ID: 924698934

View in Genome Browser
Species Human (GRCh38)
Location 1:246430298-246430320
Sequence CTCTGATGTTATCTTGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924698934_924698939 20 Left 924698934 1:246430298-246430320 CCAGCATCAAGATAACATCAGAG 0: 1
1: 0
2: 1
3: 7
4: 154
Right 924698939 1:246430341-246430363 AATGAGGATCTATTTAAGAGAGG 0: 1
1: 0
2: 0
3: 17
4: 168
924698934_924698938 4 Left 924698934 1:246430298-246430320 CCAGCATCAAGATAACATCAGAG 0: 1
1: 0
2: 1
3: 7
4: 154
Right 924698938 1:246430325-246430347 CTGGGCATCTGTAAGAAATGAGG 0: 1
1: 0
2: 2
3: 37
4: 231
924698934_924698940 24 Left 924698934 1:246430298-246430320 CCAGCATCAAGATAACATCAGAG 0: 1
1: 0
2: 1
3: 7
4: 154
Right 924698940 1:246430345-246430367 AGGATCTATTTAAGAGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924698934 Original CRISPR CTCTGATGTTATCTTGATGC TGG (reversed) Intronic
904900175 1:33851003-33851025 CACTGTTGTCATCTTGATGGGGG - Intronic
905257221 1:36692624-36692646 CTCAGATGTTATCTTGTCACAGG - Intergenic
909948806 1:81694522-81694544 ATATGATCTTATTTTGATGCTGG - Intronic
913494609 1:119416952-119416974 CTCTGTTTTTATCTTCATACAGG - Intronic
913497352 1:119440544-119440566 CTCTGTTTTTATCTTCATGCAGG - Intergenic
913508404 1:119540328-119540350 CTCTGTTTTTATCTTCATACAGG - Intergenic
913515589 1:119602904-119602926 CTCTGTTTTTATCTTTATACAGG - Intergenic
915377308 1:155408172-155408194 CTCGGATGGTACCTTGATTCTGG + Intronic
917835241 1:178936789-178936811 ATCTGCTGGTATCTTGATGTTGG - Intergenic
919548741 1:198957744-198957766 CTCTGATTTTATTTTAAAGCTGG + Intergenic
921464660 1:215472920-215472942 CAGTGATGTTATCTTGCTTCTGG + Intergenic
923101447 1:230820969-230820991 TTCTGATGTTGTTTTGAGGCAGG + Intergenic
924698934 1:246430298-246430320 CTCTGATGTTATCTTGATGCTGG - Intronic
924804234 1:247349660-247349682 ATCTGATGAGATCTTGAGGCCGG - Intergenic
1064846125 10:19655935-19655957 CTCTGATGCTGTCTAGCTGCAGG + Intronic
1068044297 10:51866435-51866457 ATCTGATGTTATAATTATGCTGG - Intronic
1071123548 10:82308729-82308751 CTCTGATTTTCTCTGGCTGCAGG + Intronic
1071709282 10:88033599-88033621 TGATAATGTTATCTTGATGCAGG - Intergenic
1072448761 10:95521965-95521987 CTCTAATTTTATCTTGTTTCTGG + Intronic
1076257652 10:129041210-129041232 CTGTGAGGTTTTCTTGCTGCTGG + Intergenic
1078963253 11:16304515-16304537 CTCTGATATTTTCTGGATACTGG - Intronic
1079515482 11:21262883-21262905 CTTTCCTGTTATTTTGATGCTGG + Intronic
1083055897 11:59819345-59819367 ATCTGCTGTTCCCTTGATGCAGG - Intergenic
1084046448 11:66571027-66571049 CTCTGTTGTAATGTTAATGCTGG - Intergenic
1084863710 11:72039438-72039460 CTTTGGTGTTATCTTGAGGTAGG - Intronic
1086272013 11:85079309-85079331 CTCTGTTTTAATGTTGATGCTGG + Intronic
1088849541 11:113693676-113693698 CTTTGATCTTCTCTTGGTGCCGG - Intronic
1089582778 11:119491896-119491918 TTCTGATGTCTGCTTGATGCTGG - Intergenic
1091757680 12:3065566-3065588 CTCTGTTTTGATGTTGATGCTGG - Intergenic
1095480220 12:42626957-42626979 CTCAGATGTTTCTTTGATGCTGG + Intergenic
1097062214 12:56293796-56293818 CTCTGATCTTTTGTTGATGAAGG - Intronic
