ID: 924710925

View in Genome Browser
Species Human (GRCh38)
Location 1:246529455-246529477
Sequence AGATGCTCACTGCAGTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924710925_924710930 -2 Left 924710925 1:246529455-246529477 CCACCCCACTGCAGTGAGCATCT No data
Right 924710930 1:246529476-246529498 CTCTCTCTTTACCCTTGGTCTGG No data
924710925_924710934 19 Left 924710925 1:246529455-246529477 CCACCCCACTGCAGTGAGCATCT No data
Right 924710934 1:246529497-246529519 GGAGAGCACATGGTATTTCAAGG No data
924710925_924710932 9 Left 924710925 1:246529455-246529477 CCACCCCACTGCAGTGAGCATCT No data
Right 924710932 1:246529487-246529509 CCCTTGGTCTGGAGAGCACATGG 0: 20
1: 41
2: 32
3: 39
4: 187
924710925_924710929 -7 Left 924710925 1:246529455-246529477 CCACCCCACTGCAGTGAGCATCT No data
Right 924710929 1:246529471-246529493 AGCATCTCTCTCTTTACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924710925 Original CRISPR AGATGCTCACTGCAGTGGGG TGG (reversed) Intergenic
No off target data available for this crispr