ID: 924703197

View in Genome Browser
Species Human (GRCh38)
Location 1:246475018-246475040
Sequence TTAAAAAGTTTGTACTTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 327}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924703195_924703197 -1 Left 924703195 1:246474996-246475018 CCTCACAGTGATTTGTGGCGCAT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 924703197 1:246475018-246475040 TTAAAAAGTTTGTACTTGGTCGG 0: 1
1: 0
2: 0
3: 41
4: 327
924703191_924703197 11 Left 924703191 1:246474984-246475006 CCCCAACTACAACCTCACAGTGA 0: 1
1: 0
2: 0
3: 15
4: 169
Right 924703197 1:246475018-246475040 TTAAAAAGTTTGTACTTGGTCGG 0: 1
1: 0
2: 0
3: 41
4: 327
924703193_924703197 9 Left 924703193 1:246474986-246475008 CCAACTACAACCTCACAGTGATT 0: 1
1: 0
2: 0
3: 15
4: 153
Right 924703197 1:246475018-246475040 TTAAAAAGTTTGTACTTGGTCGG 0: 1
1: 0
2: 0
3: 41
4: 327
924703192_924703197 10 Left 924703192 1:246474985-246475007 CCCAACTACAACCTCACAGTGAT No data
Right 924703197 1:246475018-246475040 TTAAAAAGTTTGTACTTGGTCGG 0: 1
1: 0
2: 0
3: 41
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924703197 Original CRISPR TTAAAAAGTTTGTACTTGGT CGG Intronic
903096352 1:20979032-20979054 TTAATAAGTTTTTGCTTTGTTGG + Intronic
903601280 1:24542628-24542650 TTAAAAATTTTGTTTTTGGCCGG - Intergenic
904639652 1:31915513-31915535 TTAAAAACTTGGTATTAGGTGGG - Intronic
904708789 1:32412782-32412804 TAAAAAAGTGGGAACTTGGTAGG + Intergenic
905095874 1:35470167-35470189 CTAAAATGTTTGTATTTGGCTGG - Intronic
905196422 1:36281768-36281790 TTTAAAAGTTTTTACTTTGTAGG + Intronic
907101280 1:51838912-51838934 TTAAATAGTTTTAACTTGGAAGG - Intronic
907263215 1:53237696-53237718 GTAAAAAGTTTGGACTTGGAAGG - Intronic
907377388 1:54054843-54054865 TTAATAAGTTTGTACAGGGTAGG - Intronic
908174562 1:61541759-61541781 TGAAAAAATTTGTACATGGTAGG + Intergenic
908887058 1:68801431-68801453 TTAAAAAGGTTGTACTTCTAAGG - Intergenic
910348383 1:86267388-86267410 CTAAAAAGTTTGTTTTTGTTTGG - Intergenic
910383013 1:86650136-86650158 TTACAAAATTTTTTCTTGGTAGG + Intergenic
911330786 1:96523469-96523491 TTAAGAATTTTGTAGTTGGCAGG - Intergenic
912015913 1:105035423-105035445 TTAAAATGTGTATACTTGGCCGG + Intergenic
912971938 1:114291820-114291842 TTAAAAAGTATCTACTTCATGGG + Intergenic
913268649 1:117070750-117070772 TTAAAAATTGTGAACTTGGATGG + Intronic
914315429 1:146506944-146506966 TAAAAGAGTTTTTACTTGTTGGG - Intergenic
914326881 1:146626695-146626717 TAAAAAAGTTTGTGCTTGAAAGG + Intergenic
914498926 1:148226417-148226439 TAAAAGAGTTTTTACTTGTTGGG + Intergenic
915272672 1:154766307-154766329 TCAAAAAATTTTTAATTGGTAGG - Intronic
915812241 1:158925713-158925735 TTAAAAAGTTTTTTATTGTTTGG + Intergenic
915813915 1:158947139-158947161 TTAAAAAGATTGTATTCAGTTGG - Intronic
915958626 1:160244908-160244930 TTAATAAGTTTGAAGTTAGTTGG - Intronic
916089781 1:161298951-161298973 TTAAAGAGGTTGAACTAGGTTGG + Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916992456 1:170258907-170258929 TGAAAAACTGTGTACTTTGTAGG - Intergenic
917689233 1:177450290-177450312 TTCAAAAGATTGTGCTTGGATGG + Intergenic
918284035 1:183034565-183034587 TTAAAAAGTTTCAACTGGGCTGG - Intronic
919792080 1:201298479-201298501 CTAAGAACTTTTTACTTGGTAGG - Intronic
920530879 1:206701530-206701552 TTAAAAAGTATTTAGTTTGTAGG + Intronic
923324570 1:232869923-232869945 TTAAAAAATTCATGCTTGGTTGG + Intergenic
