ID: 924700618

View in Genome Browser
Species Human (GRCh38)
Location 1:246448474-246448496
Sequence CTAAATAAACAAATGGTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 716
Summary {0: 1, 1: 0, 2: 10, 3: 75, 4: 630}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924700615_924700618 -2 Left 924700615 1:246448453-246448475 CCCAACATATCTACTGAGAGACT 0: 1
1: 0
2: 0
3: 11
4: 174
Right 924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG 0: 1
1: 0
2: 10
3: 75
4: 630
924700616_924700618 -3 Left 924700616 1:246448454-246448476 CCAACATATCTACTGAGAGACTA 0: 1
1: 0
2: 1
3: 14
4: 171
Right 924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG 0: 1
1: 0
2: 10
3: 75
4: 630
924700613_924700618 3 Left 924700613 1:246448448-246448470 CCATCCCCAACATATCTACTGAG 0: 1
1: 0
2: 1
3: 12
4: 169
Right 924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG 0: 1
1: 0
2: 10
3: 75
4: 630
924700614_924700618 -1 Left 924700614 1:246448452-246448474 CCCCAACATATCTACTGAGAGAC 0: 1
1: 0
2: 1
3: 5
4: 127
Right 924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG 0: 1
1: 0
2: 10
3: 75
4: 630
924700612_924700618 4 Left 924700612 1:246448447-246448469 CCCATCCCCAACATATCTACTGA 0: 1
1: 0
2: 1
3: 27
4: 322
Right 924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG 0: 1
1: 0
2: 10
3: 75
4: 630

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924700618 Original CRISPR CTAAATAAACAAATGGTCAA AGG Intronic
902660688 1:17900653-17900675 CTCAATTAAAAAATGGGCAAAGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903748761 1:25605521-25605543 CTCAATTAAAAAATGGGCAAAGG + Intergenic
904212482 1:28895109-28895131 CTAATTAAACAATTCTTCAAGGG - Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905248810 1:36634027-36634049 GAAGATATACAAATGGTCAATGG - Intergenic
905510064 1:38512144-38512166 GTAAACAAACAAATGGATAACGG + Intergenic
905540892 1:38759679-38759701 CTAAAGATACAAATGGTAATGGG + Intergenic
905593162 1:39182522-39182544 CCCAATAAAAAAATGGGCAAAGG + Intronic
906374442 1:45283744-45283766 CTAAATTTAAAAATGGGCAAAGG - Intronic
907315183 1:53565344-53565366 CAAAATAAACAAAATGTAAAAGG + Intronic
907332872 1:53682672-53682694 CTAGATTAACCAATGGTGAAAGG - Intronic
907589719 1:55654658-55654680 ATAAATAAATAAATGGAAAAGGG + Intergenic
907852807 1:58272762-58272784 CAAAAGAGACAAATGGTAAAGGG - Intronic
908223049 1:62027806-62027828 CTCATTAAAAAAATGGGCAAGGG - Intronic
908694381 1:66821673-66821695 TTAAATAAAAAAATGGGCAATGG - Intronic
908924406 1:69236908-69236930 AGAAATAAACAAATGTTCAGAGG + Intergenic
909584971 1:77279927-77279949 CCAAATAAACAAAGGGCCAAGGG + Intergenic
910419474 1:87042145-87042167 CTCAATTAAAAAATGGGCAAAGG - Intronic
911540997 1:99158328-99158350 CTCAATAAACAAAGTATCAATGG - Intergenic
911791281 1:102018578-102018600 CTAAATAACCCATGGGTCAAAGG + Intergenic
911961859 1:104314679-104314701 CTGAATAATCATATTGTCAATGG - Intergenic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
912613067 1:111068271-111068293 ATAAAAAAACAAATAATCAAAGG - Intergenic
913616171 1:120561577-120561599 TTATATAAACAAAAGTTCAAAGG + Intergenic
914574104 1:148949319-148949341 TTATATAAACAAAAGTTCAAAGG - Intronic
916294994 1:163208616-163208638 AAAAATAAAGAAATGGACAAGGG + Intronic
916593245 1:166214072-166214094 CTCAATAAAAAAATGATAAAGGG - Intergenic
917120621 1:171641857-171641879 CTGAGCAAACAAATGATCAAAGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917783281 1:178423810-178423832 CTCAATAGAAAAATGGGCAAAGG - Intronic
918460272 1:184769296-184769318 CCAAAGAAACAAGTAGTCAAAGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918773736 1:188600330-188600352 CTCAATAAAAAAATTGTTAAAGG - Intergenic
918806183 1:189048712-189048734 CCAAATTAAAAAATGGGCAAAGG - Intergenic
919151563 1:193707330-193707352 TTAAATAATCAAAAGGTAAATGG - Intergenic
919816195 1:201441728-201441750 CCAGATTAAAAAATGGTCAAAGG + Intergenic
920044155 1:203122649-203122671 CCAAAGAAACAAATGGTGGATGG + Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
920637658 1:207719926-207719948 AACAATAAATAAATGGTCAACGG + Intronic
921057898 1:211558017-211558039 CTCAATTAAAAAATGGGCAAAGG + Intergenic
921369781 1:214409974-214409996 CCTATTAAAAAAATGGTCAAGGG - Intronic
921427142 1:215016915-215016937 CCCAATTAACAAATGGGCAAAGG + Intronic
921594061 1:217035979-217036001 CTAATTTAAAAAATGGACAAAGG + Intronic
921830945 1:219726810-219726832 CTTAAAAAAAAAATGTTCAAGGG + Intronic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922631508 1:227118220-227118242 CTCAATCAAAAAATGGGCAAAGG + Intronic
923360421 1:233205753-233205775 CTAAATAAACATTTGTTGAAAGG - Intronic
923415433 1:233753372-233753394 CTAAAAAAATAAATGGACACAGG + Intergenic
923474161 1:234317202-234317224 CTAAATAAATAAAAGTACAACGG + Intronic
923621129 1:235580440-235580462 CTAAAAAAATTAATGTTCAAGGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924274272 1:242369547-242369569 ATAAATAAACAAAGATTCAATGG + Intronic
924461857 1:244266760-244266782 CTCAATAAATAACTGTTCAAAGG + Intergenic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
924848362 1:247796526-247796548 ATAAATAAACAAATCATCAGTGG + Intergenic
1062780043 10:194726-194748 CTCCATAAAAAAATGGGCAAAGG - Intronic
1062853506 10:765156-765178 TAAAAAAAAAAAATGGTCAAAGG + Intergenic
1063247880 10:4242081-4242103 ATAAATAAATAAATGCACAAAGG - Intergenic
1065862084 10:29880402-29880424 CAAAGAAAACAAAAGGTCAAAGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066752683 10:38674897-38674919 CTCAACAAAAAAATGGACAAAGG + Intergenic
1066964350 10:42248129-42248151 CTCAACAAAAAAATGGACAAAGG - Intergenic
1068761589 10:60717037-60717059 CTTAATAAAAAAATCCTCAAGGG - Intronic
1068797498 10:61099953-61099975 TTATAAAAACACATGGTCAAAGG + Intergenic
1068864173 10:61877737-61877759 CTTAATAAAGATTTGGTCAAAGG - Intergenic
1068958248 10:62840758-62840780 TAAAACAAACAAATGGGCAAAGG - Intronic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071001721 10:80838600-80838622 CACAATAAAAAAATGGTAAAAGG - Intergenic
