ID: 924701379

View in Genome Browser
Species Human (GRCh38)
Location 1:246456929-246456951
Sequence GAGCCAGATTTGGATTAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924701379_924701382 -6 Left 924701379 1:246456929-246456951 CCAGACTAATCCAAATCTGGCTC No data
Right 924701382 1:246456946-246456968 TGGCTCTAGGTTAAAGAAAATGG 0: 1
1: 0
2: 0
3: 23
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924701379 Original CRISPR GAGCCAGATTTGGATTAGTC TGG (reversed) Intronic
No off target data available for this crispr