ID: 924706048

View in Genome Browser
Species Human (GRCh38)
Location 1:246503078-246503100
Sequence TGTTAAATGGGTTGAGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 288}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924706048 Original CRISPR TGTTAAATGGGTTGAGGGGA CGG (reversed) Intronic
900831922 1:4971599-4971621 TGCAAAATGGGTTGATGTGAAGG - Intergenic
901333838 1:8431564-8431586 TTTTCCATGGGCTGAGGGGAAGG - Intronic
901917280 1:12509539-12509561 AGTAAAGTGGGTTGAGGTGAGGG + Exonic
902287063 1:15413649-15413671 TGTCAAATGGGGAGAGGGGTTGG - Intronic
903261704 1:22135073-22135095 TGAGAGATGGGTGGAGGGGATGG + Intronic
903682748 1:25108044-25108066 TGTGAAACGGGTTCAGGTGATGG + Intergenic
903751066 1:25621075-25621097 TGTAAAATGGGGTGAGGGAGAGG + Intronic
904498108 1:30898799-30898821 TGTTAAATGGGAAGAGTGAATGG - Intronic
904899927 1:33848938-33848960 TGCAAAATGGAATGAGGGGAGGG + Intronic
905243825 1:36598641-36598663 TGTAAAATCTGTTTAGGGGAAGG - Intergenic
905289058 1:36908980-36909002 TGTTAAATGTAGTGAGTGGAAGG - Intronic
905707578 1:40073159-40073181 TGGTAAATGTGTTTTGGGGATGG + Exonic
905788243 1:40775052-40775074 TGATGATTGGGTTGAGGGCAGGG + Intergenic
905804157 1:40863811-40863833 TGTCAAATGCGTGGAGGGTAAGG - Intergenic
905925903 1:41749628-41749650 TGTTCCGTGGGGTGAGGGGATGG - Intronic
906066055 1:42980883-42980905 TCTTAAAGGGGGTGAGCGGAGGG - Intergenic
906381987 1:45338658-45338680 TGTTAAATGAATTAATGGGATGG + Intronic
907950468 1:59178528-59178550 TGTCAAATGTGCTGAGGAGAGGG - Intergenic
908597687 1:65706194-65706216 TCTTAACTAGATTGAGGGGAAGG - Intergenic
911131273 1:94390679-94390701 TATTAACTTGGCTGAGGGGAAGG + Intergenic
916519967 1:165554765-165554787 TCTTATTTGGGTTGAGGAGAAGG - Intronic
916698641 1:167267190-167267212 TATTAAATGGGGTGGGGGGAAGG + Intronic
917617026 1:176756317-176756339 TGTTGAATAGGTTGAGGAGGAGG + Intronic
918607549 1:186446763-186446785 TGTTAAATGGGTTTTGGTAAAGG + Intronic
918632617 1:186736153-186736175 TATGACATGAGTTGAGGGGAGGG - Intergenic
918891898 1:190284519-190284541 TGATAAATGGGTAGAGGAGTTGG - Intronic
920439617 1:205970865-205970887 GGTTATATGGGTTCAGGGGTGGG + Intergenic
920597154 1:207283622-207283644 TGTTAATTTGGGGGAGGGGATGG + Intergenic
921687727 1:218109259-218109281 TGTTAAAAGAGTTGAAGGCAGGG - Intergenic
921754436 1:218837387-218837409 TGTTTAATGGGTTTAAGGTATGG + Intergenic
921953901 1:220961904-220961926 TGTTGAAGGGGTTGGGGGGAAGG + Intergenic
923990114 1:239426966-239426988 TGAGAAATGGGTTGAAGGGAGGG + Intronic
924706048 1:246503078-246503100 TGTTAAATGGGTTGAGGGGACGG - Intronic
924749700 1:246874594-246874616 TGTTAAACAGGGTGAAGGGAAGG - Intronic
1064366534 10:14713579-14713601 TGTTAAGTGAATTGAGAGGAAGG + Intronic
1067542904 10:47169054-47169076 TGTTGAGTAGGTTGAGGAGAAGG - Intergenic
1068122113 10:52791751-52791773 TGTTGAATGGGCTGAGGAGGGGG + Intergenic
