ID: 924709909

View in Genome Browser
Species Human (GRCh38)
Location 1:246523245-246523267
Sequence GAAGCCCCCCACACCCTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924709909_924709916 17 Left 924709909 1:246523245-246523267 CCATACAGGGTGTGGGGGGCTTC No data
Right 924709916 1:246523285-246523307 AGAAAGAACAGGAGAACTCTGGG No data
924709909_924709918 30 Left 924709909 1:246523245-246523267 CCATACAGGGTGTGGGGGGCTTC No data
Right 924709918 1:246523298-246523320 GAACTCTGGGTTCTTGGTCCTGG No data
924709909_924709914 6 Left 924709909 1:246523245-246523267 CCATACAGGGTGTGGGGGGCTTC No data
Right 924709914 1:246523274-246523296 CCGGGTCACTGAGAAAGAACAGG No data
924709909_924709917 24 Left 924709909 1:246523245-246523267 CCATACAGGGTGTGGGGGGCTTC No data
Right 924709917 1:246523292-246523314 ACAGGAGAACTCTGGGTTCTTGG No data
924709909_924709915 16 Left 924709909 1:246523245-246523267 CCATACAGGGTGTGGGGGGCTTC No data
Right 924709915 1:246523284-246523306 GAGAAAGAACAGGAGAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924709909 Original CRISPR GAAGCCCCCCACACCCTGTA TGG (reversed) Intergenic
No off target data available for this crispr