1097708452 12:62893305-62893327 CTCTGCTGACATCTTGATGTTGG - Intronic
1102542278 12:113630067-113630089 CACTGATGATACCTTGATTCTGG - Intergenic
1102839758 12:116106204-116106226 CACTTATGGTATCTTGAAGCAGG + Intronic
1104218065 12:126754160-126754182 CTCTGTTGTGAAGTTGATGCTGG - Intergenic
1106281171 13:28272863-28272885 CTCTGACGTTATCAGGAGGCCGG - Intronic
1107642182 13:42454625-42454647 CTCTGAGGTCTTCTTAATGCGGG + Intergenic
1108148224 13:47502089-47502111 CTCTAATGTTGTCTTTATCCTGG - Intergenic
1109056683 13:57559047-57559069 CTCTGATGTAATCTGTATTCTGG - Intergenic
1110856446 13:80302277-80302299 CTTTGAAGTTTTCTTGATACAGG + Intergenic
1111572719 13:90107981-90108003 GTCTAATGTCATCTTGATGTTGG - Intergenic
1114683082 14:24503285-24503307 TTCTGATTTTGTCTTTATGCTGG - Intronic
1117966868 14:61215340-61215362 CTCTGATGCAATCTTAAGGCAGG - Intronic
1120642647 14:87033580-87033602 GTCTAATGTTATCTTGACGATGG + Intergenic
1120705795 14:87744195-87744217 CTCTGTTGTTATCTAAATGTTGG + Intergenic
1120738997 14:88086964-88086986 CTGTGATCTCATCTTGAGGCAGG - Intergenic
1121552666 14:94814143-94814165 CTCCTTTGTTCTCTTGATGCTGG + Intergenic
1122674204 14:103397154-103397176 CTCTGATTTTCTCTTGGGGCAGG + Intronic
1125316988 15:38442058-38442080 CTCAGCTGTTATGTTCATGCTGG + Intergenic
1125747344 15:42005939-42005961 CTATGAGGTTATCATGAAGCCGG + Intronic
1127851345 15:62914650-62914672 CTCTGTTTTTATGTTAATGCTGG + Intergenic
1137832290 16:51555309-51555331 CTCTGATATTGTCATGATGGAGG - Intergenic
1138341409 16:56291750-56291772 ATCTGCTGGTATCTTGATGTTGG - Intronic
1138840721 16:60501512-60501534 CTCTGATTTTACCATCATGCTGG - Intergenic
1140975874 16:80059663-80059685 CTTTGCTGTTGGCTTGATGCAGG - Intergenic
1143706665 17:8702968-8702990 CTCTGTGGTGATATTGATGCAGG + Intergenic
1146630079 17:34463421-34463443 CACTGATTTCAGCTTGATGCTGG - Intergenic
1149904777 17:60515511-60515533 CTTTGTTATTATCTGGATGCTGG - Intronic
1157072904 18:44430591-44430613 CTTTGATGTTAGCATAATGCTGG + Intergenic
1157520677 18:48343050-48343072 CAGTGCTGTTTTCTTGATGCTGG - Intronic
1158109539 18:53925689-53925711 GATTGCTGTTATCTTGATGCTGG - Intergenic
1158162870 18:54506305-54506327 CTCTGTTGTTTTCTTCATTCAGG + Intergenic
1158765052 18:60440802-60440824 CACTGATGGCATCTTGATTCTGG - Intergenic
1158902031 18:61972967-61972989 CTCTGATGTCAACTTGATCTTGG - Intergenic
1164446794 19:28324514-28324536 CTCTGTTTTAATGTTGATGCTGG - Intergenic
1165527763 19:36370481-36370503 CTCTGATGTCAGCCTGATGGTGG - Intronic
1167491844 19:49797301-49797323 CTCTGTACTTATCTGGATGCTGG - Intronic
925073815 2:993592-993614 CTCTGATGTGATCATAATACTGG + Intronic
925503306 2:4531251-4531273 CTCTGAAGTTATTTTTATGTTGG + Intergenic
925763490 2:7209008-7209030 ATCTGATGCTATCCTGATGCTGG - Intergenic
928280600 2:29943023-29943045 TTCTGATGTTATTATGGTGCTGG + Intergenic
928946813 2:36779037-36779059 CTGTGGTGTGATCTTGGTGCTGG - Intronic
930459824 2:51659125-51659147 TTTTGATGTCATCTTGAGGCTGG + Intergenic
931790991 2:65664121-65664143 CTCTGGTGGAATCCTGATGCTGG + Intergenic
931926087 2:67074105-67074127 CTCTGGTCTTATCTTGGTCCAGG + Intergenic
