1091710794 12:2738574-2738596 CTGCTATTGCAGCTGGGGGTGGG + Intergenic
1093337287 12:17921392-17921414 CCCCTCCTACAGCTGGGTGTTGG - Intergenic
1096497365 12:52046148-52046170 CTGCCCCTCCACCTTGGGCTGGG - Intronic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098071993 12:66685635-66685657 CTGCTCCTTATGGTTGGGGTTGG - Intronic
1101522347 12:105495579-105495601 CTGCTCCTTGAACTTGGGTTTGG - Intergenic
1101909967 12:108854009-108854031 CTTCTCCTTCAGTGTGGGGTAGG - Intronic
1103988295 12:124781448-124781470 CAGGCCCTACAACTTGGGGTTGG - Intronic
1105987994 13:25588539-25588561 CTGTTCCTACAGCCAGGGGGAGG - Intronic
1111823617 13:93242994-93243016 CTGCTACTACAGGTTGGGACCGG + Intronic
1113892556 13:113744022-113744044 CCCCTCCTGGAGCTTGGGGTGGG + Intergenic
1115409212 14:33053410-33053432 CTCATCATACAGCTTGAGGTAGG - Intronic
1115814932 14:37153504-37153526 GTGCTCCTACAGCTGGGGTGGGG + Intronic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1118374356 14:65163719-65163741 CAGCTCCTACAGCTTGTGAGAGG + Intergenic
1120185886 14:81393472-81393494 CTGCTCCAAGACCTTGGGGCCGG + Intronic
1120926802 14:89805256-89805278 CCACTTCTAGAGCTTGGGGTGGG - Intronic
1121128178 14:91421576-91421598 TTGTTACTACAACTTGGGGTGGG + Intergenic
1122023694 14:98859450-98859472 AAGCTCCCACAGCTTGGGGCTGG - Intergenic
1122771391 14:104099461-104099483 CTGCTCCTACAGCCAGGGCCAGG - Intronic
1123012481 14:105356107-105356129 CTGCTCCTGGGGCTTGGGGCTGG + Intronic
1123025345 14:105421286-105421308 CTGCTCCCTGAGCGTGGGGTGGG - Intronic
1123995786 15:25716886-25716908 CTTCTCCAGCAGCTTTGGGTCGG + Exonic
1124090927 15:26599293-26599315 CAGCTCCTCCAGCTTGAGCTGGG + Intronic
1126277009 15:46895282-46895304 CTGCTCGTGGAGCCTGGGGTTGG + Intergenic
1127074373 15:55311370-55311392 CTCCTCCCACTGCTTGGAGTGGG + Intronic
1128283511 15:66416999-66417021 CTGCTCCTCAGCCTTGGGGTGGG - Intronic
1128551360 15:68599983-68600005 CTGTCCCTGCTGCTTGGGGTAGG + Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129095754 15:73205715-73205737 CTGTCTCTACAGTTTGGGGTGGG + Intronic
1129110260 15:73333115-73333137 CTACTCCTGCAGCTCGGAGTGGG + Intronic
1131271221 15:90948730-90948752 CAGCTCCACCATCTTGGGGTCGG - Exonic
1132404991 15:101536597-101536619 CTGCTCCCACAGCTCTGGGCTGG - Intergenic
1132856466 16:2047316-2047338 CTGCTCCCCCAGCTCGGGGGAGG - Intronic
1133966121 16:10532967-10532989 CTACTCCTACATCCTGGCGTGGG - Exonic
1134227669 16:12404016-12404038 CTCTTCCTACACCTTGGGGTTGG + Intronic
1134758715 16:16694094-16694116 GTGCTACTACAGCATGGAGTCGG + Intergenic
1134987361 16:18665077-18665099 GTGCTACTACAGCATGGAGTCGG - Intergenic
1138354818 16:56368695-56368717 CAGCTCCTAGAGCAGGGGGTTGG + Intronic
1139437366 16:66943903-66943925 CTGAACCTACAGCCTGCGGTGGG + Exonic
1141849630 16:86636530-86636552 CTCCTCCTTTAGCTGGGGGTGGG + Intergenic
1142376051 16:89707660-89707682 CTGACCCTGGAGCTTGGGGTTGG - Exonic
1142898460 17:2997215-2997237 CTGCTCACCCAGCTTGGCGTAGG - Intronic