1069585470 10:69598075-69598097 TGATAAATGTGTTGATGGGATGG - Intergenic
1069720959 10:70549073-70549095 TGTTAAATGTGGGGAGGGGAAGG + Intronic
1069853155 10:71423579-71423601 TGGAGAATGGGATGAGGGGAGGG + Intronic
1071726724 10:88205756-88205778 TGTGAAATGGCTTCAGAGGAGGG + Intergenic
1072230735 10:93412088-93412110 TGTAAAATGGGGTGAAGGGTAGG - Intronic
1072288060 10:93935684-93935706 TGTGAAAAGGGTGGAAGGGAAGG + Intronic
1074285263 10:112091841-112091863 TGTAAGCTGGGTTTAGGGGATGG - Intergenic
1074382125 10:112989899-112989921 TAATAGATGGGGTGAGGGGAGGG + Intronic
1074443163 10:113496506-113496528 TCTCTAATGGGTTTAGGGGAAGG + Intergenic
1075202240 10:120414433-120414455 TATTAAATAGGTTGAGGGAAAGG - Intergenic
1076845024 10:133065718-133065740 TGGTGAATGGGTGGAGGGGTAGG + Intergenic
1077357814 11:2126860-2126882 TGGTAAGTGGGTGGATGGGATGG + Intergenic
1077699276 11:4425140-4425162 TGTTAATTGGGATGAGGTAAAGG + Intergenic
1078376599 11:10799621-10799643 TTATATATGGTTTGAGGGGATGG + Exonic
1078676010 11:13415033-13415055 TCTTAAATAGTTTGAGGGAAGGG - Intronic
1079086390 11:17448492-17448514 TACTAGATGGGCTGAGGGGAAGG - Intronic
1079150958 11:17898607-17898629 TGTGAAATTGTTTGAGGGGTAGG + Intronic
1081103834 11:39039314-39039336 TGTTAAAAGGATTGGGGAGAAGG + Intergenic
1081162924 11:39772920-39772942 TGGTAAATAGATTGAGGGGTGGG + Intergenic
1081792178 11:45795936-45795958 TGGTAAGTGGGTTGTAGGGAAGG - Intergenic
1082090079 11:48081755-48081777 TGTAAAATGGGTGGGGGGAAGGG + Intronic
1082826120 11:57580321-57580343 TCTTCCATGGGGTGAGGGGAAGG - Intergenic
1083065467 11:59919168-59919190 TGTTTAATGGGTTTAGAGGAAGG - Intergenic
1083269646 11:61565357-61565379 TGTGTTTTGGGTTGAGGGGAGGG - Intronic
1083484598 11:62975445-62975467 TGTGAAAGGAGTTGGGGGGAAGG - Intronic
1083552499 11:63600486-63600508 TGTCACAGGGGTTGAGGAGAGGG + Intronic
1083742089 11:64716472-64716494 TGTTATCTGGGTGGAGGGGCAGG + Intronic
1084070401 11:66729655-66729677 TATAAAATGGGTTGGGAGGAGGG + Intergenic
1085099546 11:73788863-73788885 TGTTAAATCTGTTAAGGGAACGG - Intronic
1085118202 11:73949181-73949203 AGTTAGCTGGGTTGAGGCGAGGG + Intergenic
1085658737 11:78342374-78342396 TGTTGAAGGGGTTTAGAGGAGGG - Intronic
1085866046 11:80294131-80294153 TGTTGAATGGGTAGATGGAAGGG + Intergenic
1086161588 11:83727665-83727687 TATAAAATGGGTGGAGTGGATGG + Intronic
1086420912 11:86636150-86636172 TGGTAAATGTGTTGGGGGCAGGG + Intronic
1088610265 11:111569889-111569911 TTGTAAATAGCTTGAGGGGAGGG - Intergenic
1088812710 11:113402267-113402289 GGTTTAATTGGTTGAGGGTAGGG - Intergenic
1089769601 11:120793740-120793762 AGGTAGATGGTTTGAGGGGAAGG + Intronic
1089769647 11:120793939-120793961 AGGTAGATGGTTTGAGGGGAAGG + Intronic
1090988924 11:131798616-131798638 TCTTAAATTGTTTGAGGTGAAGG - Intronic
1091209454 11:133844040-133844062 TTTTAAATGACTTGAGGGGTTGG - Intronic
1091686888 12:2568787-2568809 TGTTTAATGGGTTCTGGAGATGG + Intronic