932506717 2:72240537-72240559 CTCTGAAGTTCTCTTGAGCCCGG + Intronic
933308532 2:80632078-80632100 CTCTTATGTTTCCTTGGTGCAGG - Intronic
933432368 2:82199398-82199420 CTCTGTTTTTATGTTAATGCTGG - Intergenic
939920822 2:148110714-148110736 CTCTCATCTTATTTGGATGCTGG + Intronic
940026110 2:149210292-149210314 CTCTGATGTTTTCTTGGTGGTGG - Intronic
941498018 2:166231452-166231474 CTCTAATGTTCACTTGAGGCTGG + Intronic
941529944 2:166655782-166655804 CTCTGTTTTAATGTTGATGCTGG + Intergenic
945797087 2:214378466-214378488 CACTGATGTTATCCTGAAACTGG + Intronic
945836263 2:214839108-214839130 CTCTGGTGTTATCTCTAGGCTGG + Intergenic
947112455 2:226733471-226733493 CTTTGATGATATCTTCATTCTGG - Exonic
1169608569 20:7352300-7352322 CTCTGAGGTAATCTTGAGCCAGG + Intergenic
1173647214 20:44640953-44640975 CTCTGATGATATCTTGATGTTGG + Intronic
1175224198 20:57435393-57435415 CTCGAATATTATCTTGAGGCGGG + Intergenic
1177185962 21:17796588-17796610 CTCTGCTGTAATGTGGATGCTGG + Exonic
1178891569 21:36524831-36524853 CTCTGATGTCACCTGGGTGCAGG - Intronic
1184091916 22:42297433-42297455 CTCTGATGAGTTCTTGTTGCTGG - Intronic
1184304802 22:43590192-43590214 CTTTGCTGATATCTTGATGGCGG + Exonic
952208152 3:31201140-31201162 CTCTGATGGTATTTTGAAGAAGG - Intergenic
952257133 3:31705253-31705275 CTCTGATATTTACTTGAGGCTGG - Intronic
953855472 3:46496565-46496587 CTCTGTTTTAACCTTGATGCTGG + Intergenic
955681931 3:61511183-61511205 CTCTGATTTTATAGTGATGATGG - Intergenic
956057456 3:65315440-65315462 ATCTGCTGTTATCTTGATCTTGG - Intergenic
956417813 3:69051886-69051908 GGCTGCTGTTCTCTTGATGCAGG - Intronic
957039353 3:75325538-75325560 CTGTTATGTTATGTTGAGGCAGG - Intergenic
957922768 3:86768122-86768144 CTGTGATGCTGTCTTGTTGCAGG - Intergenic
959227436 3:103603544-103603566 CTCAGAGGTCATTTTGATGCTGG - Intergenic
962251634 3:133839537-133839559 CAGTGATGTTATCATCATGCTGG - Exonic
964087842 3:152838458-152838480 CTCTGATGTTGACTTTATGAGGG - Intergenic
971540677 4:27812605-27812627 CTCAGATGAGATCTTAATGCTGG - Intergenic
972191121 4:36592393-36592415 CTCTGATGATATAATGATGATGG - Intergenic
974096766 4:57372609-57372631 CACTGATGTTGACTTAATGCCGG + Intergenic
975187044 4:71415810-71415832 CACTGATGCTTTCTTGATTCAGG + Intronic
975503503 4:75113520-75113542 CTTTGATGTCATGATGATGCTGG - Intergenic
975755060 4:77563517-77563539 CTCTTCTGCTATCTTAATGCTGG - Intronic
975804136 4:78095412-78095434 CTATTATGTTATCTTGGTTCTGG + Intronic
976517950 4:85993253-85993275 TGCTGATGTTATCTGGAAGCTGG + Intronic
978735749 4:112082514-112082536 TTCTGATCTTATTTTGATGTAGG - Intergenic
980846029 4:138326244-138326266 CTCTGTTGTTTTCTTGGTGAGGG + Intergenic
982787941 4:159558203-159558225 CTCTGTTTTTATGTTAATGCTGG + Intergenic
982867805 4:160540145-160540167 CTCTGTTTTGATCTTAATGCTGG - Intergenic
984469486 4:180148876-180148898 CTCTCATGTGATCTTTATTCTGG + Intergenic
985083701 4:186292350-186292372 CTCTGATGCTTTCATGAGGCAGG - Intergenic
985967900 5:3351669-3351691 CTCTGCTGTTCTCTTCCTGCAGG + Intergenic
990161575 5:52946175-52946197 CACTGATCTTATCTAGATTCCGG + Intronic
