ID: 924718645

View in Genome Browser
Species Human (GRCh38)
Location 1:246602619-246602641
Sequence AGTAACCTGCTTCTAATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 1, 2: 8, 3: 19, 4: 126}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924718645_924718650 2 Left 924718645 1:246602619-246602641 CCTTTCATTAGAAGCAGGTTACT 0: 1
1: 1
2: 8
3: 19
4: 126
Right 924718650 1:246602644-246602666 GTCCAACTTGTACTTATGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 61
924718645_924718652 5 Left 924718645 1:246602619-246602641 CCTTTCATTAGAAGCAGGTTACT 0: 1
1: 1
2: 8
3: 19
4: 126
Right 924718652 1:246602647-246602669 CAACTTGTACTTATGGGAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 98
924718645_924718649 -1 Left 924718645 1:246602619-246602641 CCTTTCATTAGAAGCAGGTTACT 0: 1
1: 1
2: 8
3: 19
4: 126
Right 924718649 1:246602641-246602663 TGGGTCCAACTTGTACTTATGGG 0: 1
1: 0
2: 1
3: 3
4: 53
924718645_924718653 15 Left 924718645 1:246602619-246602641 CCTTTCATTAGAAGCAGGTTACT 0: 1
1: 1
2: 8
3: 19
4: 126
Right 924718653 1:246602657-246602679 TTATGGGAGGAGGTTGTAAAAGG 0: 1
1: 0
2: 1
3: 19
4: 235
924718645_924718654 16 Left 924718645 1:246602619-246602641 CCTTTCATTAGAAGCAGGTTACT 0: 1
1: 1
2: 8
3: 19
4: 126
Right 924718654 1:246602658-246602680 TATGGGAGGAGGTTGTAAAAGGG 0: 1
1: 0
2: 1
3: 23
4: 247
924718645_924718648 -2 Left 924718645 1:246602619-246602641 CCTTTCATTAGAAGCAGGTTACT 0: 1
1: 1
2: 8
3: 19
4: 126
Right 924718648 1:246602640-246602662 CTGGGTCCAACTTGTACTTATGG 0: 1
1: 0
2: 1
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924718645 Original CRISPR AGTAACCTGCTTCTAATGAA AGG (reversed) Intronic
900554709 1:3274384-3274406 AGTAACATATTTCTAATGAAAGG + Intronic
901489536 1:9589514-9589536 AGTAACTTGCTGTTAATGAGAGG + Intronic
904015474 1:27416756-27416778 AATCACCAGCTTCTAATTAATGG + Intronic
904108775 1:28108407-28108429 AGTGAATTGCTTCTGATGAATGG - Intergenic
904850630 1:33456518-33456540 AGTGACCGGCTGCTAATGAGTGG - Intergenic
905678456 1:39847547-39847569 AGTAACCAGCTTCTAAAGAAAGG - Exonic
908509280 1:64838698-64838720 AGTAACATGCCTGTAATGAAGGG - Intronic
911306227 1:96235761-96235783 AGGAAAATGCTTCTAAAGAAAGG - Intergenic
912811163 1:112795663-112795685 AGGAAACTGCCCCTAATGAATGG + Intergenic
914312636 1:146480177-146480199 AGAAACCTGCTTGTAACAAAGGG - Intergenic
914484358 1:148094162-148094184 AGGACCCTGATTCTGATGAATGG + Intergenic
914501712 1:148253161-148253183 AGAAACCTGCTTGTAACAAAGGG + Intergenic
915656910 1:157368309-157368331 AGGCACCTGATTCTAAGGAAAGG - Intergenic
916556495 1:165898415-165898437 AGAAATCTGCTTCTGCTGAAGGG + Intronic
917494363 1:175526685-175526707 AATAAGCTGCTTCAAATGCATGG + Intronic
917794674 1:178524334-178524356 AGTGACTTGCTTCTAATGAATGG + Intronic
921791108 1:219291851-219291873 TTTATCCTGCTTCCAATGAATGG - Intergenic
924718645 1:246602619-246602641 AGTAACCTGCTTCTAATGAAAGG - Intronic
1062986591 10:1774768-1774790 AGTAACCTGCTGGGTATGAAGGG - Intergenic
1063482618 10:6389185-6389207 TGTGACATGCTTCTAATCAATGG - Intergenic
1063631403 10:7737054-7737076 AGAAACCTGATTCCAATGATTGG - Intronic