1071708081 10:88021152-88021174 CTCAGTAAACAAAAGATCAAAGG + Intergenic
1071714185 10:88078370-88078392 ATAAATAAACAAATATGCAAAGG - Intergenic
1072336100 10:94400027-94400049 CCAACTAAAAAAATGGGCAAGGG - Intergenic
1072504341 10:96049272-96049294 CTAATTATAAAAATGGGCAAAGG - Intronic
1072879344 10:99209382-99209404 CTAAATAACCAATTGATCAATGG + Intronic
1072910778 10:99498945-99498967 CTAAATAAAAACATTGACAAAGG - Intergenic
1074475703 10:113772105-113772127 TTAAAGAAACAAATGATGAATGG - Intronic
1074608187 10:114995017-114995039 ATAAATAAATAAATGTACAAAGG - Intergenic
1074621571 10:115129907-115129929 CTACAAAAATAAATGTTCAAAGG + Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075154076 10:119959477-119959499 CTAAATAAACAAACAAACAAAGG - Intergenic
1075535825 10:123271346-123271368 CTGAATAAACAAAAGGTGAAGGG + Intergenic
1075538503 10:123292654-123292676 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075538568 10:123293229-123293251 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075959033 10:126551055-126551077 CTAAATACACAAATACTCCAAGG + Intronic
1076219857 10:128724370-128724392 CTAAGTAAATAAATGTGCAAAGG - Intergenic
1076409843 10:130239758-130239780 CTACATATGCAAAGGGTCAAAGG - Intergenic
1076497891 10:130910087-130910109 CTAAATAACCAGGGGGTCAATGG - Intergenic
1076766393 10:132636643-132636665 ATAAATAACCAAATGGACATGGG - Intronic
1077783707 11:5359875-5359897 CAAAAAAAACAAATGGGGAAAGG + Intronic
1078196497 11:9141142-9141164 ATAAATAAATAAATGGTAAGGGG + Intronic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1079623564 11:22585931-22585953 ATAAATATTCAAATGGTAAATGG - Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081170531 11:39864565-39864587 CTAAATAACCAAAGGGTCAAAGG - Intergenic
1081271038 11:41082796-41082818 AGAAATAAACAATAGGTCAAAGG - Intronic
1081544802 11:44063864-44063886 ATACAAAAACAAATGGTCAAAGG - Intergenic
1081647675 11:44801103-44801125 ATAAATAAGCAAATGCTCTAAGG - Intronic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1082110650 11:48270163-48270185 CTAAATAATCCATTGGTTAAAGG - Intergenic
1084057667 11:66646939-66646961 CTAAACAAATAGATGGTGAAAGG - Intronic
1084908164 11:72364907-72364929 CTAATTTAAAAAATGGACAAAGG + Intronic
1085912331 11:80842445-80842467 CTCAATAAACAAATGTTGAATGG + Intergenic
1086056938 11:82658052-82658074 CTCTATAAAAAAATGGGCAAAGG + Intergenic
1086224989 11:84497074-84497096 CTAATTAAACAAATAGATAATGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086538120 11:87874403-87874425 CTCAATTAAAAAATGGGCAAAGG + Intergenic
1090348774 11:126092925-126092947 CTAAAAAATCAACTGATCAAAGG - Intergenic
1090883095 11:130851877-130851899 CCAAATAAACAAATGGCTTATGG + Intergenic
1091356187 11:134939645-134939667 CTGCCAAAACAAATGGTCAAAGG + Intergenic
1093129866 12:15377885-15377907 CTAAATAACCAATGGGTCAAAGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094584165 12:31761946-31761968 ATAAATAAATAAATGTTAAAAGG - Intergenic
1094620605 12:32076920-32076942 CTAAATAAATTATTAGTCAAGGG - Intergenic
1094813005 12:34160178-34160200 CCAAATTCACAAATGGACAAGGG - Intergenic
1095133838 12:38573635-38573657 CTTAATAATCAAATTCTCAAAGG + Intergenic
1095302440 12:40600501-40600523 CTAATTAAAAATATGGGCAAAGG - Intergenic
1095309242 12:40677959-40677981 ATAAATTACCAAATGTTCAAGGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095734045 12:45536792-45536814 CTAAATAGAAAAATGGTAAGTGG - Intergenic
1096019085 12:48307288-48307310 CAAAAAAGACAAATTGTCAAAGG - Intergenic
1096908147 12:54955302-54955324 CCAATTAAAAAAATGGACAAAGG + Intronic
1097594008 12:61605166-61605188 CTATTTAAAGAAATGGACAAAGG - Intergenic
1097637316 12:62138550-62138572 ATAAGTAAATAAATGGTCACTGG + Intronic
1097873430 12:64621319-64621341 CCTAATAGACAAATGGGCAAAGG - Intronic
1097947480 12:65388173-65388195 CTAAATATACAAATAATCTAGGG - Intronic
1098777410 12:74638223-74638245 CCAATTAAAAAAATGGGCAAAGG + Intergenic
1098944715 12:76576741-76576763 CTGAATAACCACTTGGTCAAAGG + Intergenic
1099546408 12:83986688-83986710 CTAAATAAAGACAAGCTCAAAGG - Intergenic
1099702864 12:86110348-86110370 CTATATATACACATAGTCAAGGG + Intronic
1099918994 12:88933565-88933587 CAAAATGAAAAATTGGTCAATGG + Intergenic
1100107844 12:91198857-91198879 GAAAATATACAAATGGCCAATGG - Intergenic
1100188258 12:92161125-92161147 CTAAGAAAACAAGTGTTCAAAGG + Intergenic
1100342700 12:93695906-93695928 ATAAATAAATAAATGGGCAAAGG + Intronic
1101475411 12:105042129-105042151 CTAAATAAAGAAATGGATATAGG - Intronic
1101688160 12:107046292-107046314 CAAAAAAAAAAAATGCTCAAAGG + Intronic
1102537945 12:113595634-113595656 ATAAATAAATAAATAATCAAAGG - Intergenic
1102693119 12:114777143-114777165 ATAAATAAATAAATAGGCAAAGG + Intergenic
1102999192 12:117372299-117372321 ATAAATAAAGAAATGGACATTGG - Intronic
1103430484 12:120880881-120880903 CCAAAAAAAAAAATGGACAAAGG + Intronic
1103999281 12:124850071-124850093 CTAAATAAATAAATAATAAAGGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105282194 13:18972668-18972690 CTGAATGAAAAAATGGGCAAAGG + Intergenic
1105796069 13:23854325-23854347 CAAAATAAACAAATAGGAAATGG - Intronic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106985128 13:35337865-35337887 CTAAATAACCAATGGGTTAAAGG + Intronic
1107365769 13:39673054-39673076 CTAAATTAAAAAATGGGTAAAGG - Intronic
1107420993 13:40246281-40246303 CCCATTAAAAAAATGGTCAAGGG + Intergenic
1107437323 13:40391533-40391555 CTAGATAAAACAATGGCCAAGGG - Intergenic
1107456311 13:40558647-40558669 CTAAATATCCAATTGGTCCAAGG - Exonic
1107541951 13:41397016-41397038 CTCAATTAACAAATGGGCAAAGG + Intergenic
1107542006 13:41397362-41397384 CAAAAAAACCAAATGGACAAAGG + Intergenic
1107608797 13:42091478-42091500 CCAATTAAAAAAATGGGCAAAGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108239703 13:48450360-48450382 TTAAATAAATAAATGGTCCTCGG - Intronic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1108971852 13:56386350-56386372 CTGGATAAAAAAATGGGCAAAGG + Intergenic
1109073979 13:57809108-57809130 CTAAACAAACAGTGGGTCAATGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109747840 13:66649258-66649280 CTTAATAATCAAATTGTCAAAGG + Intronic