1091801913 12:3329750-3329772 TGTTATAAGGGTAGATGGGATGG - Intergenic
1092459443 12:8673466-8673488 TGTTAGCTGGGCTGCGGGGATGG + Intergenic
1092795676 12:12108208-12108230 TGTAAAATAGGTTAAGGGTAGGG + Intronic
1094704228 12:32898757-32898779 TGTTAGGTGATTTGAGGGGAGGG + Intergenic
1096832834 12:54327785-54327807 TGCTAATTGGGTTTAGGGGGAGG - Intronic
1097176062 12:57143591-57143613 GGTTGACTGGGTTTAGGGGAAGG + Intronic
1097943213 12:65335691-65335713 TTTTAAAAGGGTTGAGGAGACGG - Intronic
1098507302 12:71268330-71268352 TGTTCCTTTGGTTGAGGGGATGG - Intronic
1099569237 12:84294423-84294445 AGTCAAATGGGGTGAGGTGAGGG + Intergenic
1101740759 12:107498068-107498090 TCTTCAATGGGCTGAGAGGAAGG + Intronic
1101818245 12:108162392-108162414 TGTGAAATGGGTTGGGGGGCTGG - Intronic
1102828305 12:115970022-115970044 TGGTAAATGGGATGAGGAAAAGG - Intronic
1103823763 12:123719691-123719713 TGTTAAAGGGGCTCAGGGGGAGG - Intronic
1105007848 12:132733968-132733990 TGTTAAATGGGTTGTGTGTCGGG - Intronic
1105759560 13:23501599-23501621 TGATAAATGGTTTGTGAGGAGGG + Intergenic
1106138090 13:26989667-26989689 TGCCAAATGTCTTGAGGGGAGGG - Intergenic
1106434168 13:29709048-29709070 TGTTAAATGGGCACATGGGATGG - Intergenic
1106736604 13:32593773-32593795 TGTTGAATAGGTTGAGGAGAAGG + Intronic
1106799100 13:33237672-33237694 AGTCAAATGGGTGTAGGGGATGG - Intronic
1106884264 13:34166625-34166647 TGTTTTATGCCTTGAGGGGAAGG + Intergenic
1107558689 13:41541468-41541490 TAATAAATGGTTTGGGGGGAAGG - Intergenic
1108152340 13:47549375-47549397 AGCCAAATGGGTTGTGGGGATGG - Intergenic
1108693991 13:52886665-52886687 TGTTAAAAGGCTTGATGGCAGGG + Intergenic
1109068785 13:57736270-57736292 TTCTAAATGAGGTGAGGGGAAGG + Intergenic
1109833787 13:67828381-67828403 TGTTAAATAGGTTAAGGGACAGG + Intergenic
1111630010 13:90838427-90838449 TGGTAAAGGTGTTGAGGGCATGG - Intergenic
1111872892 13:93856300-93856322 TGTCAAGTGGGTTGAGGATAAGG + Intronic
1113870111 13:113554085-113554107 TGTTCAAAGGATTGAGGGGTCGG + Intronic
1114582947 14:23780828-23780850 TATTAAATGGGTTCAGAGCAGGG - Intergenic
1115177995 14:30587342-30587364 TGAGAAATTGGTGGAGGGGAGGG - Intronic
1115215533 14:31010378-31010400 AGTTATATGGGGTGGGGGGAGGG - Intronic
1117920111 14:60720852-60720874 TCTGAATTGGTTTGAGGGGAGGG - Intronic
1118279090 14:64412316-64412338 TGATGAATGGGTTGAAGTGAGGG + Intronic
1118444326 14:65837943-65837965 GGTTAATTGGGTTGGGGAGAGGG - Intergenic
1119153979 14:72391566-72391588 TGTTAAATGGATAAAGGAGATGG - Intronic
1122058989 14:99124209-99124231 TGTTGAATGGGAGGAGGGGCTGG - Intergenic
1122225489 14:100274939-100274961 TGTTAAATGGGATGACTGCAGGG + Intronic
1122273093 14:100577211-100577233 TTATAAATGGGGTGTGGGGAGGG + Intronic
1122747818 14:103909982-103910004 TGTGAAATGGGGTGATGGTATGG + Intergenic
1126598717 15:50407172-50407194 TGCCAAATGGTTTGAGGGGAGGG + Intergenic
1127052674 15:55101121-55101143 TTTTAAATGGGATGATGGCAAGG - Intergenic
