ID: 924716094

View in Genome Browser
Species Human (GRCh38)
Location 1:246575600-246575622
Sequence TAGTGGGTATGTAGGGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924716083_924716094 20 Left 924716083 1:246575557-246575579 CCTGGGGCTGTGGTGGGGGTGCA 0: 1
1: 0
2: 8
3: 80
4: 732
Right 924716094 1:246575600-246575622 TAGTGGGTATGTAGGGCAGGGGG 0: 1
1: 0
2: 4
3: 23
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924716094 Original CRISPR TAGTGGGTATGTAGGGCAGG GGG Intronic
904092792 1:27956920-27956942 CAGTGGGTATCTTGGGGAGGTGG + Intronic
905867831 1:41385853-41385875 TAGTGAGTGTGCTGGGCAGGTGG + Intergenic
906187400 1:43871913-43871935 GAGGGGGTATGTGGGGGAGGGGG + Intronic
906913810 1:49985186-49985208 AAGAGGGAATGTGGGGCAGGCGG - Intronic
907375424 1:54034220-54034242 TATTGGCTATCTAGGGCTGGAGG + Intronic
909773810 1:79459143-79459165 TAGAGGGTAGGAAGGGTAGGGGG - Intergenic
912404902 1:109428970-109428992 TAGTGATTATCTAGGGCTGGAGG + Intergenic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912712215 1:111958138-111958160 TGGTGTGTATGTATGCCAGGTGG - Intronic
917435469 1:175016948-175016970 TAGGGGGTATGGCGGGCAGGGGG - Intronic
917718964 1:177767778-177767800 TAGTGGGTATGAAGTCAAGGAGG + Intergenic
919804269 1:201371681-201371703 TAATGGGTACCTTGGGCAGGGGG + Intronic
919807859 1:201391400-201391422 GAGGTGGTAGGTAGGGCAGGTGG - Intronic
920870268 1:209788421-209788443 TACTGGGGAGGCAGGGCAGGGGG + Exonic
922006060 1:221531846-221531868 AAGTGTGTATGAAGGGGAGGGGG + Intergenic
922887648 1:229032142-229032164 TGGTGTGTATGTAGGGGAGTGGG - Intergenic
923330275 1:232917408-232917430 TAGTATGTATATGGGGCAGGAGG + Intergenic
924373035 1:243375125-243375147 AGGTGGGTATGTAGGGTGGGTGG + Intronic
924576135 1:245282685-245282707 TAGCTGGTATCTGGGGCAGGTGG + Intronic
924716094 1:246575600-246575622 TAGTGGGTATGTAGGGCAGGGGG + Intronic
1065486265 10:26239090-26239112 TAGTGGGTGTGTGGGGAATGGGG - Intronic
1066269438 10:33808025-33808047 AACTGAGTATGTAGGGTAGGGGG - Intergenic
1067132241 10:43575119-43575141 TTGTGGGTGTGTAGGACTGGAGG + Intergenic
1067928134 10:50531715-50531737 CAGTGGGCAGGTAGGGAAGGTGG - Intronic
1068021136 10:51585974-51585996 GAGTGGGGAGGTAGGGCAAGAGG + Intronic
1068104629 10:52598675-52598697 TAGTGGGTGTTTATGGCAGTGGG - Intergenic
1068290996 10:55001365-55001387 AAGTGTGTGTGTAGAGCAGGGGG - Intronic
1068808140 10:61223864-61223886 TAGTAGGATTGGAGGGCAGGGGG + Intergenic
1069522034 10:69129950-69129972 TTGTGGCTATGTAGGGCACAAGG - Intronic
1070625672 10:78049388-78049410 TAGAGGGTATGTTAGGGAGGAGG + Intronic
1072422848 10:95304024-95304046 CAGTGGAGATGTAGAGCAGGCGG + Intergenic
1075339311 10:121632903-121632925 CAGTGGGTTTGCAGGCCAGGAGG + Intergenic
1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG + Intronic
1078803850 11:14676016-14676038 TAGTGAGGATGTAGGGCAACTGG - Intronic
1081611799 11:44567383-44567405 GTGTGTGTATGTAGGGCAGGGGG + Intronic