924119291 1:240780148-240780170 TTAAAAAGTGCTTACTTGGCTGG + Intronic
924703197 1:246475018-246475040 TTAAAAAGTTTGTACTTGGTCGG + Intronic
1064689252 10:17897146-17897168 TGAAAAAGTTTTTAAATGGTTGG - Intronic
1065382328 10:25102773-25102795 TTAAAAAAATTGTTCTGGGTGGG + Intergenic
1066500167 10:35985266-35985288 TTAAAAAGTATGAACTTATTGGG + Intergenic
1068131424 10:52900240-52900262 TTACAAAGTTTGTGCCTCGTAGG - Intergenic
1068480401 10:57581762-57581784 TTTAAAAATTTGTATTTGTTTGG + Intergenic
1068562269 10:58528116-58528138 TTAAAAAGTTTGTTCATTTTGGG + Intronic
1068567265 10:58589768-58589790 TTAAAAAATTTGTAATGGCTGGG - Intronic
1069279088 10:66630947-66630969 TTAAATAGATTGTGCTTGTTGGG - Intronic
1069333290 10:67318912-67318934 TTAAAAGGTTGGTCCTTGGCTGG + Intronic
1070352367 10:75605437-75605459 CTAGAAAGTTTGTACATTGTGGG + Intronic
1073162081 10:101407020-101407042 TTTAAAAGTATATACTTGGTTGG - Intronic
1073301379 10:102473120-102473142 TTAAAAAGATTGTCCCTGGCTGG - Intronic
1073938647 10:108666901-108666923 TTAAAAAGTTTGTGCTGTTTTGG + Intergenic
1074223857 10:111464148-111464170 TTTAAATGTCTGTATTTGGTGGG - Intergenic
1074660786 10:115654948-115654970 TTAGAATGTTTGTTCTGGGTAGG + Intronic
1080139023 11:28892168-28892190 TTATAAAATTTGAACATGGTTGG - Intergenic
1080241830 11:30135656-30135678 TAAAATAGTGTGTACTTGGGAGG - Intergenic
1081347212 11:42004170-42004192 TTAAAAAGTTTGTTCTTTGGAGG - Intergenic
1081393706 11:42560182-42560204 TAAAAAAATTTGCACTTAGTAGG - Intergenic
1081694218 11:45098414-45098436 TTGAAAAGCTTGGACTTAGTCGG + Intronic
1082898326 11:58217259-58217281 TGAAAAAGTTAGTACTTGCTTGG + Intergenic
1083357241 11:62075902-62075924 TTAAAAAATATTAACTTGGTTGG + Intergenic
1085798936 11:79569586-79569608 TTAAAAAGTTTGGACTTTTGGGG + Intergenic
1087274333 11:96145709-96145731 TTAAAAATTGTATACTTGTTCGG + Intronic
1087295154 11:96363248-96363270 TTAAAAAGATTGTGCTTGGCCGG - Intronic
1087827146 11:102778403-102778425 TTTACAATATTGTACTTGGTGGG + Intronic
1088138649 11:106588569-106588591 TTCAAAAGTTTGTACATGTATGG + Intergenic
1088298423 11:108327536-108327558 TAAAAATGTTTTTCCTTGGTGGG - Intronic
1088494543 11:110420014-110420036 TTAAGAAATTTGCACTTGGCTGG - Intergenic
1088937087 11:114413195-114413217 TTAGAAACTTTGTACTAGGCTGG - Intronic
1089132275 11:116222066-116222088 TTATACAGTTTGTACTCAGTAGG + Intergenic
1089733392 11:120533579-120533601 TTCAAAAGTTTTAACTTGGCTGG + Intronic
1090528692 11:127565655-127565677 TTAAAAAGATTCTAAGTGGTGGG - Intergenic
1093696859 12:22170558-22170580 TTAAAAAGTTTCTCATTGGCTGG - Intronic
1094633544 12:32201951-32201973 TTAAAGTGTCTGTATTTGGTTGG + Intronic
1096350339 12:50893497-50893519 TTAAAAAGGATGTAGTTGGCCGG + Intergenic
1097672911 12:62561780-62561802 TTAGAATGTTTTTACTTTGTTGG - Intronic
1098518677 12:71409701-71409723 TTAAAAAGTTTTTGCTTGGCTGG - Intronic
1099552996 12:84071869-84071891 AAAAAAAGTCTGTACTTGATTGG + Intergenic
1099747380 12:86722584-86722606 TTAAAAACTATTGACTTGGTAGG - Intronic
1099962635 12:89411467-89411489 TGAATAAGTTTGTACTGGATTGG + Intergenic
1100252732 12:92845936-92845958 ATAAAAAGTTTGCACTTCCTTGG + Intronic
1101335236 12:103790983-103791005 TTAAAAATGATGTACTTGGCCGG - Intronic
1102070021 12:110010942-110010964 TTAAAAAGTTTTTACAGGCTGGG + Intronic
1102237377 12:111302579-111302601 TTAAAAAATTTCTACCTGGAAGG - Intronic
1103114427 12:118314035-118314057 TTAAAAGGTTTGCATTTTGTGGG - Intronic