1129885755 15:79036019-79036041 TGGAAAACGGGTTGGGGGGAAGG - Intronic
1131724994 15:95211970-95211992 AGTTAAATGGGGTGAGGAGCAGG - Intergenic
1131887811 15:96937437-96937459 TGGTGAAGGGGATGAGGGGATGG - Intergenic
1132020721 15:98359664-98359686 TGTTGAATAGGCTGAGGAGAAGG + Intergenic
1133840078 16:9400020-9400042 TGGTATATGGGTTGACGGGTTGG - Intergenic
1134302218 16:13001853-13001875 TGATGAGTGGGTAGAGGGGAGGG + Intronic
1135219167 16:20598643-20598665 AGATAAATGCTTTGAGGGGATGG + Intergenic
1137777075 16:51065021-51065043 TGGTGAGTGGGGTGAGGGGACGG - Intergenic
1138521743 16:57575159-57575181 TGCTAAAGGGGTTCAGGTGAAGG + Intronic
1139733769 16:68969977-68969999 TCTTCAATGGGTGGTGGGGAGGG + Intronic
1140150487 16:72358795-72358817 TATTAATTTTGTTGAGGGGATGG + Intergenic
1140263944 16:73404191-73404213 AGCTAAGTGGGTTGAGGGGGTGG - Intergenic
1140759862 16:78100689-78100711 TGTAAAATGGGTTGATACGAGGG + Intronic
1140914843 16:79483995-79484017 TGTTAGATGGAGTGAGGGCAAGG + Intergenic
1142863098 17:2775472-2775494 TGTTAAGTGGGTGGTGGGGAGGG + Intergenic
1143762037 17:9111838-9111860 TGTTGAATAGGCTGAGGGGGAGG + Intronic
1145051044 17:19660984-19661006 TGTTAAATTACTTGAGGGGTGGG + Intronic
1145841306 17:27997205-27997227 TGGTAAATGAGTTGTGGGGCTGG + Intergenic
1146517427 17:33500216-33500238 TTTTGAATGGGGTGAGGGGCAGG + Intronic
1147276116 17:39318079-39318101 TTTTATATGGCTTGAGGGCAGGG - Intronic
1147722512 17:42547714-42547736 AGTTAAGAGGGTTGAGGAGACGG - Intergenic
1147883357 17:43668360-43668382 TTTTAAACGGGTTGTGGGGAGGG - Intergenic
1148398280 17:47328555-47328577 TATTATATGGGTTGTAGGGATGG - Intronic
1148951961 17:51321218-51321240 GGAGAAATGGGGTGAGGGGAAGG - Intergenic
1149424771 17:56544428-56544450 TTTTAAATGGGTTGGATGGATGG + Intergenic
1149883721 17:60319072-60319094 TGTTATGAGGGTTTAGGGGAAGG + Intronic
1150908134 17:69360530-69360552 GGTTGTATGAGTTGAGGGGAGGG + Intergenic
1153853535 18:9121220-9121242 TGTTTCATGGGTTGGGGGGAGGG - Intronic
1155692114 18:28637610-28637632 TGTTCAATGGGTTTAGAGTAAGG - Intergenic
1155779216 18:29810242-29810264 TGTTATATAGGTTAAGAGGATGG + Intergenic
1156399915 18:36730944-36730966 TGTTAAACTTTTTGAGGGGAGGG + Intronic
1156689680 18:39692474-39692496 TGATAGATGGTTTGAGAGGAGGG - Intergenic
1159262010 18:66026273-66026295 AGATATATGGGTTGTGGGGATGG + Intergenic
1159720438 18:71883345-71883367 TGGTAAATGAGTTTAGAGGAAGG - Intergenic
1161774408 19:6251266-6251288 TCTTAAAAAGGTTGGGGGGATGG + Intronic
1162591467 19:11595083-11595105 TTTTAAATGGGGTTAGGGGTTGG + Intronic
1162608241 19:11728506-11728528 TGTTATATGGGATGGGAGGATGG + Intronic
1163164032 19:15483108-15483130 TGTTGAATAGGCTGAGGGGGAGG - Intronic
1163605822 19:18274771-18274793 TGTAAAATGGCTAGATGGGAAGG + Intergenic
1166647249 19:44541279-44541301 TGTAAAATGGGGGGAGAGGAGGG - Intergenic
1168083668 19:54029239-54029261 AGTTATATGGGGTGAGGGGCGGG + Intergenic