1110325846 13:74214793-74214815 CTCAAAAAAAAAATGGTTAAAGG - Intergenic
1111191828 13:84818858-84818880 CTCAATCAAAAAAAGGTCAAAGG - Intergenic
1111195563 13:84871021-84871043 CTAAATCAACAGATGGTAATGGG + Intergenic
1111534701 13:89587778-89587800 CAAAATAAACTAAAGGACAAAGG - Intergenic
1111695745 13:91621638-91621660 CTAAATATTGAAATGGTCACAGG - Intronic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112188791 13:97154772-97154794 CTGAATAAATAAATGGTATAAGG + Intergenic
1112649121 13:101372578-101372600 CTAAATAACCTACAGGTCAAAGG + Intronic
1112944351 13:104908514-104908536 CTGAATAACCAATGGGTCAATGG - Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1113631370 13:111887246-111887268 CTAATTTATAAAATGGTCAAAGG - Intergenic
1113712079 13:112472672-112472694 CTACATTAAAAAATGGGCAAAGG + Intergenic
1114781408 14:25542241-25542263 ATAAATTACCAAATGTTCAAAGG + Intergenic
1114839423 14:26246129-26246151 TTAAATCAACAAATCCTCAAAGG + Intergenic
1114932384 14:27489817-27489839 CTAAATTAAATAATGGGCAAAGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115527752 14:34298575-34298597 CAAAGTAAACAACTGATCAATGG + Intronic
1115596960 14:34918674-34918696 TTATAGAAAGAAATGGTCAATGG - Intergenic
1115924086 14:38411590-38411612 CTAACTAAACAAATTTTCATTGG - Intergenic
1116269700 14:42745768-42745790 CTAAAAACATAAATGCTCAAAGG + Intergenic
1116586574 14:46712646-46712668 TAAAATAAATAAATGGTCAAAGG - Intergenic
1116625610 14:47259084-47259106 CTAAACAAACAAATGGAAATTGG - Intronic
1116713974 14:48405400-48405422 CAAGATACACAAATGGCCAATGG - Intergenic
1118041770 14:61924842-61924864 AGAAATAAACTAATGGTTAAAGG - Intergenic
1118152589 14:63205423-63205445 CTAGACACACAAATGGTGAAAGG + Intronic
1118268031 14:64314260-64314282 CTAAATAAAACATAGGTCAAGGG + Intronic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1118650052 14:67881966-67881988 CTAAAAAAATAAAAAGTCAAGGG - Intronic
1119573779 14:75699996-75700018 CTAATCAAACAAATGTGCAAGGG - Intronic
1120263732 14:82222310-82222332 CTAAATAATCAATAGGTCAAAGG + Intergenic
1120301846 14:82717470-82717492 GTGAATAAACAAATCTTCAAAGG - Intergenic
1120621161 14:86766363-86766385 CTAACTAAACTGATGGTAAATGG + Intergenic
1120681704 14:87487956-87487978 CTAAATAAATAAACAGTCAGGGG + Intergenic
1120726763 14:87951726-87951748 CTAAATAATCAATAGATCAAAGG + Intronic
1122730833 14:103796291-103796313 ATAAATAAATAAATAGGCAAAGG + Intronic
1123965532 15:25453164-25453186 CTAAATAACCCATTGGTAAAAGG + Intergenic
1124255198 15:28135588-28135610 CTTAATAAACACATGCTGAATGG + Exonic
1125185750 15:36927917-36927939 ATAAATAAACAAATGCTTAGAGG + Intronic
1125418882 15:39482857-39482879 ATAAATAACCAATAGGTCAAGGG + Intergenic
1125432749 15:39612389-39612411 CTAAACAAACAATAGGTCAGAGG + Intronic
1126526520 15:49662001-49662023 CTAAATAACCCATGGGTCAAAGG - Intergenic
1127332135 15:57949762-57949784 CTACATAGATAAATGGCCAAAGG + Intergenic
1128238560 15:66084274-66084296 CTGATTAAAAAAATGGGCAAAGG + Intronic
1128436633 15:67657205-67657227 CTAATTAACTAAATGGACAATGG - Intronic
1129146834 15:73656127-73656149 ATAAATAAATAAATAGGCAAAGG - Intergenic
1129554397 15:76490472-76490494 CTTAATTAAAAAATGGACAAAGG - Intronic
1130065348 15:80598281-80598303 ATAAATAAACAAATAATAAAAGG + Intergenic
1130695334 15:86125542-86125564 CTTAATAAACAATTGATTAATGG + Intergenic
1131105566 15:89731759-89731781 CTCAATAAACACATGGGCAGTGG - Intronic
1131424277 15:92332940-92332962 CTCAATAGAAAAATAGTCAAAGG - Intergenic
1132130283 15:99271088-99271110 CTCAATTAAAAAATGGGCAAAGG - Intronic
1133016781 16:2946651-2946673 CCCAATTAACAAATGGCCAAAGG + Intronic
1133504245 16:6395026-6395048 CTAACCAAACAAATGGCCATTGG - Intronic
1135076699 16:19400267-19400289 CTAAATCAACAGATGGTAATGGG - Intergenic
1135235152 16:20748175-20748197 ATAAATAAACAAAGAGTCTAGGG + Intronic
1135475103 16:22767382-22767404 CCCAATAGAAAAATGGTCAATGG - Intergenic
1135697211 16:24599581-24599603 CTAAATAACCCATGGGTCAAAGG - Intergenic
1136546011 16:30955169-30955191 CTAAATAAATAAATACTCAGTGG - Intronic
1137357623 16:47781709-47781731 CTAACTAGATAAATGGGCAAAGG + Intergenic
1139019393 16:62728630-62728652 CTAAAATAAGAAATGGACAAGGG - Intergenic
1140521452 16:75585413-75585435 CTTAGTAAACAACTGGTGAAGGG - Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140936762 16:79678428-79678450 AAAAATACTCAAATGGTCAAAGG - Intergenic
1141056922 16:80826132-80826154 CTAAATAAATAAATAGTCTTGGG - Intergenic
1141783716 16:86183758-86183780 ATAAATAGAAAAATGATCAAAGG + Intergenic
1142686772 17:1581645-1581667 CTAAATTTACAAATGGTGGAGGG - Intronic
1142946203 17:3430601-3430623 CTAAGTTAAAAAATGGGCAAAGG + Intergenic
1143685609 17:8513185-8513207 GGAAATAGAAAAATGGTCAAAGG - Intronic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1144285311 17:13768943-13768965 ACAAATAAATACATGGTCAAGGG - Intergenic
1144592328 17:16535404-16535426 CTAAATAAACAAAACCTCATTGG + Intergenic
1145387681 17:22428244-22428266 CTAAATAACCCATAGGTCAAAGG - Intergenic
1146246623 17:31290046-31290068 CTCAATGAATAAATGGGCAAAGG - Intronic
1146594869 17:34159563-34159585 CAAAACAAACAAATGGCGAAGGG - Intronic
1146969318 17:37059699-37059721 CTAAATAAAGAGCTGGGCAAAGG - Intergenic
1147285023 17:39395428-39395450 ATAAATAAATAAAAGGTAAAAGG + Intronic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1148500856 17:48089827-48089849 ATAAATAAATAAATGGCAAAAGG + Intronic
1148583415 17:48759590-48759612 CAATATAAACAAAGGGTCACTGG + Intergenic
1150198476 17:63327044-63327066 CTGATTAAAAAAATGGGCAAAGG + Intronic
1152428357 17:80231657-80231679 CTAAATAATCCACAGGTCAAAGG - Intronic
1153080722 18:1221482-1221504 CTACATAAACAAAAGCTCTATGG + Intergenic
1153319389 18:3757420-3757442 ATAAATAAATAAATGGTGCAAGG + Intronic
1153654824 18:7273236-7273258 CTAAAAAAACAAAAGGATAATGG + Intergenic
1155582123 18:27321279-27321301 TTAAATACAGAAATGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155765269 18:29622666-29622688 CTAAAGAAACAAAGGGTCATGGG + Intergenic