1083249633 11:61457620-61457642 TACTGGGGATCTGGGGCAGGAGG + Intronic
1085035418 11:73297062-73297084 TAGTGGGTGGCCAGGGCAGGCGG - Exonic
1085069781 11:73533184-73533206 TATAAGGTAAGTAGGGCAGGTGG - Intronic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085993383 11:81879298-81879320 TAGTATGTCTGTAGGGCTGGAGG + Intergenic
1086597868 11:88595402-88595424 TAGAGGGTAGGAAGGGAAGGAGG - Intronic
1086752685 11:90517985-90518007 TATTGGGGGTGTAGGGCATGTGG + Intergenic
1087327898 11:96745966-96745988 TAATGGTTATGCAGGGTAGGAGG + Intergenic
1088837931 11:113594138-113594160 TAGTGTGTATGTGGGGGTGGGGG + Intergenic
1090410972 11:126509457-126509479 TAGCTGGTATGTAGGTCATGAGG + Intronic
1091834361 12:3575248-3575270 GAGTGGGTGTGTGCGGCAGGAGG - Intronic
1092648430 12:10605622-10605644 TATTTGGTGTGTAGGGGAGGGGG - Exonic
1093452498 12:19332297-19332319 TAGTGTGCATGTTGGGCAGGAGG - Intronic
1096110171 12:49024036-49024058 TATGAGGTAGGTAGGGCAGGTGG - Intronic
1096771507 12:53938748-53938770 TAGAGGGAATGTAGGGAGGGAGG + Exonic
1096980140 12:55724004-55724026 TAGTGGGCCTGTGTGGCAGGAGG - Exonic
1097173384 12:57129347-57129369 TTGTGAGGATGTAGGGGAGGCGG - Intronic
1097925458 12:65121683-65121705 AAGTGGGCGTGTAGGGCTGGCGG + Intergenic
1098059905 12:66550685-66550707 TCGTGTGTATGTTGGGTAGGGGG + Intronic
1100704522 12:97185875-97185897 TAGTGTGTATGTGGGGGAAGGGG + Intergenic
1100960144 12:99953957-99953979 TAGGGGGTTTGTGGGGGAGGCGG + Intronic
1102976493 12:117210464-117210486 TGCTGGGTATGTGGGGCAGCGGG + Exonic
1103045690 12:117732850-117732872 CAGAGGGGATGTAGGCCAGGAGG + Intronic
1104791884 12:131488195-131488217 TAGTGGGAATGTAATACAGGTGG - Intergenic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105733363 13:23243286-23243308 TAGTGATTATGAGGGGCAGGCGG - Intronic
1107880351 13:44827066-44827088 TAGTGGAGGGGTAGGGCAGGTGG - Intergenic
1110706825 13:78607340-78607362 TAGTGGGTATACAGGGGAGGGGG + Intergenic
1111118279 13:83811162-83811184 TGGTAGGTATGAAGGGCAGATGG - Intergenic
1113507313 13:110826184-110826206 TGGTGGGAGTGAAGGGCAGGCGG - Intergenic
1114755255 14:25252609-25252631 TGGTGTGTATGTAGGGCAGCTGG + Intergenic
1117457133 14:55909693-55909715 TAGTGGTTATCTGGGGCTGGAGG + Intergenic
1118243104 14:64080925-64080947 TAATGGGAATTTAGGGCAGGTGG + Intronic
1120516967 14:85482195-85482217 AAGTGAGTAGGTGGGGCAGGAGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1122122886 14:99563871-99563893 TCCAGGGTATGTGGGGCAGGGGG + Intronic
1124216636 15:27812938-27812960 TAGTGGGCATGTGGGGAAGTGGG - Intronic
1125080314 15:35664997-35665019 TAGGGTGTATGTAGGGCAGGAGG - Intergenic
1125577463 15:40765360-40765382 TAGTGGTTATCTAGGGCTGAGGG - Exonic
1126064916 15:44819327-44819349 TGGTGGGTTTCTGGGGCAGGGGG + Intergenic
1126094918 15:45081260-45081282 TGGTGGGTTTCTGGGGCAGGGGG - Intergenic
1127451776 15:59123677-59123699 TTGTGTGTATGTTGGGCGGGGGG + Intronic
1128030529 15:64476085-64476107 TAGTGGTGATGCATGGCAGGTGG + Intronic
