ID: 924722791

View in Genome Browser
Species Human (GRCh38)
Location 1:246638800-246638822
Sequence GTGTCCACACAGAAGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 2, 1: 2, 2: 11, 3: 18, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924722791 Original CRISPR GTGTCCACACAGAAGTGTGC AGG Intronic
900322211 1:2090441-2090463 GTGTCCCCACAGGATGGTGCTGG + Intronic
903495001 1:23760015-23760037 GAGTCCACACAGAGCTGAGCTGG - Exonic
903867681 1:26410901-26410923 GTGTCCAACCAGCAGTTTGCAGG + Exonic
906274081 1:44503464-44503486 GTGTGCATACATTAGTGTGCTGG + Intronic
907272137 1:53297411-53297433 GTGTCCTGACAGTAGGGTGCAGG + Intronic
907752502 1:57276154-57276176 GTGTGCACACAGTAGTGTGCAGG + Intronic
912748998 1:112269973-112269995 GTGTCCTCACAGACTTCTGCTGG - Intergenic
915646367 1:157275594-157275616 GTGTTTACACAGAAGTGTGCAGG + Intergenic
916011679 1:160711898-160711920 GGGGCCCCACACAAGTGTGCTGG - Intergenic
916540627 1:165750655-165750677 TTGTCCACACAAAAGTCTGTGGG - Intronic
916731733 1:167572731-167572753 GTTTCCAGACAGAAGTTTGAAGG + Intergenic
916941076 1:169679172-169679194 GAGTCCACACTGAAATGTGGAGG + Intronic
918355602 1:183704608-183704630 GTGTTCACACAGGAGTGCGTAGG + Intronic
920203921 1:204277728-204277750 CTGTCCACACAGAAGAAGGCTGG - Intronic
922685675 1:227637186-227637208 GTGTTCACACAGAAGTGTATAGG + Intronic
924722791 1:246638800-246638822 GTGTCCACACAGAAGTGTGCAGG + Intronic
1062801918 10:387428-387450 CTGTCCACACAGGAGTGTGCTGG - Intronic
1067083167 10:43223275-43223297 GTCCCCAAATAGAAGTGTGCAGG + Intronic
1067243445 10:44516447-44516469 GCTTCCACACAGATGTGTGGGGG + Intergenic
1067825675 10:49570941-49570963 GGGTCAACAGAGAAGGGTGCAGG + Intergenic
1068064500 10:52111674-52111696 GTTTCCACACTGAAGTTTCCTGG + Intronic
1069509426 10:69030535-69030557 GTGTCCACAAACAAGTTTACTGG - Intergenic
1071605816 10:86987785-86987807 GTGACAACACAGAACGGTGCTGG - Intergenic
1071743537 10:88389293-88389315 GTCTCCTAACAGAACTGTGCTGG + Intronic
1073177836 10:101567231-101567253 GTGTGCACAGAGCAGTGTGTAGG - Intergenic
1074377990 10:112953916-112953938 GTGTACACAAAGATGTCTGCTGG - Intronic
1076921719 10:133457767-133457789 GTGGCCCCACAGAGGTGTCCTGG + Intergenic
1080754530 11:35183738-35183760 GTGTTCACACAGAAGTCACCAGG - Intronic
1083006501 11:59351527-59351549 GTGCACACACATAGGTGTGCTGG + Intergenic
1085600857 11:77854878-77854900 ATGTCCAGGCAGAAGTCTGCTGG - Intronic
1087048690 11:93865729-93865751 GTGTCTACATAGAAGTGTGCAGG + Intergenic
1087795137 11:102448476-102448498 ATGTCAGCACAGAAGTCTGCAGG - Intronic
1089347695 11:117801399-117801421 GTGTACCCACAAATGTGTGCAGG + Intronic
1089758753 11:120707420-120707442 GTGTAGACACACAAATGTGCAGG - Intronic
1090942015 11:131395162-131395184 GAGTCCACACACAAATGGGCAGG - Intronic
1091703885 12:2680888-2680910 GTGTGCACAGGGCAGTGTGCTGG + Intronic
1091855385 12:3735322-3735344 GTGGGCACAAAGAAGGGTGCGGG + Intronic
1096523585 12:52197876-52197898 GTGTGCTCACAGAGCTGTGCAGG - Intergenic
1097558152 12:61166394-61166416 GTGTCCAGGCATAAGTTTGCTGG - Intergenic
1098319843 12:69232225-69232247 ATGTCCAGATAGAAGTCTGCTGG + Intergenic
1099861846 12:88231865-88231887 GTGTCTACACAGAAGTGTGCAGG - Intergenic