1156698092 18:39792188-39792210 CCAAGGAAACAAAGGGTCAAAGG - Intergenic
1156879332 18:42057954-42057976 CTGAATAAAGAAATGGTAGAAGG + Exonic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158156014 18:54426249-54426271 CTAGATAAACAAATAGTCAAGGG - Intergenic
1158163395 18:54511513-54511535 CTGACTAAAAAAATGGGCAAAGG + Intergenic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158916134 18:62132245-62132267 CTAAAGAAATAAAGGGTCGATGG + Intronic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160483317 18:79263037-79263059 CAAAATAAAACAATGCTCAAAGG - Intronic
1161490559 19:4558862-4558884 CTAAAAAAAAAAAGAGTCAAAGG + Intronic
1162306109 19:9875006-9875028 CTAAATGAACAAATATTGAATGG + Intronic
1164791406 19:30987641-30987663 CAAAGGGAACAAATGGTCAAAGG - Intergenic
1165037779 19:33046851-33046873 CAAAAAAAAAAAATGGGCAAAGG - Intronic
1165987068 19:39778737-39778759 CTAAATAAACAGATATTGAATGG + Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1167371920 19:49087897-49087919 ATAAATAAATAAATGGTAACTGG - Intronic
1167700458 19:51041147-51041169 CCAAATATACAACTGGTGAATGG + Intergenic
1168443042 19:56388337-56388359 ATGAAGAAACAAATGGTGAAAGG + Intronic
924972147 2:138187-138209 CGAATTAAAAAAATGGACAAGGG - Intergenic
925229161 2:2216403-2216425 CTAAATAACCCATGGGTCAAAGG + Intronic
926530815 2:14042501-14042523 CTAAATAAATAAATGATAGAAGG - Intergenic
926813434 2:16777134-16777156 TTAAATAAACAAATTATTAAAGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927609899 2:24527989-24528011 CTCAATTAAAAAATGGGCAAAGG - Intronic
928223725 2:29428018-29428040 CTAAATAACCAGTGGGTCAAAGG + Intronic
928643913 2:33331460-33331482 CTAAATAATTCATTGGTCAAAGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929062605 2:37938743-37938765 CTAAATAAAAAAATGATAAAGGG - Intronic
929159876 2:38821115-38821137 CTAAATAATCAAAGGGTCACAGG + Intronic
929186799 2:39103976-39103998 CCAAATTAAAAAATGGGCAATGG + Intronic
929678634 2:43965685-43965707 TTCAATTAACAAATGGGCAAAGG + Intronic
930119356 2:47747578-47747600 CTAAATAAATAAAAAGTAAAAGG + Intronic
930930437 2:56875336-56875358 CTAAATAAACACATGTACAGAGG + Intergenic
931017083 2:57994688-57994710 CCATATAAACAAATGGTCTTTGG - Intronic
932642099 2:73459535-73459557 ATAAATAAATAAATGGAGAAGGG - Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933011817 2:77074754-77074776 CTAAATCAAGAAGTGGACAAAGG + Intronic
933172984 2:79144052-79144074 CCAATTTAAAAAATGGTCAAAGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933346901 2:81098445-81098467 CTTAATAATCAATGGGTCAAAGG - Intergenic
933375236 2:81471111-81471133 ATAAATGAAAAAATGTTCAATGG + Intergenic
933419095 2:82024554-82024576 CTAAATCAACAGATGGTAATGGG + Intergenic
933467333 2:82670269-82670291 AAAAATAAACAATGGGTCAAGGG - Intergenic
933583215 2:84150704-84150726 CTAAAAAAACAGAAGGTGAATGG + Intergenic
933617237 2:84495163-84495185 CTCAATAAATAAATGGTCAAAGG - Intergenic
933621882 2:84552503-84552525 TTAAGTAAAAAAATGGGCAAAGG - Intronic
933909422 2:86926362-86926384 TGAAATATACAAATGGTAAAAGG + Intronic
934023304 2:87977017-87977039 TGAAATATACAAATGGTAAAAGG - Intergenic
934186340 2:89680180-89680202 CTCAACAAAAAAATGGACAAAGG - Intergenic
934315673 2:91917050-91917072 CTCAACAAAAAAATGGACAAAGG + Intergenic
934929304 2:98407495-98407517 ATAAACAAACAAATGAGCAAAGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935392052 2:102563068-102563090 ATAAATAAACAAATAGACTAAGG - Intergenic
935410089 2:102752322-102752344 CTAAATAACAAAAATGTCAAAGG - Intronic
935550635 2:104449786-104449808 CTAAATAAAGAAATGCTCATAGG - Intergenic
936103859 2:109607492-109607514 ATAAATAAACAAATGGTCTGTGG + Intronic
936389635 2:112059402-112059424 CTAGATGAACAAAGGGTGAAAGG + Intronic
937602059 2:123750092-123750114 TTAAATAAACAAATGTTCTTAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938869356 2:135457746-135457768 CTCAATTAAAAAATGGGCAAAGG - Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
938984031 2:136555528-136555550 CCAATTAAAAAAATGGGCAAAGG + Intergenic
939814658 2:146879091-146879113 AAAAATAAAAAAATGGCCAAAGG - Intergenic
940194270 2:151076106-151076128 CTCAATTAAAAAATGGGCAAAGG + Intergenic
940194313 2:151076425-151076447 TTAAAAAAAGAAATGGGCAAAGG + Intergenic
940494037 2:154403007-154403029 CAAAATACAAAAATGGTCACTGG - Intronic
940735289 2:157444335-157444357 CTAAAGAAAAAAATGGCAAATGG - Intronic
941327768 2:164138575-164138597 CCAAATAAACAAATGAGCAGAGG + Intergenic
941583281 2:167326673-167326695 ATAAATAAATAAATGGGCAGGGG - Intergenic
941945754 2:171095020-171095042 CTAAATAACCAATAGGTCAAAGG + Intronic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
943746356 2:191466488-191466510 TTAAATAAATAAATGATCTAAGG + Intergenic
944208117 2:197178570-197178592 CCAAATAAAGAAATGGGCAAAGG + Intronic
944213777 2:197233477-197233499 CAAAATTAACAAAGGGACAAAGG + Intronic
944592325 2:201229345-201229367 CAATTTAAACAAATGGTCCATGG + Intronic
944795242 2:203177458-203177480 CTAAATAAACATTTCTTCAAAGG + Intronic
944939458 2:204607932-204607954 CTAAATGTCCAAATTGTCAAAGG - Intronic
945384928 2:209186237-209186259 CTCAATAAAGAAATGGTCAAAGG + Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945751933 2:213798127-213798149 ATAATTCAACAAATGGTTAAGGG - Intronic
945789614 2:214288742-214288764 ATAAATAAATAAGTGGGCAAAGG - Intronic
945910112 2:215639341-215639363 ATAAATGAGCTAATGGTCAATGG + Intergenic
946498822 2:220224072-220224094 CTACATAAACAAATACTCTATGG + Intergenic
947066352 2:226230082-226230104 CTCAATAAAAAAATGGGCAAGGG + Intergenic
947146499 2:227070889-227070911 ATAAATAAATAAATGCTAAAAGG + Intronic
948108685 2:235436341-235436363 ATGAACAAACAAATGGTCTAGGG + Intergenic
948558041 2:238830453-238830475 ATAAATAAATAAATGGGGAAGGG + Intergenic
1168987958 20:2066751-2066773 GTAATTGGACAAATGGTCAAGGG - Intergenic
1169355555 20:4902010-4902032 CTCAAAAAACAAATGATGAATGG - Intronic
1169800905 20:9510411-9510433 CTAAATAAGTAAATGGTGAGGGG - Intergenic
1170504219 20:17008200-17008222 CCCAATTAAAAAATGGTCAAAGG - Intergenic
1171114313 20:22511221-22511243 ATAAATAAATAAATTCTCAAAGG + Intergenic