1104210235 12:126681949-126681971 TTAATAGGTTTGTGCTTGTTTGG - Intergenic
1104303020 12:127582818-127582840 TGAAACAATTTGTATTTGGTAGG + Intergenic
1106687906 13:32081175-32081197 TTAAAAATTTTTTTCTTGTTTGG - Intronic
1107339484 13:39390677-39390699 TTAAAAAGTTTTTATTTGTATGG - Intronic
1107765429 13:43729482-43729504 TTAAAAACTCAGTTCTTGGTGGG - Intronic
1108287559 13:48923684-48923706 TTAAAAAGTGTGCCCTGGGTGGG - Intergenic
1109595262 13:64544622-64544644 TGAAAATGTTTATACTTGGGTGG + Intergenic
1109596193 13:64557528-64557550 TTTAAAAGTATGTTCTTGGATGG + Intergenic
1109599303 13:64602449-64602471 TTAAAAAGCTTGTATTTGCTAGG + Intergenic
1109886000 13:68545849-68545871 TTAAAAAGATTCTACTTTCTAGG - Intergenic
1110265930 13:73537610-73537632 TTAATAAAATTTTACTTGGTTGG + Intergenic
1112390693 13:98981356-98981378 TAAAAAAATTTTTACTTGCTTGG - Intronic
1113326409 13:109285971-109285993 TTTAAAATTTTATACATGGTGGG - Intergenic
1113364459 13:109663248-109663270 GTAAGTAGTTTGTACTTGTTAGG + Intergenic
1114419478 14:22569136-22569158 TTAAAAAGTGTTTATTTGGCCGG + Intronic
1114831299 14:26145144-26145166 TTAATAAGTTTGTCCATGTTTGG - Intergenic
1115246792 14:31303908-31303930 TTAAAGAGTATGGACTTGCTGGG + Intronic
1115443885 14:33467067-33467089 TCATAAAGTTGTTACTTGGTTGG + Intronic
1116071052 14:40046458-40046480 TTAAAAAGTTTGGATTTCTTGGG + Intergenic
1116575126 14:46564623-46564645 TTAATCAGTATGTACTTGGTTGG + Intergenic
1116597939 14:46877073-46877095 TTAGAAAGTTGGTATTTGATGGG - Intronic
1117395096 14:55301138-55301160 TTAAAAAGAGTGTTCTTGGCTGG + Intronic
1117426250 14:55600818-55600840 TTAAAAAGTTATTACTTTTTTGG + Intronic
1117740813 14:58817267-58817289 TAAAAAAGTTTGTTTTCGGTGGG + Intergenic
1118806137 14:69238559-69238581 GAAAAAAGTTTGTACATGTTTGG + Intronic
1119464254 14:74842092-74842114 TTAAACACTTACTACTTGGTTGG + Intronic
1120951494 14:90046006-90046028 TCAAGGAGTTTGCACTTGGTAGG + Intergenic
1121632963 14:95434178-95434200 TTAAATATTTTGTCCTTAGTGGG - Intronic
1122334807 14:100965451-100965473 TAAAAAAGTTTGTAATAGGCTGG + Intergenic
1122396413 14:101435857-101435879 GTAAATAGTTTGGACTTTGTGGG - Intergenic
1123925320 15:25103407-25103429 AGAAAAAGTCTGTACTTGGCTGG - Intergenic
1124457399 15:29856889-29856911 AAAAAAAGTTTGTACATGTTTGG - Intronic
1125062770 15:35444115-35444137 TTAAAAAGGTTGTTTTTGTTGGG - Intronic
1125129205 15:36261503-36261525 TTATAAAGTTTGTTCATAGTTGG - Intergenic
1125150329 15:36523523-36523545 TTTAAAAGGTTGTTCTTGGCAGG - Intergenic
1125400507 15:39297520-39297542 ATGAAAAGTTTGAACTGGGTGGG + Intergenic
1126446761 15:48755298-48755320 TCAATACCTTTGTACTTGGTTGG + Intronic
1127366818 15:58299163-58299185 TTAAGAAATTTGTCTTTGGTGGG + Intronic
1128375727 15:67073967-67073989 TTAAAATGTTTGTATGTGGCCGG - Intronic
1131079157 15:89519925-89519947 TTGAAAAGTTTATTCTTGGCTGG - Intergenic
1131213260 15:90516064-90516086 TTAAAAACTTTTTATTTGGCTGG - Intergenic
1131641368 15:94297741-94297763 TTAAATATTTTAGACTTGGTGGG - Intronic
1134279004 16:12801777-12801799 TTAAAAAGGGATTACTTGGTGGG + Intronic
1135418942 16:22291337-22291359 TTCAAAGATTTATACTTGGTAGG + Intergenic
1135709813 16:24706413-24706435 TTAAAAGTTTAGTACTTGGCCGG + Intergenic
1136619322 16:31417646-31417668 TTGAAAAGTCTGTCCTTGGCCGG + Intronic
1137860594 16:51842568-51842590 ATAAACAGGTTGTACTTGGAGGG - Intergenic