1064875242 10:19986736-19986758 AGTATACTGCTTATAAGGAATGG - Intronic
1070626305 10:78053715-78053737 AGCAACCTGCTTTTTATGAGAGG - Intronic
1071447115 10:85758812-85758834 AGTGACCTGCTAGTACTGAAAGG + Intronic
1073621185 10:105050272-105050294 AGTGGCTTGCTTCTAGTGAATGG + Intronic
1074012664 10:109499291-109499313 AGAAACCTGCCTCAGATGAAAGG + Intergenic
1081122225 11:39281339-39281361 ATTAAGCTGCTTATAATTAAAGG + Intergenic
1081298425 11:41420703-41420725 AGTAACCAGCTTGTAATTAGTGG - Intronic
1081326455 11:41751491-41751513 AATAACCTGCTTCTAAGTAATGG - Intergenic
1084133605 11:67157008-67157030 ATTAGCCAGCTTTTAATGAAAGG - Intronic
1085694500 11:78692481-78692503 GGTAACCTACTTAAAATGAAAGG + Intronic
1087274520 11:96147714-96147736 AGTAAACTGGTTATAAGGAAAGG + Intronic
1088591803 11:111409734-111409756 AGTATCCTCTTCCTAATGAAGGG + Intronic
1088783755 11:113162277-113162299 AAAAACATGCTTCTAATGACTGG - Intronic
1093522050 12:20062564-20062586 AGTGACTTGCTTCTAAGGGATGG + Intergenic
1093790070 12:23238361-23238383 AGAGACCTGCTTCTAAAGAATGG + Intergenic
1093790929 12:23249578-23249600 AGAAACTTGATTCTAAAGAAAGG - Intergenic
1096965805 12:55626578-55626600 AGTGACCTGCTTTTAATGAAGGG - Intergenic
1104635106 12:130433592-130433614 AGGAACTGGCTTCCAATGAATGG - Intronic
1110397340 13:75046579-75046601 TGTGACCTGCTTCTAACCAATGG + Intergenic
1111649582 13:91072562-91072584 TGTGACCTGCTTCTAACCAATGG + Intergenic
1113478211 13:110600454-110600476 AGCTCCCTGCTTCTAAGGAAAGG + Intergenic
1116461554 14:45180865-45180887 AGTGACTTGCTTCTAAAAAAAGG - Intronic
1118850485 14:69579359-69579381 ACTCACCTGCTTCTTATGAGTGG + Intergenic
1119130393 14:72167403-72167425 TGTAACTTGCTTCTAACCAATGG - Intronic
1120486641 14:85122437-85122459 ACCAACCAGCTTCTAATGACTGG + Intergenic
1125272025 15:37950145-37950167 AATAACTTACTTCTAAAGAATGG - Intronic
1129060633 15:72857853-72857875 AGTGACTCACTTCTAATGAATGG + Intergenic
1129643970 15:77413314-77413336 AGCAACCTGTTTCTAGTGCACGG + Intronic
1130360994 15:83185807-83185829 AGTTACTTACTTATAATGAATGG + Intronic
1130605811 15:85315727-85315749 ATTGACCTGCTTCTCATGAATGG - Intergenic
1131526897 15:93159805-93159827 TGGAACCTGATTCAAATGAAAGG - Intergenic
1134870212 16:17646073-17646095 AGTGACTTGCTTCTAACTAATGG + Intergenic
1135680427 16:24452198-24452220 TCTTAGCTGCTTCTAATGAATGG - Intergenic
1137315219 16:47312329-47312351 AGTCACCTGCTTAGAAGGAAAGG - Intronic
1137812188 16:51363364-51363386 AGTAACCTCCTCCTTCTGAATGG + Intergenic
1140136796 16:72213307-72213329 AGTGACTTGCTTCTAATACATGG + Intergenic
1143298449 17:5889317-5889339 AGTGATTTGTTTCTAATGAATGG - Intronic
1150666738 17:67147067-67147089 AGTAATCTGCTTTAAAAGAAAGG - Intronic
1150752231 17:67875441-67875463 AAAAACCTGCTTCCATTGAACGG - Intronic
1155257312 18:24009990-24010012 ACTAACTTGCCTCTAAGGAAGGG - Intronic
1155466270 18:26139088-26139110 AGTGACTTGCTTTTAAGGAATGG + Intronic
1158586265 18:58738078-58738100 AGTAACCTACATCTAATTATAGG + Intronic
1166829607 19:45631164-45631186 ATTAACCTGTATTTAATGAAAGG - Intronic
1168600074 19:57710457-57710479 AGTAACCTGCTTCTTCTGCCTGG - Intronic