1100344830 12:93718196-93718218 GTATCCACAAAATAGTGTGCTGG + Intronic
1103036636 12:117662259-117662281 GTGTCTTGACAGAAGTTTGCTGG - Intronic
1104711502 12:130990068-130990090 GTGTCCACAAAGCAGAGTGAGGG - Intronic
1106544767 13:30720920-30720942 GTGCCCACAGAGAAGTGGGAAGG - Intronic
1110849947 13:80233427-80233449 ATTTACACACAGAGGTGTGCTGG - Intergenic
1115122004 14:29948502-29948524 GTGTCCAGGCAGAAGTTTGCTGG - Intronic
1116003074 14:39265278-39265300 GTGTGGAAACAGAAGAGTGCAGG + Intronic
1117982669 14:61357377-61357399 GTGACTACACATAAGTTTGCAGG - Intronic
1118942221 14:70348413-70348435 GTGTTCACACAGAAGTGTGTAGG - Intronic
1119442501 14:74637694-74637716 GTGCTCACAGAGCAGTGTGCTGG - Intergenic
1121968861 14:98337976-98337998 GAGTACACACAGAAGAGTGTTGG - Intergenic
1123982651 15:25617942-25617964 GCGTGCACACAGATGTGTACAGG - Intergenic
1124339110 15:28878490-28878512 GGGGAGACACAGAAGTGTGCTGG - Intergenic
1125231519 15:37462281-37462303 ATGTCCAGGCAGAGGTGTGCTGG - Intergenic
1125248945 15:37677152-37677174 GTGTGCACACACAGCTGTGCGGG + Intergenic
1127243244 15:57142098-57142120 GCATCCACACAGAAGGGTGCAGG + Intronic
1127993635 15:64138685-64138707 GTGTTCACACAGATCTCTGCCGG + Exonic
1131273400 15:90960476-90960498 GTGTCACCACAGCTGTGTGCCGG - Exonic
1131288733 15:91085957-91085979 GTGTTCACACAGAGGTGTGATGG + Intergenic
1132232212 15:100192678-100192700 GTGTCCCCACAGCACTGTGCCGG + Intronic
1133611931 16:7441751-7441773 ATCTCCACACTGAGGTGTGCAGG - Intronic
1135026351 16:19002274-19002296 TTGTCCAGACTGAAGTGTGATGG + Intronic
1136872475 16:33820171-33820193 ATGTCCAGGCAGAAGTTTGCTGG - Intergenic
1137071195 16:35906307-35906329 GTGTCTACACAGAAGTGTGCAGG + Intergenic
1140468075 16:75198001-75198023 ATGACCACACAGAAGTTTACTGG + Intergenic
1141884823 16:86884306-86884328 GTGGCTCCACAGAAGTCTGCAGG - Intergenic
1142282283 16:89154804-89154826 ATGGACACACAGTAGTGTGCAGG - Exonic
1203099697 16_KI270728v1_random:1295897-1295919 ATGTCCAGGCAGAAGTTTGCTGG + Intergenic
1143916044 17:10293768-10293790 GGGTCCACTCAGTAATGTGCTGG + Intergenic
1146653189 17:34619880-34619902 ATGTGCACACAGAGGTGAGCAGG + Intronic
1148278924 17:46332042-46332064 GTGCCCACACAGAAGAGTCTGGG + Intronic
1148301139 17:46549904-46549926 GTGCCCACACAGAAGAGTCTGGG + Intronic
1151444433 17:74153910-74153932 GGGTCCTCAGAGAAGTGAGCTGG - Intergenic
1152554808 17:81047609-81047631 GTGTACACTCACACGTGTGCTGG - Intronic
1152702570 17:81826316-81826338 GTGTACAGACAGGTGTGTGCGGG - Exonic
1152846117 17:82600798-82600820 ATTTCCACACAGAAGGGAGCGGG - Intronic
1153747762 18:8198016-8198038 GTGTCCACACAGAAGAAGGTGGG - Intronic
1154426012 18:14272547-14272569 GTTTCCAAACAGAAGCCTGCTGG - Intergenic
1156753154 18:40485717-40485739 TTGTAAGCACAGAAGTGTGCTGG - Intergenic
1157920292 18:51707323-51707345 GTGTTTACATAGAAGTGTGTAGG - Intergenic
1159371554 18:67533373-67533395 TCACCCACACAGAAGTGTGCAGG + Intergenic
1161217385 19:3101223-3101245 GTGTCCACACTGATGGGTGCTGG + Intronic
1163344647 19:16732817-16732839 GTTTCCACAGGGAAATGTGCAGG - Intronic
1165419727 19:35716944-35716966 GTGAGGACACTGAAGTGTGCAGG + Exonic
1168467831 19:56618560-56618582 GTGTTCATAAAGAAGTGGGCAGG + Intronic
