ID: 924709732

View in Genome Browser
Species Human (GRCh38)
Location 1:246522360-246522382
Sequence CCTGAAACCCAGAGGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924709725_924709732 -9 Left 924709725 1:246522346-246522368 CCCAGTTCCACATCCCTGAAACC No data
Right 924709732 1:246522360-246522382 CCTGAAACCCAGAGGGAGCCAGG No data
924709722_924709732 15 Left 924709722 1:246522322-246522344 CCCAGGCTATATGTCCGCTGGCA No data
Right 924709732 1:246522360-246522382 CCTGAAACCCAGAGGGAGCCAGG No data
924709726_924709732 -10 Left 924709726 1:246522347-246522369 CCAGTTCCACATCCCTGAAACCC No data
Right 924709732 1:246522360-246522382 CCTGAAACCCAGAGGGAGCCAGG No data
924709723_924709732 14 Left 924709723 1:246522323-246522345 CCAGGCTATATGTCCGCTGGCAG No data
Right 924709732 1:246522360-246522382 CCTGAAACCCAGAGGGAGCCAGG No data
924709724_924709732 1 Left 924709724 1:246522336-246522358 CCGCTGGCAGCCCAGTTCCACAT No data
Right 924709732 1:246522360-246522382 CCTGAAACCCAGAGGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924709732 Original CRISPR CCTGAAACCCAGAGGGAGCC AGG Intergenic
No off target data available for this crispr