1171197599 20:23212457-23212479 CTAGATAATCAAATAGTGAAGGG - Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1171983981 20:31646602-31646624 ATAAATAAATAAATAGGCAAAGG + Intergenic
1173898058 20:46565899-46565921 CTGAGTAAACAAATGGCCATAGG - Intronic
1174953035 20:55064266-55064288 CAAAATAAAAAAATGATAAAGGG - Intergenic
1175291789 20:57880894-57880916 ATGAATAAACAAATGGCCAGGGG - Intergenic
1175346538 20:58281789-58281811 CTGAATAACTAAATGATCAAAGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176283061 20:64326239-64326261 CTAAATAAAGAACAGTTCAAGGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177822687 21:26048932-26048954 CTAGAGAAAGAAAAGGTCAATGG + Intronic
1178619710 21:34162872-34162894 TTAAAAAAACAAATGATCATAGG + Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178906357 21:36640227-36640249 CTAAAAAAAAAAATGCTAAAAGG + Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179031594 21:37725114-37725136 CAACAGAAAAAAATGGTCAAAGG + Intronic
1179295750 21:40060769-40060791 CTAATAAAAGAAATTGTCAAAGG - Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1180984223 22:19895048-19895070 CTTAATAAGCAATTGCTCAAGGG + Intronic
1181783442 22:25208958-25208980 CTAAATAAACAAACAAACAAAGG - Intergenic
1182017808 22:27055541-27055563 TTAAATAAACAAATGGATGAAGG - Intergenic
1182102036 22:27664243-27664265 ATAAATAAATAAATGAGCAACGG - Intergenic
1182643468 22:31788102-31788124 TTAAAAAAACAAATGGGCAAAGG + Intronic
1184102930 22:42350921-42350943 CTAAATAAATAAATAATAAACGG - Intergenic
1184142995 22:42590061-42590083 CTAAATAACCAATGGGTCAAAGG + Intronic
1184370480 22:44078722-44078744 TTAAATAAATAAATACTCAAAGG - Intronic
1185363836 22:50425848-50425870 CTCAATTCAAAAATGGTCAAAGG - Intronic
949740439 3:7227209-7227231 ATGAAAACACAAATGGTCAATGG - Intronic
950497718 3:13344031-13344053 TAAAATAAACAAATGTTAAAAGG - Intronic
951098581 3:18660087-18660109 CTAAAAAAAAAAATGATAAAAGG - Intergenic
951368991 3:21821529-21821551 CTAAACAAAAAATTGGGCAATGG + Intronic
952681101 3:36094172-36094194 CTAAATAAACCATTGATGAAGGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953317021 3:41938265-41938287 CTAAATATACAATTGGTAAATGG + Intronic
953336800 3:42100371-42100393 TTAAATAAAAAAATGGTGACAGG + Intronic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
954736044 3:52707149-52707171 ATAAATAAATAAAAGGTGAAGGG - Intronic
954928349 3:54257712-54257734 ATAAAAAAATAAATGGGCAAAGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
955990168 3:64618255-64618277 CTAATTAAAGAAAAGGTAAAGGG - Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956414154 3:69009941-69009963 AAAAAAAAACAAAGGGTCAAGGG + Intronic
957400563 3:79707371-79707393 CTAAGAAAAAAAATGGGCAAGGG - Intronic
957622757 3:82615920-82615942 TTAAATAAACAATTGATTAAAGG - Intergenic
957938425 3:86973728-86973750 CTAAATAGTCAAATGGAGAAAGG - Intronic
958111468 3:89152225-89152247 CTAACTCAACAAATGATCAGAGG + Intronic
958512517 3:95066566-95066588 CTCAATTAAAAAATGGACAAAGG + Intergenic
959957935 3:112260344-112260366 CTAAAGAAAAAAATGGACATAGG - Intronic
960079851 3:113529908-113529930 CTAAATATGCAAGTGGGCAATGG - Intergenic
960221927 3:115122646-115122668 CTTCATAGACAAATGTTCAATGG - Intronic
960397721 3:117157454-117157476 CCCAATAAACAAATAGTCACTGG - Intergenic
960401059 3:117199417-117199439 CTCAAGAAACAAATTATCAAGGG + Intergenic
960404895 3:117247750-117247772 CTTAATAAACAAATAGATAATGG - Intergenic
960482200 3:118205644-118205666 CTTAATGAATAAATGGGCAAAGG - Intergenic
960483449 3:118222093-118222115 CTCAATTAAAAAATGGACAAAGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
960767996 3:121159268-121159290 CTAAATAACTAATGGGTCAAAGG - Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
961642523 3:128373590-128373612 CTAAATAAACACCAGGTCACAGG - Intronic
961858630 3:129896166-129896188 CCCAATAAACCAATGGGCAAAGG + Intergenic
962634534 3:137317086-137317108 CTCAATAAAAAAATGATAAAGGG - Intergenic
963393784 3:144705271-144705293 CCAAATAAACAAATTGTCCATGG + Intergenic
963401036 3:144800056-144800078 CCCAATAAAAAAATGGCCAAAGG - Intergenic
964200889 3:154118010-154118032 ATAAATAAACAAAAGGTACACGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964823887 3:160804607-160804629 CTAAATAAGAAAATGAGCAATGG - Intronic
965506355 3:169519737-169519759 GCAACTAAACAAATGGGCAAAGG - Intronic
966234557 3:177686402-177686424 CTAAATGAGCAAATTCTCAAAGG - Intergenic
966535062 3:181022958-181022980 CAAAATAATCAATGGGTCAAAGG - Intergenic
966579813 3:181547801-181547823 CCAATTTAACAAATGGGCAAAGG - Intergenic
967065474 3:185911491-185911513 CTAAACAAACAATTGGAAAAGGG - Intergenic
967855806 3:194116610-194116632 ATAAATAATAAAATGGTGAATGG + Intergenic
970062074 4:12045470-12045492 CTAAAATAAAAAATAGTCAAGGG - Intergenic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
970607793 4:17696844-17696866 ATAAATAAATAAATAGTAAAAGG + Intronic
970648754 4:18154482-18154504 CTCAATTAAGAAATGGGCAAAGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971543952 4:27860647-27860669 CATAATAATCAAATGCTCAAAGG - Intergenic
972332096 4:38073549-38073571 CTCAATTAAAAAATGGGCAAAGG - Intronic
973898297 4:55439176-55439198 CCAATTAAAAAAATGGGCAAAGG + Intronic
974629869 4:64474033-64474055 CTAAATAAGCAAATGTACATTGG + Intergenic
975594689 4:76038690-76038712 ATAAATAAATAAATAATCAAGGG - Intronic
975609202 4:76187351-76187373 CCAGATAAGCAAATGGACAAAGG + Intronic
976368070 4:84253415-84253437 CTAATTAACCCAATGGTCAGTGG + Intergenic
977137125 4:93319359-93319381 CTAAATTAAGAAATTGACAAGGG - Intronic
977582241 4:98738196-98738218 TCAATTAAAAAAATGGTCAAAGG + Intergenic
977670583 4:99690878-99690900 ATAAATAAAGAAATGGTCACTGG - Intergenic
977947920 4:102935158-102935180 CTCAACAAAAAAATGGACAAAGG + Intronic
978030471 4:103936152-103936174 CTCACTAAAAAAATGGGCAAAGG + Intergenic
979129811 4:117029365-117029387 CTAAAATAACAAATGGGAAATGG - Intergenic
979467000 4:121051468-121051490 GTAAATTATAAAATGGTCAATGG + Intronic
980313013 4:131159604-131159626 ATACATAACCAAATGGTCAAAGG - Intergenic