1168120130 19:54247444-54247466 TGTGAAATGGGTTGGGGGGTTGG - Intronic
1168339936 19:55616984-55617006 TGTCTGATGGGATGAGGGGAGGG - Exonic
925716700 2:6790836-6790858 TGTTAAGTGGGTTGAGAAGCCGG + Intergenic
926779876 2:16460660-16460682 TGTGGAACGTGTTGAGGGGAAGG + Intergenic
927016562 2:18969445-18969467 GGATAAATGGGTTGGGGGCAGGG + Intergenic
930221008 2:48746725-48746747 TGTTAAATGGGTTTTGAGTAAGG - Intronic
933260625 2:80127454-80127476 TGTTAGATGGTTGGAGGGAAAGG - Intronic
935657220 2:105433967-105433989 TGCTAAATGTGTTGAGGGGTGGG - Intronic
936099314 2:109561344-109561366 TGTAAAATGGGTTGTGTGGGTGG - Intronic
936983552 2:118287156-118287178 TTTTAAAAGGGATGAAGGGAAGG + Intergenic
937433527 2:121861041-121861063 TGTTAAATGAATTGAGTGGTTGG - Intergenic
939137028 2:138308934-138308956 TGTTAAATGGATTGAGATTATGG + Intergenic
940023600 2:149181532-149181554 TGCTAGATGGGTTCAAGGGATGG - Intronic
940167469 2:150791065-150791087 TGTTAAATGACTTGAGGTTAAGG - Intergenic
941497016 2:166218253-166218275 TGTAAAATGGGGTGGGGGGAGGG + Intronic
941812357 2:169767747-169767769 TGTTAAATTGGTGGAGGAAATGG + Intronic
941992425 2:171570074-171570096 TGTTTAAGGGGTTTAGGGCAGGG + Intergenic
942749381 2:179270449-179270471 TTTTCCATGGGATGAGGGGATGG + Intergenic
943257968 2:185620577-185620599 TATTTAATAGGTTGAGGAGATGG + Intergenic
943547421 2:189298152-189298174 CCTTTAATGGGTTGAGGGTAGGG + Intergenic
943966524 2:194341098-194341120 TGTTCTAGGGGTGGAGGGGAGGG - Intergenic
946232868 2:218303435-218303457 CGGTGAATGGGTTGAGGGAATGG + Intronic
946438999 2:219679255-219679277 TCATAAATGGATTGAGGGCAGGG + Intergenic
1173076921 20:39828139-39828161 TGTTGAATGGGTTCATGGAAAGG + Intergenic
1173556165 20:43967446-43967468 GGTAAAATGGGTTGAGTGGTTGG - Intronic
1173737304 20:45371334-45371356 TGTAAAATGGATAGGGGGGACGG - Intronic
1174014436 20:47476409-47476431 TTCGTAATGGGTTGAGGGGAGGG - Intergenic
1175884503 20:62281617-62281639 TTTGAAATGGGCTGTGGGGACGG - Intronic
1177089628 21:16751343-16751365 TGTAAAATGTATTGAGGGGATGG + Intergenic
1178264522 21:31130484-31130506 TGATAAATACGTTGAGGGGAGGG + Intronic
1183444687 22:37845560-37845582 TTTTAACTGGGTTGAGTGGGAGG - Intronic
1184984084 22:48117567-48117589 TGTTTTGGGGGTTGAGGGGAGGG - Intergenic
949168257 3:966764-966786 TGTCAAATGAGGTGAGGAGAGGG + Intergenic
949372502 3:3350798-3350820 TTTTAAATGGTGTGAGGGAAAGG + Intergenic
949397080 3:3626112-3626134 TGTTCAATGGGTTGATTGTAGGG - Intergenic
951760514 3:26142691-26142713 TTTTAACAGGGGTGAGGGGAAGG - Intergenic
952321471 3:32281820-32281842 TATTTAAAGGATTGAGGGGAGGG - Intronic
954781439 3:53064895-53064917 TGTGGAATGGGCTGAGGAGATGG - Intronic
955643199 3:61109121-61109143 TGTTAAGTGTATAGAGGGGAGGG + Intronic
955745324 3:62134846-62134868 TATGAAATGGGATGAAGGGAAGG + Intronic
956146264 3:66194312-66194334 GGTTGAAAGGGTTCAGGGGATGG + Intronic
957675649 3:83360871-83360893 TGTTAATTAGGCTGAGGGGAAGG - Intergenic