931486462 2:62698303-62698325 TTTTCCACACTGAAGTATGCTGG + Intronic
933167804 2:79094863-79094885 GTGTTCAAACAGAAGTGTGTAGG + Intergenic
934079991 2:88459570-88459592 TTTTGCACACAGACGTGTGCAGG + Intergenic
934614567 2:95763151-95763173 GTGGCCCCACAGAGGTCTGCAGG - Intergenic
934839740 2:97617430-97617452 GTGGCCCCACAGAGGTCTGCAGG + Intergenic
934922828 2:98359710-98359732 GCGTCCACAGACAGGTGTGCAGG - Intronic
935302548 2:101705393-101705415 GTGTCTGAACACAAGTGTGCTGG - Intronic
936075712 2:109400693-109400715 GTGTGCACACATATGCGTGCAGG - Intronic
937887122 2:126907605-126907627 GAGTGGACACTGAAGTGTGCAGG - Intergenic
937905999 2:127053113-127053135 GCCTCCAGACAGAAGTGGGCCGG - Intronic
938479166 2:131645685-131645707 GTGTCCACATGGCAGTGTGGTGG - Intergenic
939496435 2:142932895-142932917 GTGTTCACACAGAAGTGTTTAGG + Intronic
940596175 2:155795695-155795717 ATGTCCACACAGAAGTCTGCTGG - Intergenic
944621793 2:201523093-201523115 AGGTCCACACACACGTGTGCTGG - Intronic
945184145 2:207122671-207122693 GTGCCTCCAAAGAAGTGTGCAGG - Intronic
945977497 2:216282266-216282288 TTGCACACACACAAGTGTGCTGG - Intronic
948063431 2:235058876-235058898 TTGACCACACAGAAGGATGCAGG - Intergenic
949007869 2:241660288-241660310 GTCACCACACAGGTGTGTGCTGG + Intronic
1172445664 20:34992038-34992060 GTGTCCACTTAGAAGTGGGCAGG + Intronic
1174461799 20:50688596-50688618 GTCCCCAGACAGAGGTGTGCTGG - Intronic
1175167408 20:57054589-57054611 GTGTCCACACAGCAGGCAGCAGG - Intergenic
1176848747 21:13896836-13896858 GTTTCCAAACAGAAGCCTGCTGG + Intergenic
1177629992 21:23714478-23714500 CTGGCCCCACAGCAGTGTGCAGG + Intergenic
1177667758 21:24183352-24183374 TTGTCCACACAGTGCTGTGCTGG + Intergenic
1178425676 21:32477147-32477169 GTGTCCACTCACAGGTGAGCTGG + Intronic
1179667149 21:42920791-42920813 GTGTCCACACAGAAGTGTGCAGG + Intergenic
1180082174 21:45491933-45491955 GTGGCCACAGAGAACTCTGCAGG - Intronic
1180120158 21:45740662-45740684 GTGTACACACAGACCTGTGTGGG - Intronic
1180600434 22:17011908-17011930 GTGTCCCCACAGAAGGATTCAGG + Intergenic
1182305631 22:29365866-29365888 GTAACCACACTGAAGTGTACTGG - Intronic
1182312905 22:29421804-29421826 GTAACCACACTGAAGTGTACTGG - Intronic
1183189030 22:36309660-36309682 GTGGCCACACAGTACCGTGCTGG + Intronic
1183477314 22:38042736-38042758 CTGACCACACAGAAGAGGGCTGG + Intergenic
1183865613 22:40701906-40701928 GTATCCTCACAGAAGTGTGCAGG - Intergenic
1184704737 22:46202984-46203006 GTGACCACACTGAAGCGTCCTGG + Intronic
949438854 3:4058514-4058536 GGATCCACACAGAAGGGGGCAGG + Intronic
949521436 3:4858369-4858391 GTCTTCACACAGAATGGTGCTGG - Intronic
949642663 3:6056316-6056338 GTGTCCACAAAAAAGGCTGCAGG - Intergenic
950093371 3:10313070-10313092 GTTTCCAGCCAGAAGTGTTCAGG + Intronic
950721449 3:14885606-14885628 GTGGCCACAGATAAGTGTTCTGG - Intronic
952247106 3:31606635-31606657 ATGTCCAGGCAGAAGTTTGCTGG + Intronic
952939705 3:38433046-38433068 ATGTCCAGGCAGAAGTTTGCTGG - Intergenic
953152989 3:40342241-40342263 GTGTTCACACACACGTGTGTGGG - Intergenic
953293934 3:41694330-41694352 GTGTCCACACATAATTGAGTAGG + Intronic
953508730 3:43513106-43513128 GTTTCCTCACATACGTGTGCTGG - Intronic