1138065578 16:53937700-53937722 TTAAAATGTTTCCCCTTGGTAGG - Intronic
1138954674 16:61956633-61956655 TTAACAAGTTTGTATTTCCTTGG + Intronic
1140688824 16:77461494-77461516 TTAAAAATTATGTACTTTTTAGG - Intergenic
1140751860 16:78031899-78031921 TTACAAAGTTTAGACTTGGAGGG + Exonic
1140769767 16:78192743-78192765 TAAAAAAGTTTTTATTTGTTTGG + Intronic
1144811275 17:18001205-18001227 TTAAAAAGTTATTACCTGGCTGG + Intronic
1146073722 17:29708290-29708312 TTAAAAAGTCTGTTCTTGCTAGG + Intronic
1147315946 17:39620295-39620317 TTAAAAATTTTGTCCCTGATAGG + Intergenic
1148289619 17:46432958-46432980 TTAAAAAGTTAGTTTTGGGTTGG + Intergenic
1148311787 17:46650530-46650552 TTAAAAAGTTAGTTTTGGGTTGG + Intronic
1149194283 17:54101594-54101616 TTAAAAAGTTTCAACTTGGCTGG - Intergenic
1149392385 17:56204778-56204800 TTAAAAACTTTGTACTGGCTGGG + Intronic
1150548266 17:66185515-66185537 TTAAAAAGTTTAAATTTGGCGGG - Intronic
1150636960 17:66919752-66919774 TTAAAAAGCGTGGACTTGGCAGG - Intergenic
1150796539 17:68242707-68242729 TTTAAAAATATGTGCTTGGTTGG - Intergenic
1152917041 17:83045042-83045064 TTTAATAGTTTGTTCTTTGTGGG - Intronic
1152967232 18:128324-128346 TTACAATGTTTGTTCTAGGTTGG - Intergenic
1153161538 18:2210317-2210339 GTAAAAAGTTTCTACCTGATGGG + Intergenic
1153163367 18:2234157-2234179 TTAAAAAATTTGTTTTTGATTGG - Intergenic
1154382406 18:13864325-13864347 TTAGAAAGTTTGTAATGTGTTGG + Intergenic
1154926754 18:20943729-20943751 TTACAATGTTTGTTCTAGGTTGG + Intergenic
1155447426 18:25927022-25927044 TTAAAAAGACTGTACTGGCTGGG + Intergenic
1155545838 18:26913927-26913949 ATAAAAAGTTTGTTCTTACTTGG + Exonic
1155868501 18:30996451-30996473 TTGAAAAGTTTGTAATTGTGAGG + Intronic
1155940881 18:31800866-31800888 TTAAAATGTTTGTACAGGGCCGG + Intergenic
1157460208 18:47885023-47885045 GTAAAAAGTTTGTATTTGGAAGG - Intronic
1158359998 18:56661266-56661288 TTAAAAAGTAAGGTCTTGGTGGG + Intronic
1160047028 18:75395909-75395931 TTAAAAGGTTTGTTTTGGGTTGG - Intergenic
1160211781 18:76887075-76887097 TTAAAAAGATTCTACTGGCTGGG + Intronic
1163910870 19:20191173-20191195 TTAAAAATTATGCACTTGGCTGG + Intronic
1164812759 19:31171062-31171084 TTAGAAAATTTACACTTGGTGGG + Intergenic
1166371749 19:42305572-42305594 TTAAAAATTTTTTTCTCGGTTGG - Intronic
925155271 2:1644194-1644216 TGAAATAGTTTGTAATAGGTAGG + Intronic
925826114 2:7849940-7849962 TTAAAGTGTTTTTACTTGGTTGG + Intergenic
925986575 2:9220676-9220698 TTAAAAAATTTGTCCTTTGAAGG - Intronic
926530584 2:14040028-14040050 TTAACAAGCTTGTAAGTGGTAGG - Intergenic
927184228 2:20470637-20470659 TCAAGAACTTTGTTCTTGGTGGG + Intergenic
927773543 2:25884392-25884414 TTTAAAAGTGTGTAGTTGGCCGG + Intergenic
928037839 2:27842221-27842243 TTAAAAAGTTTGTTATTTGCTGG + Intronic
928587515 2:32775847-32775869 TTTGAAACTTTTTACTTGGTTGG + Intronic
929842498 2:45483950-45483972 TTGAAAAGTTTATACTAGTTGGG - Intronic
929952207 2:46421830-46421852 TAAAAAATATTGTACTTGGCTGG + Intergenic
930682514 2:54272139-54272161 TTAATAATTGTATACTTGGTAGG - Intronic
930726525 2:54687059-54687081 TTAAAATGTTTGCATTTTGTAGG - Intergenic
931422186 2:62138480-62138502 TTAAAAACTGTGTACTAGGCCGG - Intronic
931518060 2:63063577-63063599 TTAAAAAATTTGTTATTGGTGGG + Intergenic
932958419 2:76383439-76383461 TTTAAATGTGTGTCCTTGGTGGG + Intergenic
933125857 2:78604460-78604482 TTAAAAACTTTGAAATTGGCAGG + Intergenic
933144252 2:78831851-78831873 GTGAAAAGTTAGAACTTGGTGGG - Intergenic
