ID: 924719043

View in Genome Browser
Species Human (GRCh38)
Location 1:246605892-246605914
Sequence ACGCGCGCTGCTGGTGCAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 3, 1: 1, 2: 18, 3: 12, 4: 72}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924719038_924719043 8 Left 924719038 1:246605861-246605883 CCGGCCCTCTTCCTGCTTCTGCT 0: 4
1: 63
2: 53
3: 168
4: 1380
Right 924719043 1:246605892-246605914 ACGCGCGCTGCTGGTGCAAGCGG 0: 3
1: 1
2: 18
3: 12
4: 72
924719039_924719043 4 Left 924719039 1:246605865-246605887 CCCTCTTCCTGCTTCTGCTTCTC 0: 3
1: 1
2: 32
3: 327
4: 2557
Right 924719043 1:246605892-246605914 ACGCGCGCTGCTGGTGCAAGCGG 0: 3
1: 1
2: 18
3: 12
4: 72
924719040_924719043 3 Left 924719040 1:246605866-246605888 CCTCTTCCTGCTTCTGCTTCTCG 0: 3
1: 0
2: 6
3: 116
4: 1309
Right 924719043 1:246605892-246605914 ACGCGCGCTGCTGGTGCAAGCGG 0: 3
1: 1
2: 18
3: 12
4: 72
924719041_924719043 -3 Left 924719041 1:246605872-246605894 CCTGCTTCTGCTTCTCGCTGACG 0: 3
1: 0
2: 0
3: 8
4: 134
Right 924719043 1:246605892-246605914 ACGCGCGCTGCTGGTGCAAGCGG 0: 3
1: 1
2: 18
3: 12
4: 72
924719035_924719043 28 Left 924719035 1:246605841-246605863 CCGGGGTGCGTGTCTTCCGGCCG 0: 7
1: 1
2: 18
3: 34
4: 101
Right 924719043 1:246605892-246605914 ACGCGCGCTGCTGGTGCAAGCGG 0: 3
1: 1
2: 18
3: 12
4: 72
924719037_924719043 12 Left 924719037 1:246605857-246605879 CCGGCCGGCCCTCTTCCTGCTTC 0: 3
1: 12
2: 51
3: 84
4: 486
Right 924719043 1:246605892-246605914 ACGCGCGCTGCTGGTGCAAGCGG 0: 3
1: 1
2: 18
3: 12
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924719043 Original CRISPR ACGCGCGCTGCTGGTGCAAG CGG Intronic
900143178 1:1147006-1147028 ACGCCCTCTGCAAGTGCAAGTGG - Intergenic
903647094 1:24902263-24902285 GGCAGCGCTGCTGGTGCAAGAGG + Exonic
910163542 1:84299016-84299038 GCCGGCGCTGCTGGTCCAAGAGG + Intronic
915046676 1:153023281-153023303 ACGCATGCTGCTGATGCAAGTGG + Intergenic
918372072 1:183870544-183870566 ACGCGTGCTGCTGGCGCAAGTGG + Intronic
922665617 1:227466156-227466178 ATGAGCGGTGCTGGTACAAGAGG + Intergenic
924719043 1:246605892-246605914 ACGCGCGCTGCTGGTGCAAGCGG + Intronic
924722238 1:246635019-246635041 ACGCGCGCTGCTGGTGCAAGTGG + Intronic
924794923 1:247286221-247286243 AGGCGCGCTGCTGGCGCAAGTGG - Intergenic
924795640 1:247290461-247290483 ACGCGCGCTGCTGGTGCAAGCGG - Intergenic
1069686200 10:70320631-70320653 ACGCCCGATGCTGGTGGAGGTGG + Intronic
1076406121 10:130213578-130213600 ACCCACGCTGCTGGCGCGAGTGG + Intergenic
1083063586 11:59899792-59899814 AGGCACAGTGCTGGTGCAAGTGG + Intergenic
1087049407 11:93870124-93870146 ATGCACGCTGCTGGTGCAAGTGG + Intergenic
1087172786 11:95067472-95067494 ACGCGAGCTGCGGGTGCAGGTGG + Exonic
1090798401 11:130155062-130155084 ACCCGCTCTGCTGCTGCAAAAGG + Intergenic
1098979185 12:76936649-76936671 ACGCACTCTGCTGGTGCAAGTGG - Intergenic
1099861122 12:88227371-88227393 ATGCACACTGCTGGTGCAAGTGG - Intergenic
1099862309 12:88235294-88235316 ATGCACGCTGCTGACGCAAGTGG - Intergenic