1128252271 15:66171724-66171746 TAGTGAGTCTGCAGGGCTGGGGG - Intronic
1129075438 15:72991794-72991816 TAGTGGTTGTCTAGGGCAGGGGG + Intergenic
1132106521 15:99066752-99066774 TAGTGGGCTTGGAGGGTAGGTGG + Intergenic
1135254441 16:20929762-20929784 AGGTGGGGATGTAGGGAAGGTGG - Intergenic
1136513794 16:30755901-30755923 TAGTGGGTAGGTAGGGTTGGAGG + Intronic
1137555942 16:49470417-49470439 GAGTTGGTCTGCAGGGCAGGGGG + Intergenic
1139140229 16:64253561-64253583 TAGTGGATATGGTGGGCAGGTGG - Intergenic
1141540086 16:84713446-84713468 TAGCGGGTATGTAGGGTATTAGG - Intronic
1146418913 17:32664230-32664252 TTGTGTGTATGTGTGGCAGGAGG + Intronic
1146458243 17:33023831-33023853 TAGTGGGCATGGTAGGCAGGGGG - Intronic
1146499750 17:33354304-33354326 TAGTGGGGATGGAGAGCATGAGG - Intronic
1147790922 17:43013973-43013995 TGGTGGGTAGGTAGGTCAGTGGG - Intronic
1148127800 17:45245819-45245841 TAGGGGGTGGGTAGGGCAGTAGG + Intronic
1148810122 17:50284971-50284993 TAGTGCGGAGGTGGGGCAGGGGG + Intergenic
1151326405 17:73382379-73382401 TAGAGGATATTTAGGGAAGGAGG + Intronic
1151374684 17:73679112-73679134 AAGGGGGTTTGCAGGGCAGGAGG - Intergenic
1151975395 17:77481276-77481298 TCTTGGGTATGTGGGGCACGTGG - Intronic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1153758810 18:8310502-8310524 TAGTGTGTATTCAGGCCAGGAGG - Intronic
1155489709 18:26388488-26388510 TAGTGGGTATGTAGTGGTGGCGG + Intronic
1155715269 18:28934472-28934494 TGGTGGGTATGTACGACAGTTGG + Intergenic
1155890046 18:31256433-31256455 TAGTGACTATGAAGGGGAGGTGG - Intergenic
1157908654 18:51594274-51594296 TAGTGAGTATGTAGGGTAAGCGG - Intergenic
1158447049 18:57530774-57530796 TTGTGTGTATGTGGGGGAGGAGG - Intergenic
1159186153 18:64977105-64977127 GATTGGGTAGGTTGGGCAGGGGG + Intergenic
1159272051 18:66165478-66165500 TAGTGGATATGGAGGCCAGAAGG + Intergenic
1160782274 19:883180-883202 AAGTGGGGATGTGGGGCAGTGGG + Intronic
1163857638 19:19717324-19717346 TGGTCGGTATGCAGAGCAGGTGG + Intronic
1164678657 19:30119652-30119674 TAGTGGGTGCATAGGGTAGGGGG + Intergenic
925280950 2:2684001-2684023 TAGAGGGTCTGCAGGGCTGGTGG - Intergenic
926216131 2:10906549-10906571 TAGTGGGTGTCTAGGGCAGGGGG + Intergenic
927191721 2:20521757-20521779 TGGTGGAGATGCAGGGCAGGGGG - Intergenic
927471986 2:23384250-23384272 TAAAGGGGATGTAGGGGAGGAGG + Intergenic
929667992 2:43848668-43848690 TTGTGTGTATGTTGGGCAGGGGG - Intronic
930130963 2:47850148-47850170 GAGTGGGTATGGTGGGCTGGGGG + Intronic
931654656 2:64500194-64500216 TACTGGGGAAGTAGGGGAGGTGG + Intergenic
935089145 2:99877290-99877312 TAATCGGTATGAAGGGCAGGAGG + Intronic
935571178 2:104661253-104661275 TGGTGGGTAGGTAGGGAAGGGGG + Intergenic
935747140 2:106198404-106198426 TAGTGGGGATCTCTGGCAGGAGG + Intergenic
936558780 2:113518577-113518599 TAGTGGGCATGGAAGGGAGGGGG + Intergenic
936598144 2:113868968-113868990 TATTGGGAATGGAGGGCAAGTGG + Intergenic
937254543 2:120546010-120546032 TAGAGGGTGTGTGGGGGAGGGGG + Intergenic
937937227 2:127256015-127256037 GAGGCGGTATGTGGGGCAGGTGG + Intergenic
