ID: 924712095

View in Genome Browser
Species Human (GRCh38)
Location 1:246537905-246537927
Sequence CATGGTGACAAAAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924712095_924712102 16 Left 924712095 1:246537905-246537927 CCATCTTCCCTTTTGTCACCATG No data
Right 924712102 1:246537944-246537966 CAGGCAACATGGCACCGGCCAGG 0: 10
1: 41
2: 76
3: 113
4: 244
924712095_924712101 11 Left 924712095 1:246537905-246537927 CCATCTTCCCTTTTGTCACCATG No data
Right 924712101 1:246537939-246537961 AAAAGCAGGCAACATGGCACCGG No data
924712095_924712099 -3 Left 924712095 1:246537905-246537927 CCATCTTCCCTTTTGTCACCATG No data
Right 924712099 1:246537925-246537947 ATGTGTACAGTAAAAAAAGCAGG No data
924712095_924712100 5 Left 924712095 1:246537905-246537927 CCATCTTCCCTTTTGTCACCATG No data
Right 924712100 1:246537933-246537955 AGTAAAAAAAGCAGGCAACATGG 0: 3
1: 4
2: 4
3: 48
4: 598

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924712095 Original CRISPR CATGGTGACAAAAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr