ID: 924708238

View in Genome Browser
Species Human (GRCh38)
Location 1:246515100-246515122
Sequence GATGAAGGAATCGCTCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924708238_924708242 -7 Left 924708238 1:246515100-246515122 CCTCCTGGAGCGATTCCTTCATC No data
Right 924708242 1:246515116-246515138 CTTCATCCTCCAAGTCTCCAGGG No data
924708238_924708249 22 Left 924708238 1:246515100-246515122 CCTCCTGGAGCGATTCCTTCATC No data
Right 924708249 1:246515145-246515167 CTATGTAGCCAACCTCTTCCCGG No data
924708238_924708241 -8 Left 924708238 1:246515100-246515122 CCTCCTGGAGCGATTCCTTCATC No data
Right 924708241 1:246515115-246515137 CCTTCATCCTCCAAGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924708238 Original CRISPR GATGAAGGAATCGCTCCAGG AGG (reversed) Intergenic
No off target data available for this crispr