1100089027 12:90947676-90947698 ATGCACGCTGCTGGCGCAAGTGG - Intronic
1101813624 12:108129289-108129311 AGGCGCGCTGCTGGTGGCGGCGG + Intergenic
1109458893 13:62627758-62627780 ACACGAGCCGCTGGTGCAAGTGG - Intergenic
1113853244 13:113429766-113429788 ACTCGCCCTGCTGGTGCTTGGGG + Intronic
1115788892 14:36856937-36856959 AAGCTCACTGCTGGTGCAAAAGG + Intronic
1131000905 15:88939208-88939230 ACGCATGCCGCTGGCGCAAGTGG + Intergenic
1137071866 16:35910683-35910705 ACACACGCTGCTGGTGCAAGTGG + Intergenic
1137071941 16:35911246-35911268 ATGCACACTGCTGGTGCAGGTGG + Intergenic
1138528413 16:57621781-57621803 AAGGGAGCTGCTGATGCAAGAGG + Intronic
1141603495 16:85140034-85140056 ACGGGAGCTGCCTGTGCAAGAGG + Intergenic
1150069835 17:62140971-62140993 ACGCACGCTGCTGGTACAAGTGG - Intergenic
1151580142 17:74972828-74972850 GCGGGCGCTGCAGGTGCAGGAGG - Intronic
1151858030 17:76736893-76736915 CCGCGAGCTGCGGGTGCAAATGG - Exonic
1155657487 18:28209125-28209147 ACACACGCTGCTGGCACAAGTGG + Intergenic
1155804183 18:30145246-30145268 ACGCACGCTGCTGGCACAAGTGG - Intergenic
1159915807 18:74186800-74186822 ACACACGCTGCTGACGCAAGTGG - Intergenic
1160780908 19:877666-877688 AGGCGAGCTGCTGGGGCACGTGG - Intronic
1160780951 19:877796-877818 AGGCGAGCTGCTGGGGCACGTGG - Intronic
1160780966 19:877852-877874 AGGCGAGCTGCTGGGGCATGTGG - Intronic
1160781023 19:878038-878060 AGGCGAGCTGCTGGGGCACGTGG - Intronic
1160781223 19:878690-878712 AGGCGAGCTGCTGGGGCACGTGG - Intronic
1160781356 19:879080-879102 AGGCGAGCTGCTGGGGCACGTGG - Intronic
1160781381 19:879148-879170 AGGCGAGCTGCTGGGGCACGTGG - Intronic
1160781402 19:879236-879258 AGGCGAGCTGCTGGGGCATGTGG - Intronic
1160781453 19:879436-879458 AGGCGAGCTGCTGGGGCACGTGG - Intronic
1160781470 19:879492-879514 AGGCGAGCTGCTGGGGCACGTGG - Intronic
1160781506 19:879628-879650 ACGTGAGCTGCTGGGGCACGTGG - Intronic
1160781522 19:879684-879706 AGGCGAGCTGCTGGGGCACGTGG - Intronic
1160781546 19:879772-879794 AGGCGAGCTGCTGGGGCACGTGG - Intronic
1161029652 19:2051705-2051727 AAGCGTGCTGGTGGTGCACGAGG - Intergenic
1162495154 19:11019390-11019412 ACACGCGCTGCAGGGGGAAGAGG - Intronic
1164236793 19:23344804-23344826 ACGCACGCTGCTGGTGCAAGGGG - Intronic
1167505701 19:49870000-49870022 GCGCGCGCTGGTGCTGCGAGAGG - Exonic
1168047824 19:53806747-53806769 ACTCGTGATGCTGGAGCAAGAGG + Intronic
927376404 2:22420012-22420034 ACACACGCTGCTGGTGCAAGTGG + Intergenic
931275666 2:60741794-60741816 ACGCATGCTGCTGGCACAAGTGG + Intergenic
935754482 2:106266278-106266300 AGGCACGCTGCTGGCCCAAGTGG + Intergenic
937939164 2:127271830-127271852 ACGTGTGCTGCTGGTGTCAGTGG - Intronic
941978984 2:171434374-171434396 CCGCGCTCTGGCGGTGCAAGCGG + Exonic
948311341 2:236989222-236989244 ACGAGGGCTGCTGGTGCATTGGG - Intergenic
948980898 2:241494238-241494260 ACCCACACTGCTGGTGCCAGTGG - Exonic
1170120941 20:12911021-12911043 ACCCTCGGTGCTGGTGGAAGAGG + Intergenic
1179890187 21:44331305-44331327 ACACCCGCTGCTGGTGCCTGTGG - Intronic
1182897796 22:33873302-33873324 TCGTGCGCTGCTCGTGCCAGGGG - Intronic