980469263 4:133230153-133230175 CCATATAAACAAAAGGTCACTGG - Intergenic
981285658 4:143016220-143016242 CTATATAAACACATGGGAAATGG - Intergenic
981764222 4:148229534-148229556 CTAAATAAACAAATGATATGTGG + Intronic
982392498 4:154880730-154880752 CTAAATAAGCATATTATCAAGGG + Intergenic
982423399 4:155225633-155225655 CAAATTTAACAAGTGGTCAAAGG + Intergenic
983630733 4:169846653-169846675 TTAAATAAACAAATGAACTAAGG - Intergenic
983661157 4:170131995-170132017 CTAAATCAACAGATGGTAATGGG - Intergenic
984172137 4:176372325-176372347 CTAAAGACACAAATAGTAAAGGG - Intergenic
984172428 4:176376103-176376125 ATAACTAAACCAGTGGTCAAAGG - Intergenic
984581309 4:181512980-181513002 GTAAGGAAACAAATGGGCAAGGG + Intergenic
984967868 4:185156255-185156277 TTAAAAAAAAAAATGGGCAAAGG + Intergenic
985325286 4:188761229-188761251 CTTATTAAACAAATGGTGCAAGG - Intergenic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
986183084 5:5412066-5412088 CTAAACAAACAAATGTTAATGGG - Intergenic
986528624 5:8709629-8709651 ATAAATAAATAAATAGGCAAAGG - Intergenic
986587088 5:9329729-9329751 ATAAATAAATAAATGTACAAAGG - Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987561552 5:19530123-19530145 ATAAATACACAAATGCTCAAGGG + Intronic
987943744 5:24576677-24576699 CTAAATAAATAAATGAACAGGGG + Intronic
988394856 5:30683719-30683741 CAATATAAACAGGTGGTCAATGG + Intergenic
988953027 5:36284253-36284275 ATAAACAAACAAAAGGTCATAGG - Intronic
989459626 5:41682578-41682600 ATGAATAAACAAATGATCAATGG + Intergenic
989699925 5:44251266-44251288 CTAAATAAATAAAAGTTGAAAGG - Intergenic
990414623 5:55574422-55574444 CAAAATAAATAAATGCACAAAGG + Intergenic
990584262 5:57195142-57195164 CTCAATAGAAAAATGGGCAAAGG - Intronic
991425185 5:66483583-66483605 CTAAGTTAAAAAATGGGCAAGGG - Intergenic
992106989 5:73457586-73457608 ATCAGTAAACAAATGGACAAAGG + Intergenic
992530672 5:77648843-77648865 CTAAAAAAAAAAACAGTCAATGG - Intergenic
992619413 5:78577794-78577816 CTAAAAAAAAAAAAGCTCAAAGG - Intronic
992810988 5:80388325-80388347 CAAAATATTTAAATGGTCAAAGG - Intergenic
993504918 5:88696750-88696772 TTTAAAAAATAAATGGTCAAAGG - Intergenic
993849455 5:92988735-92988757 TTAAATAAATAAATGGTGAATGG + Intergenic
994453180 5:99970086-99970108 CAAAATAAACAGATCTTCAAAGG - Intergenic
994783963 5:104131279-104131301 ATAAATGAAAAAATAGTCAATGG - Intergenic
995765603 5:115613800-115613822 TTAAATAAACAAATGGTTTGTGG - Exonic
996368334 5:122726341-122726363 CAAAACAAATAAATGATCAAGGG + Intergenic
996380423 5:122857382-122857404 ATAAATAAATAAATGATGAAGGG - Intronic
996504543 5:124254820-124254842 ATAAATAAAAAAATGGGCCATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997095645 5:130907818-130907840 CTAAATGAATAAATGATCTATGG + Intergenic
997181649 5:131835113-131835135 CTAGATTAAAAAATGCTCAAAGG - Intronic
997700992 5:135899334-135899356 CTAAATAACCAGATGGGGAAAGG - Intergenic
997959842 5:138311869-138311891 CTCAATTAAAAAATGGGCAAAGG + Intronic
998661604 5:144245082-144245104 ATAAATAAATAAATGTACAATGG - Intronic
998706914 5:144772609-144772631 CTAAATAAGAAAATGCTAAAAGG - Intergenic
998906023 5:146906298-146906320 ATAAATAAATAAATGGAAAATGG - Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999187811 5:149725896-149725918 CTAAAGAAACAAAAGTTTAAAGG - Intergenic
999264870 5:150260095-150260117 TTAAATAAACCAATGGACAGAGG - Intronic
999536741 5:152525877-152525899 CTTAATAAAGAAATTTTCAAAGG - Intergenic
999579253 5:153016876-153016898 TTTAATTAACAAATTGTCAATGG + Intergenic
999791958 5:154948649-154948671 CTTAATAAACTAATGGATAAAGG - Intronic
999817114 5:155188198-155188220 CAAGATATACAAATGGCCAAAGG - Intergenic
999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG + Intergenic
1000190696 5:158907762-158907784 AAAAAAAAACAAATGCTCAAAGG + Intronic
1001708202 5:173757349-173757371 AAAAATAATCAAAAGGTCAAAGG - Intergenic
1001771440 5:174300075-174300097 CTAAATAAAGGGATGGCCAAGGG + Intergenic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1002966665 6:1973157-1973179 CTACATAACCAATTGCTCAATGG + Intronic
1003347271 6:5282344-5282366 CAAAAGAAACACATGGTCCATGG + Intronic
1003728002 6:8788516-8788538 CTAAATAAATATATGCTAAATGG + Intergenic
1004316899 6:14597029-14597051 TTAAATAAATAACTTGTCAAAGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004612199 6:17253469-17253491 GAAGAGAAACAAATGGTCAATGG + Intergenic
1004682768 6:17912578-17912600 CCAAATAAAGAAATGGGAAATGG - Intronic
1004797064 6:19098566-19098588 GTAAATACATAAGTGGTCAAAGG + Intergenic
1005280221 6:24265652-24265674 CTAAATGACCAATGGGTCAATGG + Intronic
1005312321 6:24570584-24570606 CTAAAAAAAAAAATCGTCATAGG + Intronic
1005380905 6:25233336-25233358 CCAAATAAACAATGGGTGAATGG - Intergenic
1005661875 6:28006479-28006501 TTAAAGAAACAAATGACCAAAGG + Intergenic
1006703085 6:35992994-35993016 ATAAATAAATAAATAGGCAAAGG - Intronic
1006821147 6:36896445-36896467 CCAAATAAAAAAATAGACAAAGG - Intronic
1006952819 6:37839083-37839105 GTAGATACACAAATGGTCAATGG - Intronic
1006997619 6:38276516-38276538 TAAAAAAAAGAAATGGTCAAAGG + Intronic
1007062513 6:38954811-38954833 CTGAATAAACCAATAATCAAGGG + Intronic
1007962871 6:45976757-45976779 CTAAATATTCAAATGGGTAATGG + Intronic
1008149504 6:47933207-47933229 CCAATTGAACAAATGGTGAATGG + Intronic
1008392211 6:50965437-50965459 ATAGATAAAGAAAAGGTCAAAGG + Intergenic
1008431609 6:51424514-51424536 CAAGATATACAAATGGCCAAAGG + Intergenic
1008710694 6:54223048-54223070 CTCAATTAAAAAATGGGCAAGGG - Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009265984 6:61555667-61555689 CGAAACAAACAAATGTCCAAAGG - Intergenic
1009522588 6:64702704-64702726 CTAAATAAACAAATGAGTAATGG - Intronic
1009650525 6:66471596-66471618 CTAATTTAACTAATGGTTAATGG - Intergenic
1009677981 6:66851599-66851621 CCAAGTAAAAGAATGGTCAATGG - Intergenic
1009692368 6:67052474-67052496 CTAAAAAATAAAATGGTGAAAGG - Intergenic
1009832953 6:68962622-68962644 ATAAATAAAAAAATAGTAAAAGG - Intronic
1009903650 6:69841269-69841291 CCAAATTTACAAATGGGCAATGG - Intergenic
1009906700 6:69878019-69878041 ATAAATAAATAAAAGGGCAAAGG + Intronic
