ID: 924715097

View in Genome Browser
Species Human (GRCh38)
Location 1:246566092-246566114
Sequence GCGGAGAGCCTCAGCCGCCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924715093_924715097 -8 Left 924715093 1:246566077-246566099 CCAGCGCCCGCCAAGGCGGAGAG 0: 1
1: 1
2: 1
3: 17
4: 100
Right 924715097 1:246566092-246566114 GCGGAGAGCCTCAGCCGCCGAGG 0: 1
1: 0
2: 2
3: 13
4: 82
924715089_924715097 11 Left 924715089 1:246566058-246566080 CCCTAAAATGCAAAAGCGACCAG 0: 2
1: 0
2: 0
3: 9
4: 136
Right 924715097 1:246566092-246566114 GCGGAGAGCCTCAGCCGCCGAGG 0: 1
1: 0
2: 2
3: 13
4: 82
924715088_924715097 21 Left 924715088 1:246566048-246566070 CCGCTTCAGACCCTAAAATGCAA 0: 1
1: 1
2: 1
3: 11
4: 153
Right 924715097 1:246566092-246566114 GCGGAGAGCCTCAGCCGCCGAGG 0: 1
1: 0
2: 2
3: 13
4: 82
924715090_924715097 10 Left 924715090 1:246566059-246566081 CCTAAAATGCAAAAGCGACCAGC 0: 2
1: 0
2: 0
3: 6
4: 102
Right 924715097 1:246566092-246566114 GCGGAGAGCCTCAGCCGCCGAGG 0: 1
1: 0
2: 2
3: 13
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924715097 Original CRISPR GCGGAGAGCCTCAGCCGCCG AGG Exonic
900092229 1:925475-925497 GCGGTGAGCGCCAGGCGCCGCGG + Intronic
900244061 1:1629700-1629722 GCGCAGAGCCTCACCCACCTGGG - Exonic
906315586 1:44784661-44784683 CCGCAGAGACTCGGCCGCCGTGG + Exonic
912764455 1:112396202-112396224 GGGCGGAGCCTCAGCCGCTGTGG + Exonic
915192139 1:154160357-154160379 GGGGAGAGCCTCAGCCCACAAGG - Intronic
915441924 1:155950866-155950888 GCGGGGAGGCTGCGCCGCCGAGG + Exonic
915497353 1:156291586-156291608 GCGGAGAGGCTCAGCCCCAGGGG - Exonic
915530697 1:156500702-156500724 GCCGAGCGCCTGAGCCGCCTCGG + Exonic
921325815 1:213985554-213985576 GCCGGGAGCCTCTGCCGCCGAGG + Intronic
924715097 1:246566092-246566114 GCGGAGAGCCTCAGCCGCCGAGG + Exonic
1066650586 10:37651459-37651481 GAGGAAAGCCCCAGCCGCAGAGG + Intergenic
1071074325 10:81732834-81732856 GAGGAGAGCCTGGGCCGCTGAGG + Intergenic
1076372178 10:129963074-129963096 GCCGAGAGCCTCGGTCGCGGAGG - Intronic
1076424745 10:130359522-130359544 GTGGAGAGCCCCAGCGGCCGTGG + Intergenic
1105437835 13:20392061-20392083 GCGGAGAGCTTGAGGCCCCGGGG - Intergenic
1108336218 13:49444408-49444430 GAGGAGAGCCCCACCCGCGGAGG + Exonic
1113231255 13:108215725-108215747 GCAGAGAGCATCTGCTGCCGAGG - Intronic
1113769306 13:112898299-112898321 GCGGAGAGGCCCAGAGGCCGTGG - Intronic
1118186490 14:63542949-63542971 GCCTAGAGGCTCCGCCGCCGCGG - Exonic
1122746446 14:103899808-103899830 GGGGAGAGCCTGAGCCGGCCAGG + Intergenic
1125200569 15:37098119-37098141 ACGGAGACCCTCACGCGCCGCGG - Exonic
1129116671 15:73368613-73368635 CCGGAGAGGCTCTGCGGCCGCGG + Exonic