933669617 2:84994242-84994264 TTAAAATGTTCATACTTGGCCGG - Intronic
933856510 2:86419422-86419444 TAAACAAATTTGTACCTGGTTGG - Intergenic
934982453 2:98854991-98855013 TTAAAAAGAATGTTCTTGGCTGG + Intronic
936052956 2:109239455-109239477 CTAAAAAGCTTTTACTTGATTGG - Intronic
936881669 2:117259561-117259583 TTTAAAAGTTTTAACTAGGTTGG - Intergenic
937329164 2:121014386-121014408 TTAAAAAGTTTGTGCTTCAAGGG + Intergenic
937569600 2:123340234-123340256 TTAAACAGTATGTACTTTTTTGG - Intergenic
937945358 2:127330074-127330096 TAAAATGTTTTGTACTTGGTAGG - Intronic
940778880 2:157912286-157912308 TTAAAAATTTTGTTCTTGGCTGG + Intronic
941761210 2:169245990-169246012 TACAAAAATTTGTACTTGGGAGG - Intronic
942509498 2:176682203-176682225 CTAAAAAGTTTGAACATGATGGG + Intergenic
942680331 2:178471707-178471729 TTAAAATGTTTGTCCTTGGAAGG + Intronic
943503873 2:188728869-188728891 TTCAAAAGTTTCCACTAGGTAGG - Intergenic
943839967 2:192567216-192567238 TTAAACAGTTTGCAGATGGTGGG + Intergenic
944752009 2:202718576-202718598 TTAAAAATTTTGTTGTTGGTTGG + Intronic
945545739 2:211149278-211149300 TTACAAAATTTAAACTTGGTGGG + Intergenic
945632623 2:212301066-212301088 TTAAGTAGTTAGTACTTGGCTGG + Intronic
945645794 2:212491251-212491273 TTAAAAAGTTTATACATAATAGG - Intronic
946753973 2:222924255-222924277 TTTAAAAGTTTGATCTTGATAGG + Intronic
947424636 2:229972296-229972318 TTAAAAATTGCATACTTGGTAGG - Intronic
947695749 2:232186958-232186980 TTAAAAATTTTGTGCTTTGAAGG + Intronic
948420843 2:237859369-237859391 TTAAAAAGTGTTTATTTGCTCGG + Intronic
1168871008 20:1128479-1128501 TTAATAGGTTTGTTCTTGGTAGG - Intronic
1169422699 20:5472611-5472633 TTAAAAAGTTTGAAGTTTGCTGG - Intergenic
1169426721 20:5502864-5502886 TTAAAAAGTTTGAAGTTTGCTGG + Intergenic
1169705320 20:8496781-8496803 AACAAAAGATTGTACTTGGTAGG - Intronic
1169847169 20:10006810-10006832 CAAAAATGTTTGTATTTGGTTGG - Intronic
1174763916 20:53233907-53233929 TTAAAAAGTTTTTAATTGCTTGG - Intronic
1175016718 20:55799399-55799421 TTTAAAAGTTTGTACATGTTCGG + Intergenic
1177049470 21:16214181-16214203 TTAAATAGTATGCACTTGGAGGG + Intergenic
1177366231 21:20141807-20141829 TTAACAGTTTTGTACTTGTTGGG - Intergenic
1177407734 21:20692142-20692164 TTACAAAGATAGTACTTGGAAGG + Intergenic
1178261683 21:31105851-31105873 TTTACAAGTTTGAACTTGTTGGG - Intergenic
1178591854 21:33917481-33917503 TTAAAAAGTTTTTAGGGGGTTGG - Intergenic
1182699811 22:32227470-32227492 TTTAAAAGACTGTACTTTGTTGG - Intronic
1184144520 22:42601464-42601486 TTAAGAAGTTTCTTCTTGGCTGG + Intronic
949465451 3:4339023-4339045 ATAAAGAGTTTGAACTTGGTTGG - Intronic
951740074 3:25911878-25911900 TGAAAAAGTGTGTCATTGGTGGG + Intergenic
952134999 3:30408604-30408626 TTGGAAAGTTTACACTTGGTGGG - Intergenic
954922089 3:54200033-54200055 TTAAATAGTTTCCACTTTGTAGG - Intronic
955353692 3:58212626-58212648 TTATAAAATGTGCACTTGGTAGG + Intronic
956170508 3:66430218-66430240 TTTAAAAGTTTTTAATTGGATGG - Intronic
957669208 3:83279438-83279460 TTAAAAAGTTTTTGTTTTGTTGG + Intergenic
957877624 3:86169622-86169644 TCATAAAGTTAGTAATTGGTAGG - Intergenic
957882004 3:86228874-86228896 TTAAAAATGTTGTCATTGGTTGG + Intergenic
959608702 3:108269823-108269845 TTAAATATTTTGAACTTGGCTGG + Intergenic
960061601 3:113328562-113328584 TTAATTAGTTTGTACATGATAGG + Intronic
960232637 3:115246000-115246022 TTAAATAGTTTCTACCTGGATGG - Intergenic