938107650 2:128544378-128544400 GAGTGGGTAGGTGGGGCATGTGG + Intergenic
938650135 2:133374558-133374580 AAGTGCGTGTGTAGGGCAGTGGG + Intronic
938650161 2:133374650-133374672 AAGTGCGTGTGTAGGGCAGGGGG + Intronic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
940384746 2:153057809-153057831 TAGTGGGGAGGGAGGGCATGGGG - Intergenic
942076363 2:172360190-172360212 CAGGGTGTATGAAGGGCAGGGGG - Intergenic
943876193 2:193071104-193071126 GAGTGGAAATGTAGGGCTGGGGG + Intergenic
944814667 2:203363507-203363529 AAGTGGGGAGGTAGGACAGGAGG - Intronic
944941611 2:204634123-204634145 TAATGGGGAGCTAGGGCAGGAGG - Intronic
946342679 2:219081296-219081318 TAGTGGCTACCTGGGGCAGGCGG + Intronic
947516656 2:230811324-230811346 TACTGGGAGTGGAGGGCAGGGGG - Intronic
947534242 2:230931011-230931033 TGGCGGGTAGGTAGGGCAGGTGG - Intronic
948722607 2:239911054-239911076 TAGTGGGTCTGCTGGGCAGAGGG + Intronic
1171035920 20:21712997-21713019 TGGAGGGAATGGAGGGCAGGAGG + Intronic
1171247838 20:23627192-23627214 TAGTGGTTGTCTAGGGCTGGGGG - Exonic
1171448853 20:25222506-25222528 GAGGGGGAATGTAGGGCAGATGG + Intronic
1172034252 20:32000460-32000482 TAATGGATGTGGAGGGCAGGTGG - Exonic
1172038633 20:32028471-32028493 TAGTGGGTTTGAGGGGCAGCAGG + Intronic
1172363524 20:34331667-34331689 TACTGGGTAGCTAAGGCAGGAGG + Intergenic
1172579397 20:36034904-36034926 TGAGGGGAATGTAGGGCAGGGGG + Intergenic
1172663596 20:36584147-36584169 TAGTGGGAATGTAGGGGACCAGG - Intronic
1172906736 20:38375835-38375857 TAAAGGGAATGAAGGGCAGGGGG + Intronic
1172988953 20:39017720-39017742 TAGAGGGCAAGAAGGGCAGGTGG + Intronic
1173556523 20:43969965-43969987 TACTGGAGATGTAGGGCAAGGGG - Intronic
1174128378 20:48325382-48325404 TAGTGTGTCTGAGGGGCAGGGGG - Intergenic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1178808513 21:35859756-35859778 TGGTGGGTATGTAGGGCTGTGGG - Intronic
1178964549 21:37103996-37104018 TAGTGTGGATGTAGGTTAGGAGG + Intronic
1179569229 21:42268243-42268265 GGGTGGGAAAGTAGGGCAGGCGG + Intronic
1179653114 21:42827563-42827585 TAGTGGGAGGGTAGGGGAGGTGG - Intergenic
1180008955 21:45037167-45037189 TGGTGGGGAGGAAGGGCAGGAGG + Intergenic
1182216404 22:28722178-28722200 TTGTGGGTACCTAGGGGAGGAGG - Intronic
1184127990 22:42501054-42501076 GAGTGGAAATTTAGGGCAGGCGG - Intergenic
1184136779 22:42554369-42554391 GAGTGGAAATTTAGGGCAGGCGG - Intronic
950096075 3:10331421-10331443 TAGTGTATGTGTGGGGCAGGGGG + Intronic
952540378 3:34361063-34361085 TGTTGGGTATGTTGGGCAGATGG + Intergenic
952886469 3:38015405-38015427 TAGTGGCTGTCTAGGGCTGGGGG + Intronic
954104612 3:48403276-48403298 AGTTGGGTCTGTAGGGCAGGGGG - Intergenic
956958183 3:74365621-74365643 TATTGGGAATGCAGGGCAAGCGG - Exonic
960572166 3:119196035-119196057 TAGTTGGTAGGTAGTGGAGGTGG - Intronic
964372404 3:156014249-156014271 TAGTGGTTATCTAGGGCTCGGGG + Intergenic
973639773 4:52891352-52891374 CAGTGGGTAAGTAAGGAAGGTGG + Intronic
975361975 4:73481002-73481024 TGGTGGTTATCAAGGGCAGGAGG - Intergenic
