ID: 924706822

View in Genome Browser
Species Human (GRCh38)
Location 1:246509027-246509049
Sequence CAGGCTAATCACACTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 119}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924706822_924706833 12 Left 924706822 1:246509027-246509049 CCCTCCACAGTGTGATTAGCCTG 0: 1
1: 0
2: 0
3: 8
4: 119
Right 924706833 1:246509062-246509084 CAGCTGGTCCTCCTGGGAAATGG 0: 1
1: 15
2: 3
3: 38
4: 306
924706822_924706830 5 Left 924706822 1:246509027-246509049 CCCTCCACAGTGTGATTAGCCTG 0: 1
1: 0
2: 0
3: 8
4: 119
Right 924706830 1:246509055-246509077 AGGTGGCCAGCTGGTCCTCCTGG 0: 2
1: 16
2: 4
3: 32
4: 264
924706822_924706831 6 Left 924706822 1:246509027-246509049 CCCTCCACAGTGTGATTAGCCTG 0: 1
1: 0
2: 0
3: 8
4: 119
Right 924706831 1:246509056-246509078 GGTGGCCAGCTGGTCCTCCTGGG 0: 2
1: 16
2: 4
3: 31
4: 287
924706822_924706836 30 Left 924706822 1:246509027-246509049 CCCTCCACAGTGTGATTAGCCTG 0: 1
1: 0
2: 0
3: 8
4: 119
Right 924706836 1:246509080-246509102 AATGGTGCCAACCCAGAGACTGG 0: 1
1: 0
2: 3
3: 12
4: 235
924706822_924706828 -4 Left 924706822 1:246509027-246509049 CCCTCCACAGTGTGATTAGCCTG 0: 1
1: 0
2: 0
3: 8
4: 119
Right 924706828 1:246509046-246509068 CCTGCCAGCAGGTGGCCAGCTGG 0: 3
1: 15
2: 1
3: 45
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924706822 Original CRISPR CAGGCTAATCACACTGTGGA GGG (reversed) Intergenic
900501499 1:3007616-3007638 CAGGCTTAACACCATGTGGAAGG - Intergenic
902369201 1:15994728-15994750 CAGGCTGGTCACACTGCGGAGGG + Intergenic
902981506 1:20126763-20126785 CAGACTCAGCACACTGTGCAGGG + Intergenic
906280403 1:44549566-44549588 CAGGCTGATCACGCTGGGCAAGG - Intronic
917135961 1:171788276-171788298 CAGGTGAGTCACACTATGGAGGG - Intronic
921619520 1:217310633-217310655 AAGGCTGATCGCACTGTGGGTGG - Intergenic
921662476 1:217821321-217821343 CAGGCTCATCCCACTTCGGATGG - Intronic
922452269 1:225746794-225746816 CTGGCTTCTCACACTGGGGAGGG + Intergenic
924706822 1:246509027-246509049 CAGGCTAATCACACTGTGGAGGG - Intergenic
1064886937 10:20122345-20122367 CAGGTAACTCACACAGTGGAGGG - Intronic
1065746404 10:28846287-28846309 CAGGCTGATGGCACCGTGGAGGG + Intergenic
1070871780 10:79760938-79760960 GAGGCTAATAACACTGAGAAGGG + Intergenic
1071326637 10:84525193-84525215 CAGGCTAGCCCCACTGTGCAAGG - Intergenic
1071638701 10:87283105-87283127 GAGGCTAATAACACTGAGAAGGG + Intergenic
1071656539 10:87454847-87454869 GAGGCTAATAACACTGAGAAGGG - Intergenic
1075396777 10:122133316-122133338 CAGGCCAAGCACAGTGTAGACGG - Intronic
1075625404 10:123960642-123960664 CAGCCCACTCACACTGGGGAGGG - Intergenic
1076926818 10:133494922-133494944 CAGGCTCAACACCATGTGGAAGG + Intergenic
1077453096 11:2662633-2662655 CAGGGGAATCACACCGTGGCCGG - Intronic
1077518307 11:3015769-3015791 CATGCTACTCACACTGAGGCTGG + Exonic
1077742784 11:4865808-4865830 CAGGCTACTAAAACTGTGGATGG - Intronic
1078368424 11:10725370-10725392 CCGACTAATCTCACTGAGGAAGG - Intergenic
1078457315 11:11485351-11485373 CAGATTAATCACACCGAGGAGGG - Intronic
1079230567 11:18645559-18645581 CAGGTAAATCTCACAGTGGAGGG + Intergenic
1080409895 11:32013739-32013761 CAGGCTTGGCAAACTGTGGAAGG - Intronic
1081118742 11:39237274-39237296 GAGACTCATCAGACTGTGGAAGG - Intergenic
1085799703 11:79578024-79578046 TAGGCTAATGACACAGTTGAAGG - Intergenic
1087447083 11:98268891-98268913 CAGGCTCAACACCATGTGGAAGG + Intergenic
1090713062 11:129405236-129405258 TAGGCTACTCACACTCTTGAGGG + Intronic