990640222 5:57775182-57775204 CTCAGATGTTATTTTGATGATGG - Intergenic
991300083 5:65121520-65121542 CACTGATGGTATCTTCTTGCTGG + Intergenic
997232619 5:132255591-132255613 CTCTGATGTTCTCTTAAGTCAGG + Intronic
1000785591 5:165539258-165539280 CTCTGCTGTTATCTTGATCTTGG - Intergenic
1001492957 5:172168581-172168603 CTCTTATGGTCTCTTGCTGCAGG + Intronic
1001800172 5:174536344-174536366 CTCTGATGTTAGGGTAATGCTGG - Intergenic
1005406663 6:25496522-25496544 GTCTGATGTTATATTATTGCAGG + Intronic
1013238624 6:108222297-108222319 CTCTGATGTCATTCTGAGGCAGG + Intronic
1013285165 6:108675073-108675095 CTCTGACTTTATGTTGAGGCAGG - Intronic
1014032581 6:116722974-116722996 CACTGATGCTATCCTCATGCTGG - Intronic
1015954876 6:138589119-138589141 CTCAGATGTTAGTTGGATGCAGG - Intronic
1016022533 6:139251032-139251054 TTCTTATGTTTTCTTGTTGCTGG + Intronic
1017022006 6:150147584-150147606 TACAGATGTTATCTTGATGCTGG - Intronic
1019021571 6:168923090-168923112 CTCTGATGTTTTATTGTTGCGGG + Intergenic
1019068494 6:169322579-169322601 CTCTGTTTTTATGTTAATGCTGG + Intergenic
1020381421 7:7551707-7551729 ATCTGAAGTTCTCTTAATGCTGG + Intergenic
1021604159 7:22393765-22393787 TTCTGATTTTCTCTTGATGGTGG - Intergenic
1025005901 7:55354531-55354553 CTCTGTTTTTATGTTAATGCTGG - Intergenic
1025137030 7:56426602-56426624 CTCTTATGTTTTCTGGATGAAGG - Intergenic
1030457101 7:109789875-109789897 CTCTGATATGATCTTAATACTGG + Intergenic
1031957176 7:127954438-127954460 CTCCGATGGTCTCTTGAAGCAGG + Intronic
1035570102 8:667074-667096 CTGGGCTGTTATCTTGAGGCTGG - Intronic
1039607918 8:38898400-38898422 CTCTCATGTCACCTTGAAGCAGG - Intergenic
1042835181 8:73073061-73073083 CTCTGTTGTCATCTTGAGGAAGG + Intronic
1043859934 8:85304247-85304269 TTCAGATGCTATCTTTATGCTGG - Intergenic
1047566251 8:126047127-126047149 CTGTGAAGAGATCTTGATGCAGG - Intergenic
1048831783 8:138484540-138484562 CTTTTATGTCATCTTCATGCAGG - Intronic
1050158256 9:2690769-2690791 CTCTGCTGATACCTTGATTCTGG - Intergenic
1052017648 9:23487848-23487870 CTCTGAGGTTATAGTGGTGCTGG + Intergenic
1056466167 9:86857387-86857409 TTCTGATTTAATCTTGAAGCTGG + Intergenic
1056723038 9:89087836-89087858 CTCTGTTCTCATCTTAATGCTGG - Intronic
1060030844 9:120213556-120213578 CTCTGATGTTATGCTGGGGCGGG + Intergenic
1061311274 9:129764330-129764352 CTCTGATGTTATGTTTGTGTGGG - Intergenic
1062466530 9:136684036-136684058 CTCTGCTGGTATCTGGAGGCCGG - Intronic
1186353296 X:8762526-8762548 CACTTATTTTATCTTGATCCTGG + Intergenic
1186794570 X:13031957-13031979 CACTTATTTTATCTTGATCCTGG + Intergenic
1188212215 X:27440259-27440281 CTCTGATCCCATATTGATGCAGG + Intergenic
1188250665 X:27889678-27889700 CTCTGAAGCAATCTTGATGATGG + Intergenic
1188777359 X:34236941-34236963 CCCTGATGTTCCCTTGCTGCTGG + Intergenic
1188937804 X:36198708-36198730 CTCTGTTGTAATGTTAATGCTGG + Intergenic
1190165863 X:48072282-48072304 CTCTGATTTGATCTTCAAGCAGG - Intergenic
1190367247 X:49707585-49707607 CTCTGTTGTTATCATGACCCAGG - Intergenic
1195557993 X:106249424-106249446 CTCTGTTTTTATGTTAATGCTGG + Intergenic
1197836945 X:130705128-130705150 CTCTGATTTTCTCTGGTTGCTGG + Intronic