1144592629 17:16537270-16537292 CTGCTTCTACACCATGGGGTGGG - Intergenic
1146568329 17:33932186-33932208 GAGCTCCTGCAGCCTGGGGTGGG - Intronic
1146652808 17:34616823-34616845 CTGCAGCTCCAGCCTGGGGTGGG + Intronic
1147812939 17:43186318-43186340 TTGCTCCTACAACTGGGGGTGGG - Exonic
1148029649 17:44610617-44610639 CTGGTCCCATAGCTGGGGGTGGG - Intergenic
1148154263 17:45413692-45413714 CTGCTCCTCCAGGGCGGGGTGGG + Intronic
1149274168 17:55015623-55015645 CTCCTCCCACTGCTTGGAGTGGG + Intronic
1149552440 17:57550202-57550224 CTGTTCTTAGAGCTTGGGTTTGG + Intronic
1151519306 17:74616939-74616961 CTGATCCTTCAGCCTTGGGTGGG - Intronic
1152252848 17:79220778-79220800 CTGCTGCTCCAACTTGGGGCTGG - Intronic
1152362139 17:79837643-79837665 CGGTTGCTGCAGCTTGGGGTGGG - Intronic
1152876001 17:82786535-82786557 CTGACCCAACAGCATGGGGTGGG - Intronic
1154005834 18:10526459-10526481 CTGCTCCTGAAGATTGTGGTGGG + Intronic
1156027963 18:32678088-32678110 CTTCTCCTACAGCTTCTGATAGG + Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1160583260 18:79899647-79899669 CTGCTCCTTGAGCTCGGAGTAGG - Exonic
1163372119 19:16907112-16907134 CTCCTCCTGCAGGGTGGGGTGGG + Exonic
1164478765 19:28595335-28595357 CAGATCTTACAGCTTGGGGCTGG + Intergenic
1164962183 19:32443097-32443119 CTGCACCGACAGCATGGGGTAGG - Intronic
1166745698 19:45140904-45140926 CAGCTCCTACAGGGTGGGCTTGG + Intronic
1167751069 19:51380532-51380554 CTGGTCCTACATCCTGGGCTGGG - Exonic
925315632 2:2921122-2921144 CTGAGGCTACAGCTTGGGGTGGG - Intergenic
925595898 2:5555404-5555426 CTGCCCCCACAGCCTGGGCTGGG + Intergenic
926676460 2:15626803-15626825 CTCCTCCTACAGATTGGGAAGGG + Intronic
927805125 2:26140317-26140339 CTACTCCTACATCCTGGCGTGGG - Intergenic
928553946 2:32403179-32403201 CTGCTCCTACTTCTTGGGGAGGG - Intronic
932594279 2:73084447-73084469 CTGCCCCCACCGCTTGGGGGTGG - Intronic
933548355 2:83742404-83742426 CTGCTCATGCAGCTTTGGATTGG + Intergenic
935627124 2:105180594-105180616 CTGCTTTTACAGCTGGGTGTTGG + Intergenic
936166963 2:110129210-110129232 CTGCTCCAAGAGCATGGGGAAGG + Exonic
936899658 2:117468843-117468865 GTGGTCCTACTTCTTGGGGTTGG + Intergenic
938107945 2:128546036-128546058 CTGCACCCACAGCTTGGGCGAGG + Intergenic
938192853 2:129299476-129299498 CTGCTCCCCCAGGGTGGGGTGGG - Intergenic
940983563 2:160029500-160029522 CTGCTTCCACAGCTTGAGGTGGG + Intronic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
949022901 2:241751620-241751642 CTCATCCCACAGCATGGGGTTGG - Intronic
1169341300 20:4798373-4798395 CTGCTCATTCAGCTTGAGTTTGG - Intronic
1173222889 20:41143977-41143999 CTGCTCCAACAACCTGGGCTAGG + Intronic
1173354837 20:42277501-42277523 CTGCTCCTCCAGCCTTGGTTAGG - Intronic
1176968936 21:15243695-15243717 CTGCTCCTACACCTTTGTTTTGG - Intergenic
1177173274 21:17677082-17677104 CTGCTCCAGCAGCTTCTGGTGGG - Intergenic
1178888976 21:36505371-36505393 CTCCTCCAGCAGCTTGGGGTGGG - Intronic
1180179701 21:46112438-46112460 CTGCTCCTTCAGGTTCTGGTTGG - Exonic
1181471080 22:23140319-23140341 CTCCTCCTTCAGCTTGGGCAGGG + Exonic