960450021 3:117795123-117795145 TTAAAAATCCTGTTCTTGGTGGG - Intergenic
960477645 3:118148766-118148788 TTAAAAATTTTGTTTTTGTTGGG + Intergenic
961186832 3:124922458-124922480 TTAAAATGGTTGTGCTAGGTTGG - Intronic
962167196 3:133061795-133061817 TTATAAAATTTCTCCTTGGTGGG - Intronic
963459671 3:145594106-145594128 TTTTAAACTTTGTACTTGTTAGG - Intergenic
963636725 3:147807211-147807233 TTAAAAACTGTCTACTGGGTAGG + Intergenic
964034316 3:152177533-152177555 TCAAAAAGTTTGTACTTTTAGGG + Intergenic
964065486 3:152573516-152573538 CTAAAAAGTTGGTTCTTGGGAGG - Intergenic
964334594 3:155641728-155641750 TTAAAAATTTTTTATTTGTTTGG - Intronic
964655295 3:159060207-159060229 TTAAATAGCTTGTCCATGGTGGG + Intronic
965698193 3:171431373-171431395 TTAAAAAGAATGTACTTGTATGG - Intronic
966609463 3:181853976-181853998 TTAAAAAGTGTCTCCTTCGTTGG - Intergenic
967637166 3:191816385-191816407 TTAAAATGTGTGATCTTGGTTGG + Intergenic
968770088 4:2499858-2499880 ATTAAAAGTTTGTCCTTGGCCGG + Intronic
969666838 4:8562935-8562957 TTAAAAAATTTTTGCTTGGCTGG + Intronic
969994078 4:11293691-11293713 TTAAAAATATTTTACTTAGTAGG - Intergenic
971711202 4:30114787-30114809 TTAAAATGTTCGTATTTGGCTGG - Intergenic
972546675 4:40086629-40086651 TTAAATATTTTTTATTTGGTCGG - Intronic
972662947 4:41134275-41134297 CTAAAAAGTTTGTCCTGGCTGGG - Intronic
974991117 4:69092110-69092132 GTAAAATGTTTGTACTGAGTAGG + Intronic
976533011 4:86177432-86177454 TTAAAAATTTTATACTTCATTGG - Intronic
976955112 4:90886976-90886998 TTAAAATGTTTTCATTTGGTAGG - Intronic
977791526 4:101110127-101110149 TTAAAAATTTTGTGCTTGAATGG + Intronic
979030841 4:115644037-115644059 TTAAAAAGATCATACTTGGAAGG + Intergenic
979308914 4:119179083-119179105 TTACAAAGTTTTTAGTTGGAAGG - Intronic
981118720 4:141022474-141022496 TTGAAAACTTTTTATTTGGTTGG + Intronic
981635299 4:146870931-146870953 TTAAAAAGTTTGTAAAAGATTGG - Intronic
982014463 4:151139475-151139497 TTAAAAAGTTTGTGACTGGTAGG + Intronic
982386456 4:154809989-154810011 TTTAAAAGTTACTACTTGGAGGG + Intronic
982446524 4:155496947-155496969 TAAAAAATTTTGTAGGTGGTAGG + Intergenic
983386114 4:167064191-167064213 TTAAAAAATTTGAAATTGGTGGG - Intronic
983517331 4:168671916-168671938 TTAGAAAGTTTCTAATTTGTAGG - Intronic
983744528 4:171180977-171180999 TTAAATACTTTTTTCTTGGTGGG + Intergenic
984641543 4:182170464-182170486 TTATAAAGTTTGAATTTGGCAGG - Intronic
984649528 4:182255288-182255310 TTACAAAGTTTGTGCTTTGGGGG - Intronic
984740304 4:183155113-183155135 TAGAAAAGTTAGAACTTGGTAGG + Intronic
984765817 4:183399624-183399646 TTTAAAATTTTGTATTTGGTCGG - Intergenic
988050131 5:26016982-26017004 TTAGAACGTTTGTACATGGTTGG + Intergenic
988074964 5:26340540-26340562 ATAAAAAGTTGGTATTTGTTTGG - Intergenic
992444826 5:76824105-76824127 TATAAAAGTTTGTACAGGGTCGG - Intronic
992697069 5:79300112-79300134 TTAAAAAATTTCTAGCTGGTGGG - Intronic
992920643 5:81514082-81514104 GTAAAAAGTTTGAAGATGGTGGG + Intronic
992970501 5:82051852-82051874 TAGAAAAGTTTATACTAGGTAGG - Intronic
993533774 5:89055763-89055785 TTAAAAACTTTGTCATTGGATGG + Intergenic
994025040 5:95072402-95072424 TGAAAAAGCTTGTACTATGTAGG - Intronic
994370301 5:98959891-98959913 TTAAATAGTATGTACTGGCTGGG - Intergenic
995203270 5:109449834-109449856 TTTAAAAGTTTGTTATTGGCTGG - Intergenic
995500796 5:112804672-112804694 TTAAAAAAGTTGTAATTGGCCGG - Intronic
996421239 5:123265215-123265237 TTAAATAGTTTGCATTTGTTGGG - Intergenic