1131735473 15:95326959-95326981 GCGGAGCGCCGCAGCCGCCGCGG - Intergenic
1131872637 15:96777728-96777750 GCAGAGAGCCACAGCCACAGGGG - Intergenic
1132736891 16:1390667-1390689 GCGGAGAGACTCGCCGGCCGAGG - Intronic
1132842372 16:1984338-1984360 GCGGAGAGACGCGGCCGCCTCGG + Exonic
1135034732 16:19067675-19067697 GCGGGGAGCCGCCGCCGCCCCGG - Exonic
1136867914 16:33771029-33771051 GCGGAGCGCCGCAGCGGCCAAGG - Intergenic
1136930129 16:34410954-34410976 TTGTAGAGCCTCAGCCACCGAGG - Intergenic
1136974445 16:35000851-35000873 TTGTAGAGCCTCAGCCACCGAGG + Intergenic
1148178196 17:45585278-45585300 GCAGAGAGCCTGGGGCGCCGGGG + Intergenic
1150134848 17:62689952-62689974 ACGGGGAGCCGCAGCAGCCGGGG + Exonic
1150408095 17:64919568-64919590 GCGGAGAGCCTGGGGCGCCGGGG + Intergenic
1152887724 17:82862319-82862341 CTGGAGAGCCTCAGCCTCTGTGG + Intronic
1160399729 18:78601471-78601493 CCGGAGAGCCACAGGAGCCGAGG - Intergenic
1160566531 18:79789673-79789695 GCGGGGAGCCTGAGCCGGCCGGG - Intergenic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1165157228 19:33796057-33796079 GAGGAGAGCAGCCGCCGCCGCGG - Intronic
1167249180 19:48391583-48391605 GAGGAGAGGCTCCGCCCCCGAGG + Intergenic
1168063556 19:53907306-53907328 GCGGGGAGCCTCGGAGGCCGAGG - Exonic
1168643345 19:58044512-58044534 GCGAAGAGCCGCGGCCGCCGCGG + Intronic
1168696966 19:58409063-58409085 GCGGAAACCCTCGGCCGCCGTGG - Exonic
926225001 2:10961206-10961228 GCGGGGAACCTCAGCCCCGGAGG - Intergenic
927685557 2:25168380-25168402 GCGGAGAGCCAGAGGCGCCCAGG + Intronic
929776684 2:44934792-44934814 GAAGAGCGCCTCAGCAGCCGGGG - Intergenic
932448322 2:71794125-71794147 GCAGAGAGGCTCAGCCTCCCAGG - Intergenic
934755310 2:96820470-96820492 GCAGAGAGCCTCAGCCTCCTAGG + Intronic
934763948 2:96870079-96870101 GCGGAGAGCCGCGGCCGCGCTGG - Intronic
935196639 2:100820231-100820253 CCGGAGACCCGCAGCCGCGGCGG + Exonic
937204100 2:120224581-120224603 GCGGACAGTCCCAGCCCCCGAGG + Intergenic
941366978 2:164621448-164621470 GCCGCGCGTCTCAGCCGCCGGGG - Exonic
941666348 2:168247271-168247293 GCCGACAGCCTGTGCCGCCGGGG + Exonic
942619613 2:177833451-177833473 GGGGAGAGCATCAGCTGCTGAGG - Intronic
948987531 2:241534474-241534496 GCGTCCAGCCTCAGCCGGCGGGG + Intergenic
1170808538 20:19655136-19655158 GCAGAGAGCCTCAGCTGAAGTGG - Intronic
1173913598 20:46689346-46689368 GGCCAGAGCCTCAGCCTCCGGGG + Exonic
1175286446 20:57840007-57840029 GGGGACAGCCTCAGCAGCAGTGG - Intergenic
1175567093 20:59988983-59989005 GAGGAAAGCTTCAGCCGCCAAGG + Exonic
1179988035 21:44932087-44932109 GCGCGGAGCCTCCCCCGCCGCGG + Intergenic
1180188395 21:46151477-46151499 GCTGAGAGCCTCAGGCGGGGAGG - Intronic