1090909508 11:131106168-131106190 CAGGCTCAGCACACTGTAGTTGG + Intergenic
1095252612 12:39996721-39996743 CAGGCTCAACACAATGTAGAAGG - Intronic
1098325573 12:69298490-69298512 CAGGCTTAACACCATGTGGAAGG - Intergenic
1101720887 12:107349837-107349859 CAGGCTAATCAAACACTGAAGGG + Intronic
1102614024 12:114137494-114137516 CAGGCTTGTCACTCTGTGCAAGG - Intergenic
1106454155 13:29912015-29912037 CAGTCTAGTGATACTGTGGATGG + Intergenic
1106888709 13:34218949-34218971 CAGGGTCATCCCACTGTGGAAGG + Intergenic
1108358152 13:49645638-49645660 CAGGATATTCACACTGTGCCCGG - Intergenic
1108531169 13:51328696-51328718 CCTGCCAATCACACTGGGGAAGG - Intergenic
1109995106 13:70112883-70112905 CTGGTTAATCACACTGCTGAGGG + Intergenic
1111432512 13:88162158-88162180 AAGGCTAATACCACTGGGGATGG + Intergenic
1111520478 13:89396004-89396026 TAGGTTAATTCCACTGTGGATGG + Intergenic
1122252647 14:100450821-100450843 CAGATTAAGCACACTGAGGAGGG + Intronic
1122946641 14:105014030-105014052 CAGCCTAATGCCCCTGTGGAAGG - Intronic
1123928164 15:25139371-25139393 TGGGCTCATCACAGTGTGGATGG - Intergenic
1134264788 16:12683720-12683742 CAGGAAGATCACACTGAGGATGG - Intronic
1135940355 16:26816938-26816960 CCGGCTAATCACAGTGTGCGGGG - Intergenic
1139749857 16:69103153-69103175 GAGGCTCATCTCCCTGTGGAGGG - Intergenic
1140135877 16:72205078-72205100 CAGCCTAGACACACTGAGGATGG - Intergenic
1141005141 16:80344885-80344907 CAGTGTAATCTCACTGTGCATGG - Intergenic
1141338237 16:83177657-83177679 CAGGCTTATCCCTATGTGGAGGG - Intronic
1142478324 17:202825-202847 CAGGCTCCTCACACTGCGGGAGG - Intergenic
1144637967 17:16923119-16923141 CAGGCCGCCCACACTGTGGAGGG - Intergenic
1144787010 17:17837505-17837527 GAGGCTAGTGACAATGTGGAGGG + Intergenic
1145762138 17:27431090-27431112 CAGGCTGACCACACTGCGAAGGG + Intergenic
1147375159 17:40018742-40018764 CAGGCTAGTCAGAGTGTGGGTGG + Intergenic
1147537410 17:41329522-41329544 CAGGCTGACCACACTGCGGAAGG + Intergenic
1148442268 17:47717495-47717517 CAGCAAAAGCACACTGTGGATGG + Intergenic
1148860963 17:50604145-50604167 CCGGCTGATCACCCTGGGGAGGG - Exonic
1151984582 17:77534096-77534118 CAGGGTATACACACAGTGGATGG - Intergenic
1152224755 17:79087567-79087589 CAGGCCACTGACACCGTGGAAGG - Intronic
1158808525 18:61003693-61003715 CAGGCAAATCAAATTTTGGAAGG - Intergenic
1159892085 18:73962475-73962497 CAGCCCCATCACAGTGTGGAAGG + Intergenic
1163487350 19:17595956-17595978 CAGGTAACTCTCACTGTGGAGGG + Intergenic
1164785631 19:30928145-30928167 CAGGCCAAGCAAACTGTGGGAGG + Intergenic
1168703528 19:58455288-58455310 CAGGCTTTTTACACTGTGGCAGG - Exonic
1168706039 19:58470836-58470858 CAGGCTTTTTACACTGTGGCAGG - Exonic
928680572 2:33698029-33698051 CATCCTAATCAAACTGTTGAGGG + Intergenic
935201279 2:100858865-100858887 CAGGAAAATTACACTATGGAGGG - Intronic
941163041 2:162056600-162056622 CAGGCCAAGCAAACTATGGAAGG + Intronic
943503828 2:188727915-188727937 CAGGATAAACCCACTGTGTATGG + Intergenic
945564007 2:211373464-211373486 CAGCTTGATAACACTGTGGAGGG + Intergenic
946139196 2:217673904-217673926 GAGGCAAATAACACTGAGGAAGG + Intronic
948259797 2:236595152-236595174 CAGGCCAATCACTCTGGTGATGG - Intergenic
1170876293 20:20253405-20253427 AAGGCTCATCTCACTGTGGCAGG + Intronic
1172088646 20:32410600-32410622 CAGGTTATTTAAACTGTGGAAGG + Intronic
1172813594 20:37669286-37669308 CAGGCTGAGCACTCAGTGGATGG + Intergenic
1176013087 20:62910981-62911003 GAGGCCAGTGACACTGTGGAGGG - Exonic
1183276809 22:36903574-36903596 AAGGCAAATGACACTTTGGAAGG - Intergenic