996771781 5:127093906-127093928 TTCAGTGGTTTGTACTTGGTGGG - Intergenic
997670992 5:135671868-135671890 TTAAAAAGTTAATTCTGGGTGGG - Intergenic
998220751 5:140276918-140276940 TTAAAAAGTTTGAACTGGTTGGG + Intronic
998481360 5:142465889-142465911 TTAGCAAGTGTGTTCTTGGTAGG + Intergenic
998653691 5:144150644-144150666 TTAAATATTTTGTCCTTGGCTGG - Intergenic
999180568 5:149667265-149667287 TTAAGAACTTTGAACTTGGCAGG - Intergenic
999308516 5:150536187-150536209 TTAAAAATTTTTTTCTTGGCTGG + Intronic
999336208 5:150719114-150719136 TTAAAAAGTTTTTATAAGGTCGG - Intronic
1000988994 5:167892637-167892659 TTGAAAAGTGTGTACTTAGTAGG + Intronic
1001357462 5:171042946-171042968 TAAATAAGATTGTACTTAGTGGG + Intronic
1002689654 5:181041766-181041788 TTAAAAAGTCTGTATTTGAAAGG - Intronic
1003223471 6:4182914-4182936 TTAAAGAGTTTGTATTTGATTGG + Intergenic
1004377737 6:15105225-15105247 TTAAAAAGTTAGAATGTGGTAGG - Intergenic
1005158021 6:22830243-22830265 TTAAAATGTCTGTATTTGTTAGG + Intergenic
1005296422 6:24431829-24431851 TTAAAAAGTTTAACCTTGGCTGG - Intronic
1006759126 6:36443520-36443542 TTAAAAATTAGGTAGTTGGTGGG + Intronic
1008164398 6:48118289-48118311 TTAAATAGTGTTTACTTTGTGGG - Intergenic
1008624364 6:53303141-53303163 TTAAAAAGATTTTTCTAGGTTGG + Intronic
1008887720 6:56449428-56449450 TTAAAAAATATGTGCTTGGCCGG + Intergenic
1010979895 6:82359815-82359837 TTAAAAAGTCTGTACATGTTTGG + Intergenic
1011777365 6:90746889-90746911 TTAAAAAATTTGTATTGAGTAGG + Intergenic
1014135091 6:117879714-117879736 TTAAAAAGTCTATAGTTGGCTGG - Intergenic
1014853144 6:126365923-126365945 TTAAGCAGTTTGTTCTTAGTGGG + Intergenic
1014881014 6:126724624-126724646 TTTAACAGTTAGTACATGGTTGG + Intergenic
1015592606 6:134836839-134836861 TTAAAAACTTTTTATTTGGATGG - Intergenic
1016023822 6:139263853-139263875 TTACATAATTTGAACTTGGTAGG - Intronic
1016040453 6:139427222-139427244 TTGAAGAGTTTGTACCTGGTTGG - Intergenic
1016052593 6:139545455-139545477 TTCAAAAGTTTGTGTTTGTTTGG - Intergenic
1016467877 6:144344781-144344803 ATAAAACGTTTGTACTTTGGGGG + Intronic
1017944548 6:159083958-159083980 TAAAAAAGTTTCTACTTGTTTGG + Intergenic
1019158367 6:170053503-170053525 TGATACAGTTTGTGCTTGGTGGG - Intergenic
1021704633 7:23354678-23354700 TTAAAAAGATTTTTCTTTGTGGG + Intronic
1021928092 7:25552551-25552573 TTAAAAAAATTGTAATTGGATGG + Intergenic
1023003268 7:35834979-35835001 TTAAACTCTTTGTACTTTGTTGG + Intronic
1023567131 7:41534362-41534384 TTTAAATGTTTTTATTTGGTGGG - Intergenic
1024742210 7:52366515-52366537 TTAATAAGTTTCTAGATGGTAGG + Intergenic
1025076198 7:55945336-55945358 TTAAAAAGTACATACTTGGCTGG - Intergenic
1025076730 7:55950353-55950375 TTAGAAAGTTTGTTTTTAGTCGG + Intergenic
1025754034 7:64317091-64317113 TTAAAAAATTTCTACTTTGTAGG + Intronic
1026169590 7:67942610-67942632 TTAAAATGCTTGTATTAGGTCGG + Intergenic
1027679975 7:81208063-81208085 CTAAGAAGTTTGTTCTTCGTCGG + Intergenic
1027858863 7:83549101-83549123 ATCAAAAGTTTCTATTTGGTTGG - Intronic
1030611153 7:111690589-111690611 TTAAGAAGTTTGTTATGGGTGGG - Intergenic
1031001140 7:116416148-116416170 TAAAAAAATATGTACTTTGTCGG + Intronic
1031507946 7:122609821-122609843 TTCAACAGTTTGTGCTTTGTTGG - Intronic
1032655301 7:133922548-133922570 TTAAAAAATTTATACATGGCCGG + Intronic
1033667517 7:143456378-143456400 TCAAAAACATTGCACTTGGTTGG - Intergenic
1036663489 8:10723624-10723646 TTAAAAAGTTGTTATCTGGTAGG - Intergenic