975769953 4:77710097-77710119 TAGTGGGTTTGAAGTGCAAGTGG + Intergenic
978328388 4:107585175-107585197 CACTGGGTCTGTTGGGCAGGGGG + Intergenic
979129260 4:117019975-117019997 TAGTGGGGCTGTAGGGGAGTGGG + Intergenic
980309660 4:131109657-131109679 TAGTGGCTGTGGAGGGTAGGGGG + Intergenic
981002324 4:139839819-139839841 TAGTGGATATGAAGGGGAGATGG + Intronic
982814778 4:159871252-159871274 GAGAGGGTATGGAGAGCAGGAGG + Intergenic
984662574 4:182389270-182389292 CAGAGAGTTTGTAGGGCAGGTGG - Intronic
985519427 5:366068-366090 CAGTGTGTGTGTGGGGCAGGGGG - Intronic
986587762 5:9336287-9336309 AAGTGGGAATGCAGGGCAGAAGG + Intronic
988190197 5:27920447-27920469 TAGTGGTTGTGTAGAGCTGGGGG + Intergenic
988965727 5:36415836-36415858 CAGTGGTTGTATAGGGCAGGAGG + Intergenic
990320473 5:54625145-54625167 TAGTGTGTATGAGGGGAAGGGGG + Intergenic
991992395 5:72353174-72353196 TCATGGGTATATAGGGCAAGGGG - Intronic
993275399 5:85850501-85850523 CTGTGGTTATGCAGGGCAGGGGG + Intergenic
993322062 5:86483348-86483370 TAGAAAGTATGCAGGGCAGGAGG + Intergenic
997615013 5:135240264-135240286 CAGTGGTTATCTAGGGCATGAGG + Intronic
997810492 5:136962948-136962970 TGGTTGGTTTCTAGGGCAGGTGG + Intergenic
998059234 5:139106008-139106030 AAGTGGCTGTGTAGGGGAGGGGG + Intronic
1001041690 5:168340499-168340521 TAGTGGTTGTCTAGGGCTGGGGG - Intronic
1001404899 5:171469295-171469317 TAGTGGCTTTGTCGGGCAGAGGG + Intergenic
1002305130 5:178278676-178278698 GGATGGGTATGTGGGGCAGGAGG - Intronic
1005155614 6:22802738-22802760 TACTGAATATGTAGGGAAGGGGG + Intergenic
1005278369 6:24244048-24244070 TAGTGTGTATGTTGGTTAGGAGG - Intronic
1006898719 6:37486566-37486588 TGGTGGGGCTGCAGGGCAGGGGG - Intronic
1008058096 6:46966315-46966337 TAGTGGGTGTGAAGGGCTGGGGG - Intergenic
1008468854 6:51860467-51860489 TGGTGGCTATTTAGGGCATGGGG - Intronic
1010033274 6:71291074-71291096 TAGAGGGTATGAAGAGGAGGAGG + Intronic
1013483541 6:110573669-110573691 TAGTGGCCATGTACTGCAGGAGG - Intergenic
1015499286 6:133915285-133915307 TTGTGGATATGGAGGGCTGGTGG - Intergenic
1021655734 7:22871932-22871954 TAGTGGGAATAAAGGGAAGGGGG - Intergenic
1022139919 7:27484622-27484644 TGGTGGGTATGTGGAGCAAGGGG - Intergenic
1022702608 7:32775835-32775857 AGGTGGGTCTGTAAGGCAGGAGG - Intergenic
1022845846 7:34209124-34209146 TAGTGGGTATGATGAGAAGGAGG + Intergenic
1023863233 7:44227470-44227492 AAGGGGGTATGGGGGGCAGGGGG + Intronic
1025606667 7:63044517-63044539 TAGTAGGGATGCAGGGAAGGGGG - Intergenic
1029438608 7:100575547-100575569 CAGGGGGCATGCAGGGCAGGGGG + Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1031723208 7:125203503-125203525 TAGTGAGTGTGTAGGGCAATTGG - Intergenic
1032494530 7:132351107-132351129 TAGTGGCTACCTAGGGCTGGGGG + Intronic
1032505736 7:132433345-132433367 TGCTGGGTATGTAGGGTAGAAGG - Intronic
1034971581 7:155423021-155423043 TTGAGGGTGTGTAGGGCGGGAGG - Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1038307749 8:26420052-26420074 TGGTGGGCGTGGAGGGCAGGAGG - Intronic