1184235776 22:43182325-43182347 CTCCTCCTCCAGCTGGGAGTGGG - Intronic
1184521987 22:45000081-45000103 CGGCTCCTTCCGCTTGGGGCAGG - Intronic
1185031026 22:48442963-48442985 CTGCACCTGGAGCCTGGGGTGGG + Intergenic
1185141611 22:49105663-49105685 CTGCCCTTGCAGCCTGGGGTGGG + Intergenic
950003715 3:9677691-9677713 CTGCCCCTACAGGCTGGGGAAGG - Intronic
950260926 3:11543089-11543111 CTGCTCCTGCACCGTGGGGTCGG - Intronic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
952922305 3:38294082-38294104 CTCCTCCTACTGCTTGGAGGGGG + Intronic
953759425 3:45674908-45674930 GTGCTCCTTCATCTTGGGTTGGG - Intronic
954299938 3:49695567-49695589 CTGCTCCTACAGCTCAGGGCTGG + Intronic
954332949 3:49900587-49900609 TTGTGCCTACAGCTTGGGGTGGG + Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
957206506 3:77205469-77205491 CTGCTCCTGGAGCCTGGGGTTGG + Intronic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
962070944 3:132033705-132033727 CTCCTCCTTCATCTTGGAGTAGG - Intronic
962205058 3:133427573-133427595 CTCCTCAGCCAGCTTGGGGTTGG + Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
962883556 3:139601681-139601703 CTGCTCTCACAGGATGGGGTTGG + Intronic
962932395 3:140050468-140050490 CTTCTCCTTCAGCCTGGGGATGG - Intronic
966778082 3:183560654-183560676 GTGCTCCTTCAGCATGGGGTGGG - Intergenic
966926964 3:184650860-184650882 CTGCTCCTCCAGGCAGGGGTGGG - Intronic
968295980 3:197576948-197576970 CTACTCCTCCAGCGTGGGGAGGG + Intergenic
968295997 3:197577017-197577039 CTACTCCTCCAGCTTGGGGAGGG + Intergenic
968296013 3:197577085-197577107 CTACTCCTTCAGGTTGGGGCGGG + Intergenic
968665465 4:1819407-1819429 CTGCTCCTGCAGCTTAGAGCAGG + Exonic
969656753 4:8503185-8503207 CGGCTCCTGCAGCCTGGGGAAGG - Intergenic
977359731 4:95986730-95986752 CATCTCCAACACCTTGGGGTGGG + Intergenic
978077629 4:104552837-104552859 CTCCTCCTTGAGCTTGGGCTAGG - Intergenic
980076182 4:128295523-128295545 CTCATCCTACAGTTTGGTGTTGG + Intergenic
981343589 4:143649939-143649961 CTACTCTTACAGTTTGGGTTTGG + Intronic
983178288 4:164617221-164617243 TTTCTCCTACAGCTTGGGAGAGG - Intergenic
983233663 4:165155207-165155229 CTGATCCTATGTCTTGGGGTAGG + Intronic
983409551 4:167379464-167379486 CTGGTCCTACAGATTAGGCTAGG - Intergenic
986257587 5:6113406-6113428 CTGCTGTTACAGATTGGGATTGG + Intergenic
988337113 5:29921449-29921471 CTGGTCCTACTTCTTGGGGCTGG + Intergenic
990197383 5:53334012-53334034 CTCCTACTCCAGCTTGGGATAGG - Intergenic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
992693133 5:79259411-79259433 CTGATCCTACTGACTGGGGTGGG - Intronic
993773509 5:91962308-91962330 CTGCTCGTGCAGCCTGGGGTTGG - Intergenic
994089480 5:95797095-95797117 CTCTTCCTATGGCTTGGGGTGGG + Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
1001414452 5:171534796-171534818 CTGGTCCTACTGAGTGGGGTTGG + Intergenic
1002449400 5:179310350-179310372 CTGATCCTCCAGCTTGGAGCTGG - Intronic