953064815 3:39459204-39459226 ACGCAGGCTGCTGGTGCAAGTGG - Intergenic
954558091 3:51534006-51534028 ACGCACACTGCTAGCGCAAGTGG + Intergenic
972075646 4:35082911-35082933 ACCCGCGTAGCTGGTGCAAAAGG + Intergenic
972224918 4:37001777-37001799 ACGCACGCTGCTGACGCAAGTGG - Intergenic
972356901 4:38287905-38287927 ACTCACTCTTCTGGTGCAAGAGG + Intergenic
973052702 4:45613792-45613814 ACGCTCGCTGCTGATGCAAGTGG - Intergenic
973624020 4:52752946-52752968 AGCCGCGCTGCTGGTGCTGGGGG - Intergenic
974489658 4:62548435-62548457 ACGCACGCTGCTGGCACAATTGG + Intergenic
974781280 4:66556773-66556795 ATGCACCCTGCTGATGCAAGTGG - Intergenic
974958389 4:68671819-68671841 ACACACGCTGCTGATGCAAGTGG - Intergenic
976299531 4:83505181-83505203 ACACACGCTGCTGATGCAGGTGG + Intronic
976741233 4:88359632-88359654 ACACACGCTGCTGATGCAGGTGG - Intergenic
988258435 5:28850682-28850704 ACACATGCTGCTGATGCAAGTGG + Intergenic
989095486 5:37777628-37777650 ACGCACGCTGCTGGCGCAAGAGG - Intergenic
989586211 5:43075571-43075593 ACACACGCTGCTGGTGCAAGTGG + Intronic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1007474318 6:42108703-42108725 ATGTGCGCTGCTGGGGCCAGGGG - Intronic
1015924326 6:138294183-138294205 AGGCACGCTGCTGGTGATAGAGG - Intronic
1017016109 6:150100768-150100790 ACGCACGCTGCTGGCGCAGGTGG - Intergenic
1018768460 6:166952384-166952406 ACCCACGCTGCTGGTGCGGGAGG - Intronic
1024195298 7:47053038-47053060 ACGCGAGCTGCGGGTGCAGATGG + Intergenic
1029803323 7:102973290-102973312 ACTCACGCTGCTGGTACAAGTGG - Intronic
1031996499 7:128235370-128235392 ACTCCAGCTGCAGGTGCAAGTGG + Intergenic
1034306521 7:150048558-150048580 ACGCGAGCGGACGGTGCAAGGGG + Intergenic
1034800326 7:154052085-154052107 ACGCGAGCGGACGGTGCAAGGGG - Intronic
1036382318 8:8244606-8244628 ACGCACGCTGCTGATGCAAGCGG - Intergenic
1042157658 8:65863315-65863337 ATGCACACTGCTGGTACAAGTGG - Intergenic
1042158690 8:65870163-65870185 ATGCATGCTGCTGATGCAAGTGG - Intergenic
1043506717 8:80909995-80910017 ACGCACGCTGCTGGTGCAAATGG + Intergenic
1043506956 8:80911647-80911669 ATGCATGCTGCTGGTGCAAGTGG + Intergenic
1043768734 8:84169840-84169862 ACGCACGCTGCTGGAGCAAGTGG + Intergenic
1043856729 8:85273551-85273573 ACGCACGCTGCTGGAGCAAGTGG - Intronic
1043856812 8:85274060-85274082 ACACACACTGCTGGTGCCAGTGG + Intronic
1043857414 8:85277903-85277925 ACGCACGCTGCTGGAGCAAGTGG + Intronic
1050487501 9:6149456-6149478 ACGCACACTGCTGGTGCAAGTGG - Intergenic
1055490777 9:76803634-76803656 AGGCTGGCTGCTGGTGGAAGGGG + Intronic
1060479442 9:124009345-124009367 ACGTGGGCTGCTGGTCCGAGAGG + Intronic
1061449552 9:130660891-130660913 ACGCGCGCTGGTGCCTCAAGGGG + Intergenic
1062620309 9:137417563-137417585 ACGCGCGTTGCTGGTCCCCGTGG - Intronic
1192281964 X:69697320-69697342 AGGCACGCTGCTGGTGCAAGTGG + Intronic
1193912007 X:87317289-87317311 ATGCACGCTGCCGGTGCAAGTGG + Intergenic
1197947076 X:131851186-131851208 ATGCACTCTGCTGATGCAAGTGG + Intergenic
1198479907 X:137031645-137031667 GCGCGTGCTGTTGGTGCAGGTGG + Exonic