929981376 2:46683401-46683423 ACTATTCTGCTGCTAATGAATGG - Intergenic
930126897 2:47806304-47806326 AATAATCTTCTACTAATGAATGG - Exonic
935936973 2:108196427-108196449 AGTAACCTGCAGCTAATAAGAGG - Intergenic
939115826 2:138059266-138059288 AGAAACAACCTTCTAATGAATGG - Intergenic
939989403 2:148863328-148863350 AGTGACTTGCTTCTAATCAATGG + Intergenic
942191585 2:173475903-173475925 AGCAACTTGCTTCTAACGAATGG + Intergenic
946846329 2:223861967-223861989 AGCAGCCTGCTTGTAAAGAAAGG + Intronic
948665054 2:239529423-239529445 AGTAACCTGCTTTTGTGGAAAGG - Intergenic
1170051785 20:12154034-12154056 TGTAACTTGCTTCTAACAAATGG - Intergenic
1170279294 20:14627335-14627357 AGTAACCTGCATCTAATGACTGG + Intronic
1172582638 20:36060448-36060470 AGTAACTTGCTTCCAAAGAGTGG + Intergenic
1173113586 20:40218976-40218998 ATTAATCTGCTTGTACTGAAGGG + Intergenic
1173476963 20:43366427-43366449 AATAACCCGCAGCTAATGAAAGG + Intergenic
1174876553 20:54232504-54232526 AGTGACATGCTTCTGATGAATGG + Intergenic
1175430719 20:58901153-58901175 TGGAGCCTGCTTTTAATGAATGG + Intronic
1177022972 21:15886031-15886053 GTTAACCAGCTTGTAATGAAGGG + Intergenic
1177114995 21:17074416-17074438 AGCAACTTGCTTCTAATGAATGG - Intergenic
1177873829 21:26607400-26607422 TGCTACCTGCTTTTAATGAAGGG + Intergenic
1178899743 21:36589401-36589423 AGTGACCTGAATCTAATGAGAGG + Intergenic
1181470543 22:23136614-23136636 ATCAACCTACTTATAATGAATGG - Intronic
1182914139 22:34012501-34012523 TGTAAGCTGCCTCTAAAGAAAGG - Intergenic
949730468 3:7106502-7106524 AGAAAACAGCTTCAAATGAATGG + Intronic
952971900 3:38656611-38656633 AGTGGCCTGCTTCTGATGAGAGG + Intergenic
956888545 3:73586185-73586207 ATTCCCCTGCTTCTAAAGAAAGG + Intronic
957244841 3:77703570-77703592 TGTAACCTGCTTCAAGGGAAAGG + Intergenic
957548288 3:81668852-81668874 AGGAAGCTGCTTCTACTGAGTGG + Intronic
959078397 3:101775702-101775724 AGTGACTTGCTACTAATGGATGG + Intergenic
960340116 3:116464575-116464597 AGTACCCTCCTTCTATTTAAAGG - Intronic
961399716 3:126630122-126630144 AGGAAGGTGCTTCAAATGAATGG + Intronic
962469283 3:135690925-135690947 ATTAAGCTGCTTCTGAGGAATGG + Intergenic
967723334 3:192838342-192838364 AGTGACTTGCTTCTAATGCATGG - Intronic
969945758 4:10781802-10781824 AGAAAGCTGCTTCTAAAGAAGGG - Intergenic
971054146 4:22893899-22893921 AGTAACTTGCTTCTAAAAAATGG - Intergenic
971446567 4:26756844-26756866 AGCCACCTGTTTCAAATGAAAGG - Intergenic
975155169 4:71063902-71063924 TCTAACCTGCTTATAAAGAAAGG + Intergenic
978821148 4:112968151-112968173 ACTAACCTGCTAATAATTAATGG - Intronic
980289755 4:130830373-130830395 AGTATCCTGCCTTTAATAAATGG - Intergenic
981540636 4:145843202-145843224 AGTAAGCTGCCTCTACTCAAAGG + Intronic
984248885 4:177308082-177308104 AATGACTGGCTTCTAATGAATGG + Intergenic
985100551 4:186454079-186454101 AGTGACTTACGTCTAATGAATGG + Intronic
991629325 5:68639060-68639082 AGTGACCTGCTTCTAAAGAATGG - Intergenic
992273326 5:75088610-75088632 AGCAACCTGTTTCTAATGAAAGG + Intronic
992912015 5:81404941-81404963 ACTACACTGCTTCTAATAAAAGG + Intergenic
996586733 5:125096872-125096894 AAAAATTTGCTTCTAATGAATGG + Intergenic
997105729 5:131017335-131017357 AGTAACCTGCTTCTGATCATTGG - Intergenic