1183333590 22:37234334-37234356 CTGGCTACCCACGCTGTGGAAGG + Intronic
1184128533 22:42503524-42503546 CAGGCTGATCACGCAGTGGCAGG + Intergenic
1184137327 22:42556839-42556861 CAGGCTGATCACGCAGTGGCAGG + Intronic
1184172608 22:42768798-42768820 CAGGTCACTCAGACTGTGGAGGG - Intergenic
1184478265 22:44733267-44733289 CCGGCTCATCACACTGTCGCAGG + Intronic
950095680 3:10328889-10328911 CAGGTTGATCCCACTGTCGATGG + Exonic
957524125 3:81358146-81358168 CAGGCTTAACACCATGTGGAAGG - Intergenic
959774345 3:110138873-110138895 CAAGCTAATAACTCTGTGAAAGG - Intergenic
968597031 4:1491016-1491038 CGGGCTTATCACGTTGTGGAAGG + Intergenic
971371781 4:26025317-26025339 CAGGCAAGTCAGCCTGTGGATGG - Intergenic
973243692 4:47987025-47987047 CAAGCTAATCATGCTTTGGAGGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977435447 4:96989297-96989319 CAGGCCAAGCACCATGTGGAAGG - Intergenic
978523412 4:109639880-109639902 CAGGCTAATAACGCTGTGTTGGG - Intronic
982278481 4:153660555-153660577 AAGTCTAATCACATTGTTGATGG - Intergenic
982309995 4:153974745-153974767 CAGGCTTAACACCGTGTGGAAGG - Intergenic
983647000 4:170002002-170002024 CAGGCTAATCACAAAGTGAATGG + Intronic
990048176 5:51460392-51460414 ATGGCAAAACACACTGTGGAAGG - Intergenic
995714554 5:115069190-115069212 CAGACTAATGGAACTGTGGAAGG - Intergenic
995906614 5:117131730-117131752 CTGGTCAATCACTCTGTGGAAGG + Intergenic
995906939 5:117135929-117135951 CAGCCTAGTCAAACTGTGCAAGG + Intergenic
1000210549 5:159103469-159103491 CAGGCTAATCACATGGGGAAGGG + Intergenic
1006813492 6:36836212-36836234 AAGGCAAATGACACTGGGGATGG - Intronic
1010390642 6:75332749-75332771 AAGGCTCCTCACACTGTGGGAGG - Intronic
1011335311 6:86253449-86253471 CAGGTTCATCTCACTGGGGATGG + Intergenic
1014588559 6:123232264-123232286 CAGGCGACCCACAATGTGGAAGG + Intronic
1014705315 6:124739507-124739529 CTTGATGATCACACTGTGGAAGG - Intronic
1015095315 6:129408642-129408664 CTGGCTGATCACCCTGAGGAAGG + Intronic
1016552431 6:145296662-145296684 CAGCCTTATCACACTGTGTCAGG + Intergenic
1017205524 6:151800812-151800834 AATGACAATCACACTGTGGAGGG - Intronic
1017358092 6:153534042-153534064 CAGATTAATCACCCTGAGGAGGG - Intergenic
1019476249 7:1245868-1245890 CTGGCTAAACCCACGGTGGAAGG + Intergenic
1025300378 7:57815182-57815204 CAGGCTGAACACAACGTGGAAGG + Intergenic
1031668904 7:124518999-124519021 CAGGCTCAACACCATGTGGAAGG - Intergenic
1034198556 7:149266424-149266446 CACGGAAATCACACTGTGGACGG + Exonic
1035755690 8:2030098-2030120 GAGGCCATCCACACTGTGGAGGG + Intergenic
1037897572 8:22668484-22668506 CAGTCCAATCCCACAGTGGAAGG + Intronic
1039919842 8:41885616-41885638 CAGGCTAAACAAGCTGTGGAAGG + Intronic
1046680950 8:117169539-117169561 CAGCCTAATAACACTGGGTATGG - Intronic
1052007827 9:23371473-23371495 CAGGCTAATAACACTGATGACGG + Intergenic
1055398213 9:75895650-75895672 CAGGATAAGCATACTGCGGATGG + Intronic
1057859158 9:98625751-98625773 CAGGCCAGTCACAGTCTGGAGGG + Intronic
1061074017 9:128329842-128329864 CAGGCTGTTCCCACTGTGTATGG + Intronic
1186006668 X:5079733-5079755 CTGGTTAATAACACTGTTGATGG - Intergenic
1188831259 X:34900351-34900373 CTGGCCAATCACAGAGTGGATGG - Intergenic
1192038936 X:67596581-67596603 CAGACTGAACACACTGAGGAAGG - Intronic
1194482768 X:94447102-94447124 CTGGCTGATCACTTTGTGGAAGG - Intergenic
1196037640 X:111164201-111164223 CACACTAATGACATTGTGGAAGG - Intronic
1196474780 X:116069460-116069482 CAGGTTCATCTCACTGGGGAGGG - Intergenic
1196939193 X:120759246-120759268 CAGGGCAATCACTCTGTGAATGG - Intergenic