1037180360 8:15997306-15997328 TTTAAAAGTTTATACTCGGCCGG - Intergenic
1038290266 8:26242826-26242848 TTAAAAAATTTTACCTTGGTGGG + Intergenic
1039070114 8:33642063-33642085 TTAAACAGTTTCCACTTGCTTGG + Intergenic
1041254102 8:55964568-55964590 TTAAAAAGTACATACTTGGCTGG + Intronic
1041303349 8:56435675-56435697 TTAAAGAGTTTGTACTAGGCTGG - Intergenic
1041709650 8:60882146-60882168 TAAGAAAGTTTGCACTTGGCTGG - Intergenic
1041985220 8:63914482-63914504 TTTTAAATTTTGTATTTGGTTGG - Intergenic
1042311895 8:67387221-67387243 TTAAAAAGATTCTTCTTGATAGG - Intergenic
1043004720 8:74804695-74804717 TTTAAAAATTTGTACTTACTGGG + Intronic
1043189916 8:77205731-77205753 TTAAAAATTTTGTATTTAATAGG - Intergenic
1043878630 8:85515788-85515810 ATCAACAGTTTGAACTTGGTAGG + Intergenic
1044455653 8:92389975-92389997 TTAAACATTTTTTAGTTGGTGGG + Intergenic
1044841710 8:96342730-96342752 TTAAACAGTTTGTTAGTGGTAGG - Intergenic
1045170372 8:99659978-99660000 TTAAAAAGTCTGTTGCTGGTAGG - Intronic
1045209304 8:100079189-100079211 TTAAAAATTTTTTACTAGGTGGG - Intronic
1045782538 8:105884628-105884650 TTTAAAATTTTGTAGTTAGTAGG - Intergenic
1045830207 8:106450278-106450300 TTAAGAAATGTGTACTTGGGAGG - Intronic
1046036165 8:108843969-108843991 TATACAAGTTTGAACTTGGTGGG - Intergenic
1046402357 8:113720413-113720435 TTAAAAATTTTGTCTTTGGTAGG + Intergenic
1046462000 8:114551672-114551694 GTAAAAAGTTTGTACTAGTATGG + Intergenic
1048155795 8:131949506-131949528 TTAAAAAGTTTCTTTTGGGTTGG + Intronic
1048704061 8:137130605-137130627 TTATATAGTGTGTACTTGGAAGG + Intergenic
1051093304 9:13435898-13435920 ATAAGTATTTTGTACTTGGTTGG + Intergenic
1052278856 9:26709859-26709881 TTAAAAAATGTGTATTTGGTTGG - Intergenic
1052570418 9:30214252-30214274 TGAAAAAGTATGTGCTAGGTAGG - Intergenic
1053213454 9:36251409-36251431 TTAAAAAGTTTTTACATTTTTGG + Intronic
1056062986 9:82903709-82903731 TTAAAAAAAATGTCCTTGGTGGG - Intergenic
1057743953 9:97736775-97736797 ATAAAAAGTATTTACTTAGTTGG + Intergenic
1058559254 9:106206892-106206914 ATAAAAATGTTGTAATTGGTCGG - Intergenic
1058614909 9:106815730-106815752 TTTAAGATTTTGTACTTCGTAGG - Intergenic
1059070233 9:111127780-111127802 TTAAAATGATTTTGCTTGGTTGG + Intergenic
1060174589 9:121488014-121488036 ATAAAAAGTCTATACCTGGTAGG - Intergenic
1060713930 9:125902434-125902456 TTAAAAATTTAATACTTGGCAGG - Intronic
1061468884 9:130806852-130806874 TTAAAAAATTTGTTTTTGGCTGG + Intronic
1186190339 X:7061782-7061804 TTATAAAATTTGAAGTTGGTGGG - Intronic
1187037210 X:15553331-15553353 TTACAATGATTGTACTTGCTGGG + Intronic
1187106687 X:16250414-16250436 TTTAAGGGTTTGTTCTTGGTGGG - Intergenic
1188653235 X:32657660-32657682 TTTAAAAGTCAGTATTTGGTTGG + Intronic
1189577009 X:42364763-42364785 TTTACAAGTTTGTATTTGGCTGG - Intergenic
1192625427 X:72722335-72722357 TTTAAAATTTTCTACTTGTTAGG - Intergenic
1193115656 X:77772781-77772803 TAAAAAAGTTTGTTTTTGGCTGG - Intronic
1194827958 X:98585630-98585652 TTTTAAAGTTTTTATTTGGTTGG - Intergenic
1197842331 X:130762284-130762306 TTAAAATTTTTATACTTGGTTGG + Intronic
1198893678 X:141427242-141427264 TTAAAAAGTTTTAAATTGGGGGG - Intergenic
1199246669 X:145612998-145613020 TTAAAAAGTTTATAGCTGGCTGG + Intergenic
1200313497 X:155105185-155105207 TTAAAAAGTTTGTGTTAGGTGGG + Intronic
1200869368 Y:8080918-8080940 TTAAAATATTTCTACTGGGTTGG + Intergenic
1201338817 Y:12908980-12909002 TTAAAAAATCTGTACTGGGCTGG - Intronic