997249702 5:132379054-132379076 AATAACCTGCTTATAAGAAATGG - Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
999856248 5:155597543-155597565 AGTAACCTTATGCTATTGAATGG + Intergenic
1000868824 5:166549519-166549541 AATATTCTGGTTCTAATGAAAGG - Intergenic
1001708584 5:173760119-173760141 AGTGACTTGCTTCTGATGAATGG - Intergenic
1005892105 6:30148366-30148388 TGTGACTTGCTTCTAATGAATGG + Exonic
1007983282 6:46180820-46180842 AGTAACCTGCTTTTCTTGAGGGG + Intergenic
1009414801 6:63403850-63403872 TGTAACTTGCTTCTAAACAATGG + Intergenic
1010237321 6:73586065-73586087 AGTAACATGCTTTTACTGAGAGG + Intergenic
1014053981 6:116991447-116991469 AGTAACCTGCTGCTCATTAGAGG - Intergenic
1014598417 6:123375217-123375239 AATATCCTGTCTCTAATGAAAGG - Intronic
1014930044 6:127324985-127325007 AGTAACTTGCTTCCAAGGAGTGG + Intronic
1015585112 6:134768561-134768583 AGTACCCTGTTTCTCATTAAAGG - Intergenic
1018420116 6:163633854-163633876 AGTAACTGGCTTCTAATGAATGG - Intergenic
1019195385 6:170278795-170278817 AGTAACATGCTTTTCGTGAATGG + Intergenic
1021261851 7:18468174-18468196 AGTGACTTGCTTCTAAAGAGTGG - Intronic
1022415897 7:30176768-30176790 AGCAACTTGCTTCTAACCAAAGG - Intergenic
1031059571 7:117035386-117035408 AGTAGACTGTTTCAAATGAATGG + Intronic
1031588288 7:123558905-123558927 AGTCTCATGCCTCTAATGAAAGG - Intergenic
1032319457 7:130872836-130872858 AGTAATTTGCTTCTAATGGATGG - Intergenic
1038685665 8:29715441-29715463 AATATCCATCTTCTAATGAATGG - Intergenic
1040050894 8:43013143-43013165 AGTAAACTACCTCTAATGAGTGG - Exonic
1041184453 8:55284731-55284753 CGTGACTTGCTTCTAATGAATGG - Intronic
1042330179 8:67571239-67571261 AGTCCCCTGCTGCTATTGAATGG - Intronic
1042796595 8:72670227-72670249 AGCAAGTTGCTTCTAATGAGTGG + Intronic
1043495197 8:80792501-80792523 AGTGACCTGCTTCTAGCAAAGGG + Intronic
1047817314 8:128478918-128478940 AGTAACCTGCTTCTGAATAATGG - Intergenic
1048998137 8:139806805-139806827 AGGATCCTGCTTCTCATGATGGG + Intronic
1052101874 9:24456887-24456909 AGTATACTGCTTCTAAGTAAAGG + Intergenic
1052339198 9:27348718-27348740 AGTAACCTACTTCTAATGAATGG + Intronic
1052414111 9:28156314-28156336 AGTAACCCCATTCTAAGGAATGG + Intronic
1052530607 9:29679660-29679682 AGTAATCTGTTTCTAAACAAAGG + Intergenic
1055831294 9:80381813-80381835 AGTAACATTAATCTAATGAATGG - Intergenic
1056123432 9:83511899-83511921 AGAAACCTGCTTCTTTTGCAGGG + Intronic
1057735934 9:97660283-97660305 AGAAATCTGCTTTTAATGTAAGG - Intronic
1059373514 9:113863050-113863072 CGTAACTTGCTTCTAATCAGTGG - Intergenic
1061508216 9:131044554-131044576 AGTGACTTGCTTCTAATGACTGG + Intronic
1185793856 X:2948402-2948424 AGTAACCTGCATCACCTGAAGGG - Intronic
1185927838 X:4166910-4166932 TGTAACTTGCTTCTAACCAATGG - Intergenic
1186107561 X:6224119-6224141 AGTATCCTCCTTCTAAAGATAGG - Intronic
1186412302 X:9354586-9354608 AGTAAGCGCCTTCTAATTAATGG + Intergenic
1188840243 X:35008515-35008537 AGTTACATACTTTTAATGAATGG + Intergenic
1197644314 X:129001589-129001611 AGTAACTTGCTACTAAAGCATGG + Intergenic
1198113144 X:133520580-133520602 AGTGACTTGTTTCTAATGAATGG - Intergenic
1198372142 X:136000469-136000491 AGAACCTTGCTTATAATGAAAGG - Intronic