957965254 3:87313690-87313712 TGTTAAGATGGTTGAGGGGTAGG + Intergenic
958696454 3:97533957-97533979 TGATTTATGGGTTGATGGGATGG - Intronic
959029723 3:101284182-101284204 AGTTAATTGGGTTGGGGGCATGG + Intronic
959983636 3:112547676-112547698 TGTTAAATGAGTTGAATGCAAGG - Intronic
962253667 3:133855626-133855648 TGCTATAAGAGTTGAGGGGAGGG - Intronic
962639325 3:137367733-137367755 TCTTAAATTGATTGTGGGGATGG + Intergenic
962674881 3:137748345-137748367 GGTTGAATAGGCTGAGGGGAGGG - Intergenic
963692895 3:148526808-148526830 GGATAAATGCTTTGAGGGGATGG + Intergenic
963956901 3:151263989-151264011 TGTTAAGTGGGTAGGGGAGAGGG - Intronic
963988415 3:151625040-151625062 TTTAAAAAGGGTTGTGGGGAAGG + Intergenic
966927062 3:184651530-184651552 TGGGAAAGGGGTTGCGGGGAGGG + Intronic
967133533 3:186494284-186494306 CGATAAAGGGGTTGAGTGGAGGG + Intergenic
967232751 3:187356071-187356093 TCTTAAATGGATTGTGGTGATGG + Intergenic
968338521 3:197934795-197934817 TGTGAGATGGGGTGGGGGGAGGG - Intronic
969230713 4:5828339-5828361 TGTTAAATGGGTTGAGACGCTGG - Intronic
970466545 4:16329373-16329395 TGTTAAATGGCATGAGGCAAAGG + Intergenic
971572636 4:28232518-28232540 TGTTTGATGGGTTGAGGAAATGG - Intergenic
972306838 4:37838906-37838928 TGGTGAAAGGGTGGAGGGGACGG + Intronic
974295274 4:59990437-59990459 TGTTAAATATGTTGAGAAGATGG - Intergenic
976634544 4:87274837-87274859 TGTTGAATAGGTTGAGGAGGAGG + Intergenic
976691650 4:87874499-87874521 TGTTGAGTAGGTTGAGGAGAAGG + Intergenic
979351798 4:119652079-119652101 TGTTAAATTGGTAGAGGAGGTGG - Intergenic
982029948 4:151290599-151290621 TCTAAAATGGGTTGTGGTGATGG + Intronic
982146236 4:152396294-152396316 TTTTAAAAGGGTTAATGGGAGGG - Intronic
982459773 4:155654809-155654831 TGTTGAATGTGTGGAAGGGAAGG - Intergenic
982759623 4:159265713-159265735 TGGTAAATAGGTTGGGTGGATGG + Intronic
983358022 4:166689771-166689793 TATTAAATGTCTTAAGGGGAAGG - Intergenic
983439433 4:167762731-167762753 GGTAAAATGGGTTGAGGGGTTGG - Intergenic
984549270 4:181141272-181141294 TATTAAATGTGTTGAGAAGAAGG + Intergenic
984801435 4:183720587-183720609 TGATCAATGGGTTTAGAGGATGG + Intergenic
987885893 5:23811579-23811601 TTTTAAATGGGGTCAGAGGAAGG - Intergenic
991189859 5:63857596-63857618 TGTTGCAGGGGTTGAGGGGAGGG - Intergenic
992942288 5:81774270-81774292 TATTAAAAGGGTTGTTGGGATGG + Intergenic
995251273 5:109995836-109995858 TGTTAAATGGGTTGAGCTATGGG + Intergenic
996853464 5:127978458-127978480 GGTTAAATGGGTGGAGGAAAAGG + Intergenic
996970357 5:129359747-129359769 TGTAAAATGGAATGAGGGGTAGG - Intergenic
997065158 5:130550639-130550661 TTTTCAATGGGTGGTGGGGATGG + Intergenic
998642146 5:144022989-144023011 TCTAAAATGGCTTGAGGGGGTGG + Intergenic
1002447573 5:179298677-179298699 TGCTAGAGGGGTTGAGGGGGAGG + Intronic
1004035062 6:11915855-11915877 TGTCAAATGACTTGTGGGGAGGG + Intergenic
1004136116 6:12968557-12968579 TTTTCAAGGGGCTGAGGGGAGGG - Intronic