1040057714 8:43074892-43074914 TTGTGGGTATGTGGGACAGGTGG - Intronic
1041320856 8:56611155-56611177 TAGTGGGTTTTTATGGTAGGGGG + Intergenic
1043043355 8:75290049-75290071 TAGGGTGCATGTAGGGCAGAGGG + Intergenic
1043668615 8:82851229-82851251 TTGTGTGTATGTGGGGGAGGGGG + Intergenic
1045496323 8:102712491-102712513 TAGTGGGGATGGTGGGCGGGGGG - Intergenic
1045554619 8:103203599-103203621 TAGTGGTTATGTAGGGCTGGGGG - Intronic
1047463948 8:125094133-125094155 TATTGGGTATGAAGGGGAGAAGG + Intronic
1049270615 8:141693708-141693730 TGGTGGGTTTGAAGGGCTGGGGG + Intergenic
1049894070 9:97604-97626 TAGTGGGCATGGAAGGGAGGGGG - Intergenic
1050826964 9:9958878-9958900 TAGTGAGAATGTAGGGCAATAGG + Intronic
1050961834 9:11743669-11743691 GACTAGGTATGGAGGGCAGGGGG + Intergenic
1051201641 9:14633355-14633377 CAGTGGGAATGTTGGGCAGTAGG - Intronic
1051442174 9:17097064-17097086 CTGTGAGTGTGTAGGGCAGGAGG - Intergenic
1051643237 9:19243160-19243182 TAGTGGTTATCTAGGGCTAGGGG - Intronic
1052564037 9:30123699-30123721 AAGTGGCTATCTAGGCCAGGTGG - Intergenic
1053735296 9:41097688-41097710 TAGTGGGCATGGAAGGGAGGGGG - Intergenic
1054693083 9:68333709-68333731 TAGTGGGCATGGAAGGGAGGGGG + Intronic
1054923219 9:70562602-70562624 TTGTGTGTGTGTTGGGCAGGGGG + Intronic
1056736752 9:89216184-89216206 TAATGGGTATGAAGTGGAGGAGG - Intergenic
1056858409 9:90156362-90156384 CAGTGGGTATGATGGGGAGGAGG + Intergenic
1057426822 9:94957718-94957740 TAGTGGTTATGTAGGGCTGGGGG - Intronic
1058132698 9:101270898-101270920 TAGAGGGCAGGTAGGGGAGGAGG - Intronic
1059235464 9:112757155-112757177 TAGTGGCTACCAAGGGCAGGTGG - Intronic
1059521001 9:114942053-114942075 TAGTAGGTCTGTAGGGGAGGAGG + Intergenic
1061306445 9:129735792-129735814 TGGTGGGTATGGAAGGGAGGTGG - Intergenic
1062087006 9:134654148-134654170 CTGGGGGTATGTAGGGCTGGAGG + Intronic
1186340625 X:8642340-8642362 TAGTGGATATGTAGGACTGAAGG + Intronic
1186635037 X:11394357-11394379 TAGTGGGTACCTGGGGCTGGGGG + Intronic
1188779597 X:34264987-34265009 TAGTGGTTATCAAGGGCTGGGGG + Intergenic
1189151733 X:38715707-38715729 TAGTGGTTACCTAGGGCTGGGGG + Intergenic
1189655118 X:43236963-43236985 TAGTGAGTATGCTGGGAAGGTGG - Intergenic
1189864969 X:45318286-45318308 TAGTGGGTGAGTTGGGGAGGTGG + Intergenic
1190288169 X:48974150-48974172 TAGGGGGTAGGAAGGGGAGGAGG + Exonic
1191726826 X:64290599-64290621 TGGTGGGTATGAGGGGGAGGTGG - Intronic
1193373929 X:80734861-80734883 TAGTGGGTATTTAGAGTAGGGGG + Intronic
1196903809 X:120412269-120412291 TAGTGGGTATCTAGGTATGGAGG - Intergenic
1197234302 X:124041903-124041925 TGGTGGGTATGGAGTGGAGGTGG + Intronic
1197792957 X:130273409-130273431 TAGTAGTTGTGTAGGGCAGGAGG - Intergenic
1198574862 X:137998827-137998849 TTGTGTGTATGTGTGGCAGGTGG - Intergenic
1199652964 X:149965954-149965976 TAGTGGTTATCTAGGACAAGGGG - Intergenic
1199866528 X:151854806-151854828 GAGTGGTTATCTAGGGCTGGAGG - Intergenic
1200562170 Y:4718525-4718547 TTGGGGGAATGTAGGGGAGGGGG - Intergenic