1002501209 5:179648853-179648875 CAGCTCCTACAGGCTGGGGTGGG + Intergenic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1003398113 6:5770416-5770438 CTGCTGCTGCTGCTGGGGGTTGG + Intronic
1006636869 6:35467551-35467573 CAGCTCCTATAGGATGGGGTGGG - Intergenic
1007176609 6:39901802-39901824 CTGCTCCTTCAGCTGCGGGCGGG - Exonic
1011444458 6:87422893-87422915 CTGCAACTACAGCTTGGGGGAGG + Intronic
1011856056 6:91692863-91692885 CTGCTGCTGCAGCTTTGGTTGGG + Intergenic
1012783137 6:103589118-103589140 CTGCTGCTAGAGATTGGGGAAGG + Intergenic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1015903505 6:138092152-138092174 CTGGGCCTACGGCTTTGGGTGGG - Exonic
1019342538 7:515407-515429 CTGCTCCTCCAGCTTGTAGGGGG - Intronic
1023843155 7:44107841-44107863 CTCCTCCTTCTGCTTGGGGGTGG - Exonic
1023908091 7:44536328-44536350 CTCCTCCCACAGCTTGGCCTGGG + Exonic
1025261905 7:57425512-57425534 CTGCTCCTTCAGCATGAGGATGG - Intergenic
1026091948 7:67307746-67307768 ATGCTTCTCAAGCTTGGGGTGGG + Intergenic
1028251181 7:88541561-88541583 GTGGTCCTACTTCTTGGGGTTGG + Intergenic
1029377378 7:100187630-100187652 ATGCTTCTCAAGCTTGGGGTGGG + Intronic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1030688521 7:112509851-112509873 CTGCTGCTATAGCTTTGTGTGGG + Intergenic
1031415610 7:121492704-121492726 CTGCTACCAGAGGTTGGGGTGGG + Intergenic
1036085294 8:5607056-5607078 CTGCCCCTACAGACTGTGGTAGG - Intergenic
1036600902 8:10259517-10259539 CTGCTCCTGTGGCTGGGGGTGGG + Intronic
1038878216 8:31576030-31576052 CAGCTCCTACAACTTTGTGTGGG - Intergenic
1040530700 8:48264208-48264230 CGGCTCCCAGTGCTTGGGGTAGG - Intergenic
1042409207 8:68443059-68443081 CTGCTTCCACAGCCTGTGGTTGG + Intronic
1045173685 8:99697473-99697495 CTGCTCCTTCAGCTTAGAGCAGG - Intronic
1046818028 8:118606929-118606951 CTGACCCTATAGCCTGGGGTTGG - Intronic
1046836311 8:118805579-118805601 CTGATCCCATAGCTTGGGCTGGG + Intergenic
1047762032 8:127961521-127961543 ATGCTCACCCAGCTTGGGGTGGG - Intergenic
1048733251 8:137468023-137468045 CTCCTCCTAGAGCTTTGGGTAGG + Intergenic
1053101013 9:35372413-35372435 CTGCCCCTAAAGCTTGGGCTTGG + Intronic
1057871745 9:98723272-98723294 CTGTCCCTCCAGCTTGGGGAAGG - Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1060929492 9:127479822-127479844 CTGCTCCTGCAGCCGGAGGTAGG - Exonic
1062131444 9:134896199-134896221 CTTCTGCCACATCTTGGGGTGGG - Intergenic
1062546232 9:137064881-137064903 CTGCTCCTTCAGCATGAGGATGG + Exonic
1186776027 X:12865538-12865560 CTTCTCCTTCAGCCTGAGGTCGG - Intergenic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189761060 X:44322060-44322082 CTGGTGATACAGCTGGGGGTGGG - Intronic
1190581928 X:51898202-51898224 CTGGACCTGCAGCTGGGGGTTGG + Intronic
1192340967 X:70263058-70263080 CTGCTCCTACTGCTTCAGGCTGG + Intergenic
1193664469 X:84299303-84299325 ATGCTACCACAGCTGGGGGTGGG - Intergenic
1198657368 X:138929399-138929421 CTGCCCCTAGATCTTGTGGTAGG - Intronic
1199736532 X:150691530-150691552 CTTCTCCTATGGATTGGGGTAGG + Intergenic
1199929478 X:152503945-152503967 CTACTCTTACAGGTTGGAGTTGG + Intergenic