1005200975 6:23343427-23343449 AGTTAAATAGGATAAGGGGAAGG - Intergenic
1007654252 6:43442746-43442768 TGTTATATGGGCTGAGGGCCTGG + Intronic
1008650995 6:53562571-53562593 GGAAAAATGGGGTGAGGGGAAGG - Intronic
1008919678 6:56828871-56828893 TGTTAATGGGGAGGAGGGGAAGG + Intronic
1009434831 6:63605460-63605482 TGTAGAATGGGTTGAGGGGAGGG + Intergenic
1013349039 6:109289762-109289784 TGCTAAATTGGTTGAGGGAATGG + Intergenic
1014152388 6:118072742-118072764 TGTTGAATGTGTTGTGTGGAGGG + Intronic
1014188718 6:118466794-118466816 TGTAAAATGGATTAGGGGGAGGG + Intronic
1016414021 6:143814441-143814463 TGTTGAATAGGCTGAGGAGAAGG + Intronic
1017655625 6:156626206-156626228 TCTTAAAAGTGTTGAAGGGATGG - Intergenic
1017728193 6:157290592-157290614 TGTTAAATTGGTTAATGGAAAGG - Exonic
1018211509 6:161487204-161487226 TGTAAAAAGGGTTGAGGGATAGG - Intronic
1019150042 6:169999396-169999418 TGTTAAATGGGCTGAGTGTGTGG - Intergenic
1020284075 7:6666792-6666814 TGTTACCGGGGCTGAGGGGAGGG - Intergenic
1021289686 7:18827650-18827672 TGTTTAATGGGTTAAAGGTATGG - Intronic
1021344144 7:19502633-19502655 TGTCAAGAGGGTTGAGGGGAGGG + Intergenic
1022351675 7:29572008-29572030 TGTTAAGTGGGGCGATGGGAGGG + Intergenic
1023656873 7:42432117-42432139 TCTTAAATAGGGTGTGGGGAGGG + Intergenic
1026631417 7:72041315-72041337 TGATAACTGGAGTGAGGGGATGG + Intronic
1027380218 7:77600081-77600103 CCTCAAAAGGGTTGAGGGGAGGG + Intronic
1027931019 7:84535218-84535240 TGTTATTTGGGTTGAGTGAAAGG - Intergenic
1028490997 7:91411510-91411532 GGTTAATTGGGTTGAGGTGCAGG + Intergenic
1029207304 7:98877709-98877731 TGATAAATGGGGTGAGGGTGGGG + Intergenic
1031260879 7:119518431-119518453 GGTAAAAGGGGTTGAGGGGAAGG + Intergenic
1033048422 7:137982823-137982845 GGTTAAATGGGCTGAAAGGATGG + Intronic
1033677816 7:143561137-143561159 AGCTACACGGGTTGAGGGGAAGG + Intergenic
1033694020 7:143768300-143768322 AGCTACACGGGTTGAGGGGAAGG - Intergenic
1033915662 7:146322103-146322125 TCTGGAGTGGGTTGAGGGGAAGG + Intronic
1034403113 7:150879508-150879530 TGTTAAGTGAGTTGGGGGGATGG - Intergenic
1034783585 7:153904488-153904510 TATTAAAAGGCTTGAGGGGGAGG + Intronic
1035326092 7:158067135-158067157 TGTTAGATGGGTGGAGGGCAAGG + Intronic
1036686823 8:10917306-10917328 TGTTAAATGGGGAGAGGGGCTGG + Intronic
1037655199 8:20877149-20877171 TGCTAAATGGGCTCAGGTGATGG - Intergenic
1038388597 8:27173598-27173620 TGTTAAATGCCTTGAGTTGAGGG + Intergenic
1038388802 8:27175509-27175531 TGTTAAATGTGTTTAAAGGAAGG - Intergenic
1038408622 8:27341251-27341273 TGCTAAATGGGATGAAGGAAAGG + Intronic
1039732918 8:40299352-40299374 TGTCAAATGAGTTAAGAGGAAGG - Intergenic
1040506368 8:48052485-48052507 TGATAAATGGGTTGGGGGAAGGG - Intronic
1041159610 8:55026100-55026122 TTTTAAAGGGGTTGTGGGGCAGG + Intergenic
1041647497 8:60268268-60268290 TGATAAAGGGGTTTTGGGGAAGG - Intronic
1042259254 8:66839979-66840001 TGTCAAATTGGTTGTGGGGGTGG - Intronic
1045074695 8:98551135-98551157 AGTTAAATGGATAGAGGGGAAGG - Intronic