1009961339 6:70525841-70525863 CTGAAAAAACAAATTGTAAAGGG - Exonic
1010093296 6:72009618-72009640 CTCAATAAAAAAATGATAAAGGG + Intronic
1010380709 6:75221263-75221285 CTGAATAAAAAAATAGTCAGCGG - Intergenic
1010794374 6:80102514-80102536 CTATTTAAAGAAATGGACAAAGG - Intergenic
1010979066 6:82349352-82349374 CTAACTTAACAAATGTTAAAAGG - Intergenic
1011193627 6:84762208-84762230 CTAAATAAATACCTGGACAAGGG + Intronic
1011362483 6:86542531-86542553 CCACATTAAAAAATGGTCAAAGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011756637 6:90505959-90505981 CTTAAGAAATAAATGCTCAAAGG - Intergenic
1012293245 6:97485243-97485265 GAAAATACACAAATGGCCAAGGG - Intergenic
1012755119 6:103220371-103220393 CTAAATAAAATATGGGTCAAAGG + Intergenic
1013114126 6:107087752-107087774 ACAAAAAAACAGATGGTCAATGG + Intronic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013647050 6:112155329-112155351 CTAAAAAAATAAACTGTCAAAGG + Intronic
1013947606 6:115740649-115740671 CTAGAGAAACAAATGCCCAAAGG - Intergenic
1014024785 6:116632779-116632801 ATAAATAAATAAATGGTCTCAGG + Exonic
1014361735 6:120485397-120485419 CTAAATAAACATATGATGAATGG + Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015087146 6:129309326-129309348 CTATCTAAACACATGGTTAATGG + Intronic
1015095536 6:129410504-129410526 CTAACTAAACAAATTGAGAAAGG - Intronic
1015114354 6:129630993-129631015 CTAATTTAAAAAATGGTCACAGG - Intronic
1015440051 6:133237842-133237864 AAAAATAAACAAATAGTAAATGG + Intergenic
1016211206 6:141536019-141536041 CTAAATAAATAAATGCTCATAGG - Intergenic
1016787056 6:148022449-148022471 ATAAATAAATAAAATGTCAAGGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017250476 6:152274881-152274903 AAAAATAAACAAATGGGCCATGG - Intronic
1017665380 6:156715328-156715350 ACAAATAAATAAATGGTCCATGG - Intergenic
1017801506 6:157900288-157900310 CTCAATTAAAAAATGGACAAAGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018780606 6:167060791-167060813 CTAAATAACCAATGGATCAAAGG + Intergenic
1019232533 6:170580304-170580326 CAAAATAACAGAATGGTCAAGGG + Intronic
1019761971 7:2819592-2819614 CAAATTAAAAAAATGGGCAAAGG + Intronic
1019873079 7:3784529-3784551 CTAATTAAAAAAATGGACAAGGG + Intronic
1019969708 7:4530530-4530552 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1019992905 7:4704524-4704546 TTAAAAAAAAAAATGCTCAAAGG + Intronic
1021372028 7:19861098-19861120 CTAAATTATCAAATGGTCCTGGG + Intergenic
1021606841 7:22416650-22416672 CTCAATAAAAAAATGGGTAAAGG + Intergenic
1021730368 7:23589765-23589787 ATAAATAAATAAATAGTGAATGG - Intergenic
1022612238 7:31887851-31887873 CTAAATAACCCATAGGTCAAAGG + Intronic
1022726184 7:32983874-32983896 CTAAATAGAAAAATAGGCAAAGG - Intronic
1022760126 7:33339797-33339819 CTAAAACAACAAATGGTCAGTGG + Intronic
1023051236 7:36253195-36253217 GTAAATAACCAACGGGTCAAGGG - Intronic
1023190440 7:37574886-37574908 CTAAAAAGACAAATGACCAATGG + Intergenic
1023355100 7:39358635-39358657 ATACACAAACAAATGGTTAATGG + Intronic
1023502995 7:40870766-40870788 ATAAGTAAACAAATGGAGAACGG - Intergenic
1023554976 7:41412235-41412257 CCAATTCAACAAATGGGCAAAGG - Intergenic
1023899390 7:44463815-44463837 CTAAATAAAAAAAAAATCAACGG + Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024128318 7:46323512-46323534 ATAAATAAATAAATGTGCAAAGG - Intergenic
1024181061 7:46895508-46895530 CCAAATTAAAAAATGGTCAAAGG - Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025047412 7:55703796-55703818 CTAAATAGAAAAATAGGCAAAGG + Intergenic
1026449485 7:70514946-70514968 CTCAATAAAAATATGGACAAAGG - Intronic
1027371508 7:77510587-77510609 TTAAAAAAAAAAATGGTCAAAGG + Intergenic
1027732379 7:81891124-81891146 CTGAATTAAAAAATGGGCAAAGG + Intergenic
1027812448 7:82921899-82921921 CTTATTAAAAAAATGGTCAAAGG + Intronic
1027843120 7:83339388-83339410 CTGAATAAATAAATGGCCAGAGG - Intergenic
1027968802 7:85049709-85049731 CTAAAAACACAAATCTTCAAAGG + Intronic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028307754 7:89287533-89287555 TTAAATAAACTAATGGTTAACGG + Intronic
1028572091 7:92301512-92301534 CTCAATTAAAAAATGGGCAAAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1031469489 7:122152102-122152124 TTAAAAAAAAAAATGGACAAAGG - Intergenic
1031819488 7:126481975-126481997 CTATATTAAGAAATGGGCAAAGG + Intronic
1032395549 7:131586736-131586758 CTGAATGAATAAATGGTAAAAGG - Intergenic
1033281033 7:140006527-140006549 CTAGCTAGAAAAATGGTCAAAGG - Intronic
1033636044 7:143212193-143212215 CAAAAAAAAAAAATGGGCAAAGG - Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035196148 7:157222337-157222359 TTAAAGAAAAAAATGGTAAATGG - Intronic
1035426775 7:158783449-158783471 CTAAATAAAAAACTGGAGAAAGG - Intronic
1038109243 8:24476956-24476978 TTAAAAAAACAAATTGTGAATGG + Intronic
1038537785 8:28366495-28366517 CTAAATAAATAAATAATCAAAGG + Intronic
1038829229 8:31038395-31038417 CTCAATTAAAAAATGGGCAAAGG - Intronic
1038948137 8:32384261-32384283 ATAAATAAACAAACTGTAAATGG + Intronic
1038968152 8:32599554-32599576 CCAAATAAACAAAGGCTCAATGG - Intronic
1039134678 8:34308150-34308172 CCAAATAGAAAAATGGGCAAAGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040793344 8:51260374-51260396 CCAAATTAAAAAATGGGCAAAGG - Intergenic
1040994037 8:53383242-53383264 CTCAATCAAAAAATGGGCAAAGG + Intergenic
1041308032 8:56484014-56484036 GTAAATGCACAAATGATCAATGG + Intergenic
1041415768 8:57607210-57607232 CAAGATAAACAGATGATCAATGG - Intergenic
1041580055 8:59448059-59448081 CTAATTAAACACAAGGTCAGTGG - Intergenic
1041812808 8:61930606-61930628 TTAAAGAAAAAAATGATCAATGG - Intergenic
1042548429 8:69971749-69971771 CTCATTAAAGAAATGGTAAATGG + Intergenic
1042591144 8:70400548-70400570 CTAAATTAACAAATGGTGGGGGG + Intronic
1042727730 8:71895397-71895419 CCATTTAAACAAATGGACAATGG + Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044920050 8:97159981-97160003 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045822330 8:106354095-106354117 TTAAAAAAAAAAATGGGCAAAGG - Intronic
1046151086 8:110227076-110227098 CCCAATTTACAAATGGTCAAAGG - Intergenic