1183344633 22:37300581-37300603 GCGGGGAGCCACAGACCCCGGGG + Intronic
1183720329 22:39558404-39558426 CCGCAGAGCCGCAGCCGCGGAGG - Intergenic
1184406556 22:44303923-44303945 GCGGAGGGCCTCACCTGGCGTGG - Intronic
1184640771 22:45868807-45868829 GAGGAGCACCTCAGCGGCCGCGG - Intergenic
1185278671 22:49960765-49960787 GCGGAGCGCCTCACCCGCCCCGG - Exonic
951640554 3:24830107-24830129 GCTTAGAGCCTCAGCCTCCAGGG - Intergenic
954686552 3:52373214-52373236 GCGGAGAGACGCCGCCGCCACGG + Intronic
959849703 3:111071944-111071966 GCCCAGAGCCTGAGGCGCCGGGG + Exonic
962309148 3:134313344-134313366 GCGGAGTGGGGCAGCCGCCGGGG + Intergenic
963733046 3:148991351-148991373 CCGGTGAGCCGCAGCCGCAGCGG + Exonic
968636624 4:1684298-1684320 GCGACGCGCCTCAGCCGCGGCGG + Intronic
968671781 4:1855998-1856020 GCGAAGAGCCGCGGCCGCCGCGG - Exonic
970485898 4:16524543-16524565 GCTGAGAGCCTGAGCTGCAGTGG + Intronic
975325502 4:73054165-73054187 GCGCAGAGCCTCAGCAACTGAGG + Intergenic
981455893 4:144952727-144952749 GCTGAGATCCTCAGCAGCCAAGG - Intergenic
985520757 5:373113-373135 GCGCAGAACCTCAGCCACCTTGG - Intronic
985773583 5:1828004-1828026 GTGGAGAGGCACAGCCGCAGCGG + Intergenic
986488890 5:8269341-8269363 ACACAGAGCCTCAGCCACCGTGG - Intergenic
988077614 5:26373024-26373046 TCACAGAGCCTCAGCCTCCGTGG + Intergenic
1001948707 5:175801024-175801046 GGGGAGAGCAGCAGCCGCCAGGG + Intronic
1003049234 6:2765354-2765376 GCGAGGCGCCTCCGCCGCCGGGG + Intergenic
1003322772 6:5066936-5066958 GCGGAGAGCCTCAGCCGAGGAGG + Intergenic
1013010484 6:106115698-106115720 GAGGAAAACCTCAGCCGCCTTGG - Intergenic
1017146704 6:151241004-151241026 GCAGAAAGGCTCAGCCGCCGTGG - Intronic
1017662413 6:156687403-156687425 GCAGGGAGCCTCAGACGCCGCGG + Intergenic
1023000346 7:35801534-35801556 GCGCAGAGCCGCGGCCTCCGCGG + Intronic
1029707880 7:102285265-102285287 GGGGAGAGCCTGACCCGCGGTGG - Intronic
1034465806 7:151227843-151227865 GCGGGGAGGCTAAGCGGCCGAGG - Intergenic
1037825184 8:22156487-22156509 GCGGAGAGCGCCAGCAGCCCCGG + Exonic
1049788585 8:144462803-144462825 GCGTAGCCCCACAGCCGCCGCGG + Intronic
1055936835 9:81611801-81611823 GATGAGCGCCGCAGCCGCCGCGG - Exonic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1057997145 9:99828714-99828736 GCTGGGAGCCGCAGCCGCCGCGG + Exonic
1060812700 9:126618998-126619020 GCCGAGAGGCTCGGCCGCCCGGG - Intronic
1061810934 9:133162461-133162483 GGGGACAGCCTCATCCGCCCAGG - Exonic
1192762242 X:74105469-74105491 GCGGAGGGCCGTAGCCGCAGGGG + Intergenic
1195589366 X:106606151-106606173 GCGGAGAGCTTGAGCCCCGGAGG + Intergenic
1199737199 X:150695253-150695275 GTGGAGAGCCTCAGAGGCCATGG + Intronic