1045965938 8:108024617-108024639 TGTGAAAAGGGTAGAAGGGATGG + Intronic
1046306386 8:112372414-112372436 TGTAGAAAGGGTTGAGTGGAAGG + Intronic
1046490727 8:114950312-114950334 GGTTAAATGTGATGAGGGTAAGG + Intergenic
1047228942 8:122979678-122979700 TGGTAAATGGCAGGAGGGGAAGG - Intergenic
1048616271 8:136078950-136078972 TGTGAGATGGGTTTATGGGAAGG + Intergenic
1050166378 9:2768972-2768994 AGAGAAATGGGTTGCGGGGAGGG + Intronic
1051107778 9:13599750-13599772 TGTTACAGGGGTTGAGGGAAAGG - Intergenic
1051259567 9:15249697-15249719 TTTTAAAAAGGTTGGGGGGAGGG + Intronic
1051539791 9:18202819-18202841 GGTTGAGTGGGTTGAGTGGATGG + Intergenic
1052042884 9:23759924-23759946 TTTTCAGTGGCTTGAGGGGAAGG - Intronic
1052595682 9:30554985-30555007 TCATAAATGGGATTAGGGGAAGG + Intergenic
1053313519 9:37034500-37034522 TTTTATAGGGGTTGGGGGGAGGG + Intergenic
1055208010 9:73756748-73756770 TATTAAATTGGTGGGGGGGAGGG + Intergenic
1055280186 9:74665519-74665541 TGTTTAATGGGTTGAAGGCACGG - Exonic
1055673934 9:78635695-78635717 TGTCAGATGGGTTGAGTGTAGGG + Intergenic
1057907996 9:98997180-98997202 TTCTTAAAGGGTTGAGGGGAAGG - Intronic
1058847474 9:108975311-108975333 GGATAAAGGGGTTGAGGGGCAGG + Intronic
1059027446 9:110650292-110650314 TGTTAACTGGGTAGATGTGAAGG - Intergenic
1060441105 9:123640128-123640150 TTTTAAATTGCTTGAGGGCATGG - Intronic
1060529539 9:124340159-124340181 TGTTAAATGGAGCTAGGGGATGG + Intronic
1061234973 9:129336948-129336970 TGATAGATGGGGTGCGGGGACGG + Intergenic
1062061671 9:134500072-134500094 TGTTGAGTGGGTTGAGGAGGAGG - Intergenic
1185737655 X:2505210-2505232 AGATAAGTGGGTTGTGGGGAAGG - Intergenic
1186710781 X:12194039-12194061 TGTTAAGTGGGTAGGGGTGAGGG + Intronic
1187338068 X:18397914-18397936 ATATACATGGGTTGAGGGGAGGG + Intergenic
1187452835 X:19413747-19413769 TGTTAAAAGAGAGGAGGGGAGGG + Intronic
1189090969 X:38082278-38082300 TATTAAATTGGAGGAGGGGAAGG - Intronic
1189396537 X:40628292-40628314 TGTAGAATGGGTGGAGGGCAGGG - Intronic
1190143510 X:47869158-47869180 TGTTAACTGGTTTGACTGGAAGG - Intronic
1190370681 X:49737778-49737800 TTTTAAATGTGTTGAGAGGATGG + Intergenic
1190839959 X:54134748-54134770 TGTTAGATGGGTGGAGGGTGTGG - Intronic
1192373770 X:70538265-70538287 TGTTAAAAGATTTGAGGGAAAGG + Intronic
1194009530 X:88543126-88543148 TGTTAAAGTGATTGAGGAGAAGG + Intergenic
1194749529 X:97669019-97669041 TTTTAAATGGGTTGAGACAAGGG + Intergenic
1195991077 X:110682938-110682960 TTTTAAATGGGTTGGAGAGAGGG + Intronic
1196332163 X:114484829-114484851 TGTAAAATGAGTTGAGAAGAAGG - Intergenic
1198075626 X:133190544-133190566 TGTTAAAAGGAAAGAGGGGAAGG + Intergenic
1198645820 X:138805289-138805311 TTTTAAATGGGTTTAAGGGAAGG - Intronic
1199532972 X:148870643-148870665 TGTTAAATGGGTTGAAGTGAAGG + Intronic
1202328657 Y:23721343-23721365 AATTAAATGTGTTGAGGGGGAGG - Intergenic
1202542114 Y:25948711-25948733 AATTAAATGTGTTGAGGGGGAGG + Intergenic