1046869211 8:119186333-119186355 TTAAATAGATAAATGGGCAAAGG - Intronic
1046935294 8:119879709-119879731 TTAAATAAATAAATAATCAAGGG + Intronic
1047091865 8:121583928-121583950 CTACATAAACAATAGGGCAAAGG - Intergenic
1047376967 8:124308587-124308609 ATAAATAAATAAATGGTGGAGGG + Intergenic
1047789503 8:128188279-128188301 CTCAATTTACTAATGGTCAATGG - Intergenic
1047857688 8:128930204-128930226 CTAAATAAATAAAGGATGAAAGG - Intergenic
1048644036 8:136397944-136397966 CCAAATAACTCAATGGTCAAGGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049106004 8:140613467-140613489 CCACATAAACAAATGGTCTTCGG + Intronic
1050886613 9:10774588-10774610 TTAACTAAACAAATTCTCAATGG + Intergenic
1051003075 9:12309470-12309492 ATAAATAAATAAATATTCAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051511436 9:17882584-17882606 ATAAATAAACAAATAATAAAAGG + Intergenic
1051906803 9:22104674-22104696 AAAAACAAACAAATGGTAAATGG - Intergenic
1052051027 9:23850134-23850156 CTAACAAAACAAAAGGTAAAGGG + Intergenic
1052158769 9:25228975-25228997 CTAAAAAAAGAAATGTTAAAGGG - Intergenic
1052161501 9:25266071-25266093 CTAAATAAACAACTGGTGGGAGG - Intergenic
1052581974 9:30369124-30369146 CCCAATTAAAAAATGGTCAAAGG - Intergenic
1053436483 9:38078583-38078605 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1053728896 9:41032456-41032478 AGAAAAAAAAAAATGGTCAAAGG + Intergenic
1054699615 9:68399627-68399649 AGAAAAAAAAAAATGGTCAAAGG - Intronic
1055423992 9:76174145-76174167 TTAAATAATCAAATGTTTAATGG + Intronic
1055580156 9:77699883-77699905 CTAAATAATCCATGGGTCAAAGG - Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1056080468 9:83087994-83088016 CTAAATAACCAATGGGTCAAAGG - Intergenic
1056337263 9:85584856-85584878 CTAAATAGACACATAGGCAATGG + Intronic
1056651241 9:88465618-88465640 CCTAATTAAAAAATGGTCAAAGG - Intronic
1056761266 9:89416920-89416942 GTAAATAAAAAAAAGGTCAAAGG - Intronic
1057066944 9:92062657-92062679 CTAAATAATCCATAGGTCAAAGG + Intronic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1058005412 9:99908434-99908456 ACAAATAAACAAATGGGAAATGG - Intronic
1058203314 9:102070498-102070520 AAAAATAACCAAATGCTCAAAGG + Intergenic
1058207754 9:102129667-102129689 CACAATAAAAAAATGGTAAAGGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059888203 9:118770098-118770120 CAAATAAAACAAATTGTCAAGGG - Intergenic
1060183027 9:121546843-121546865 CCAAAAAAACAAATTGTCATCGG - Intergenic
1060590727 9:124814848-124814870 CTAAATAAAGACATGATCAAAGG + Exonic
1060679981 9:125553628-125553650 CTACATAGACAAATGGGCATGGG - Intronic
1060837218 9:126765402-126765424 CCAAATAGAAAAATGGGCAAAGG + Intergenic
1061426769 9:130503873-130503895 CTAAATATATAAATGGGGAAAGG - Intergenic
1061640477 9:131950821-131950843 CTCAATAAACATGTGGTGAACGG + Intronic
1061771525 9:132927305-132927327 CTAAATCAAGAAAAGGGCAATGG + Intronic
1186155773 X:6724959-6724981 TTAAATAAACAAACTGGCAATGG + Intergenic
1187444786 X:19351769-19351791 CAAAACAAACAAATAGTCACGGG - Intronic
1187464894 X:19518312-19518334 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1187677453 X:21731121-21731143 CTAAATAACCAATGAGTCAAAGG - Intronic
1188817702 X:34735737-34735759 CAAAATTACCATATGGTCAATGG + Intergenic
1188904367 X:35774424-35774446 ATAAATAAACAAATAGGCAAAGG - Intergenic
1189855659 X:45222826-45222848 CTCAATTAACAAGTGGGCAAAGG - Intergenic
1189954762 X:46266214-46266236 CTAAATAAGAAAATGGCCAAAGG + Intergenic
1190693239 X:52929917-52929939 CCCCATAAAAAAATGGTCAAAGG + Intronic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1192302269 X:69917318-69917340 GTAAATAAGAATATGGTCAATGG - Intronic
1192749365 X:73972536-73972558 GAAAACATACAAATGGTCAATGG - Intergenic
1193057068 X:77164153-77164175 TTAAATAAAGAAATGGACAAAGG + Intergenic
1193219851 X:78911665-78911687 TTTAATAATCAAATTGTCAAAGG - Intergenic
1193523747 X:82563194-82563216 CTCCATTAAAAAATGGTCAAAGG + Intergenic
1193563228 X:83046225-83046247 TTAAATAACCAAATTCTCAAAGG - Intergenic
1193916090 X:87365866-87365888 CCAACTAAAAAAATGGTTAAAGG + Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194127250 X:90035165-90035187 CTGAATAATCAATGGGTCAAAGG - Intergenic
1194207308 X:91027665-91027687 CTAAACAGACAAATTGTCATTGG + Intergenic
1194636857 X:96355819-96355841 CTAAATAAAAAAATGATAAATGG + Intergenic
1195293546 X:103452556-103452578 CTAAATAAAAAAATTATAAATGG - Intergenic
1195503147 X:105626554-105626576 TTAAATATAAACATGGTCAATGG + Intronic
1195920936 X:109982960-109982982 CTCAATTAAAAAATGGGCAAAGG + Intergenic
1195984227 X:110611855-110611877 ATAAATAAATAAATGATAAAGGG + Intergenic
1196395114 X:115252394-115252416 ATAAGTAAACAAGTTGTCAATGG - Intergenic
1196749597 X:119103258-119103280 CCCAATTAACAAATGGGCAAAGG + Intronic
1197186686 X:123595240-123595262 CAAAATAAACTGATGGTGAAGGG - Intergenic
1197328375 X:125122183-125122205 GTAAAGAAACCAATGGCCAATGG + Intergenic
1197879366 X:131149110-131149132 TTAAGTAAACAAATAGTGAATGG - Intergenic
1198171661 X:134112142-134112164 CCCAATTAACAAATGGGCAAAGG - Intergenic
1198191172 X:134307732-134307754 ATAAATAAATAAATAGTCAAAGG + Intergenic
1198514034 X:137386241-137386263 CTAAATTAAAAAATGGCCAATGG + Intergenic
1199464410 X:148119888-148119910 CTTAATAACCAATGGGTCAATGG + Intergenic
1199560175 X:149153262-149153284 CTAAATGAACAAATGAACAAAGG - Intergenic
1199888665 X:152051074-152051096 CTCCATTTACAAATGGTCAATGG - Intergenic
1200331804 X:155305640-155305662 CAAAATAAGGAAATGGCCAATGG - Intronic
1200354085 X:155529671-155529693 CCCAATTAAAAAATGGTCAATGG - Intronic
1200362804 X:155628490-155628512 AAAAATAAAAAAGTGGTCAAAGG + Intronic
1200553050 Y:4602396-4602418 CTAAACAGACAAATTGTCATTGG + Intergenic
1200873157 Y:8124891-8124913 CTAAATCAACAGATGGCAAAGGG - Intergenic
1201183341 Y:11371871-11371893 CTCAACAAAAAAATGGACAAAGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201374808 Y:13307744-13307766 CCAAATTAAAAAATGGGCAAAGG + Intronic
1201549152 Y:15201072-15201094 TTAAATAAACAAACTGGCAATGG + Intergenic
1201678664 Y:16617750-16617772 ATAAATAAACAAATAAACAATGG + Intergenic