954661853 3:52230650-52230672 GTGTGCACATAGATGTGTTCTGG - Intronic
959567732 3:107849585-107849607 CTCTCCACACAGATGTCTGCTGG - Intergenic
959841892 3:110985794-110985816 GTTTCCACTGAGAAGTCTGCTGG - Intergenic
961042316 3:123686228-123686250 GTGTCCCCAAAGAAGTGTGGGGG + Intronic
962146480 3:132845035-132845057 GTGTCCACCCAGTGGTGTGCCGG - Intergenic
963878319 3:150501182-150501204 ATGTCCAAGCAGAAGTTTGCTGG - Intergenic
965281870 3:166764889-166764911 ATGTCCAGGCAGAAGTCTGCTGG - Intergenic
965872564 3:173279072-173279094 GTGTTCACACAGAAGTGTGTAGG - Intergenic
966079934 3:175988906-175988928 GTGTGTACATAGCAGTGTGCTGG + Intergenic
966314808 3:178633345-178633367 ATGTCCAGTCAGAAGTTTGCTGG - Intronic
967215593 3:187207339-187207361 GTGTCCTCAGAGTACTGTGCTGG + Intergenic
967957312 3:194887097-194887119 ATGTCCAGAGAGATGTGTGCTGG - Intergenic
968162395 3:196437520-196437542 GTGTCCAGGCTGGAGTGTGCAGG - Intergenic
968476191 4:810017-810039 AGATCCACACAGACGTGTGCAGG - Intronic
970794106 4:19891498-19891520 GTGTTCACACAGAAGTGTGTAGG - Intergenic
971069298 4:23072730-23072752 GTGTCCACACAAAGGTAAGCAGG + Intergenic
971658042 4:29375346-29375368 GTGACCACAAAGAGTTGTGCGGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
972847159 4:43004295-43004317 ATGTCCAGGCAGAAGTCTGCTGG + Intronic
972911500 4:43822559-43822581 GTCTCCAGACAGAAGCATGCTGG - Intergenic
972965891 4:44509246-44509268 GTAGCCACACAGATGTCTGCGGG + Intergenic
973052367 4:45611240-45611262 GTGTTCACACAGAAGTGTGTAGG - Intergenic
974867745 4:67601690-67601712 GTTTCCACTGAGAAGTCTGCTGG + Intronic
977532718 4:98219157-98219179 GTGTCCACACACAAATGTTTTGG + Intergenic
978693219 4:111541542-111541564 AGGTCCACAGGGAAGTGTGCAGG - Intergenic
981197452 4:141938257-141938279 ATGTCCACACAGAAGGTTGTGGG - Intergenic
981837117 4:149066780-149066802 GTTTCCACTGAGAAGTCTGCTGG - Intergenic
983491726 4:168397832-168397854 CTGTCAACTCAGAAGTGGGCAGG - Intronic
983674443 4:170276135-170276157 GTGTGCACACAGACATGTGTTGG - Intergenic
985163291 4:187066002-187066024 CTGACCACGCGGAAGTGTGCTGG + Intergenic
985839824 5:2298025-2298047 GTGTCCCCACAGTGGTCTGCAGG + Intergenic
990185415 5:53205093-53205115 GTGTTCACACAGAAGCGTATAGG - Intergenic
991256234 5:64618145-64618167 GAGTCCACAGAGAATGGTGCTGG + Intergenic
991727553 5:69551014-69551036 CTTTCCAGACAGAAGGGTGCGGG + Intronic
991867404 5:71076860-71076882 CTTTCCAGACAGAAGGGTGCGGG - Intergenic
993037741 5:82775603-82775625 GTCTCCACACAGAAATCTCCAGG - Intergenic
993561670 5:89417925-89417947 TTGTCCAGGCAGAGGTGTGCTGG + Intergenic
996103484 5:119470279-119470301 ATGCCCACACAGAAGGCTGCAGG - Intronic
997273750 5:132564977-132564999 ATGTCCAGGCAGAAGTCTGCAGG + Intronic
1002882993 6:1269280-1269302 GTGCCCACCAAGAAGTGTGATGG + Intergenic
1003191712 6:3880447-3880469 GTGTCCATAAAGATGCGTGCTGG - Intergenic
1008245069 6:49161512-49161534 ATGTCCAGGCAGAAGTTTGCTGG - Intergenic
1012683222 6:102209665-102209687 ATGTCCAGGCAGAAGTTTGCTGG + Intergenic
1013311451 6:108898357-108898379 GTGTCCACACAGAAGATGCCTGG - Intronic
1017120600 6:151020348-151020370 GCGGCCAGACAGCAGTGTGCTGG + Intronic
1018195964 6:161356358-161356380 GTGACGACACAGAAGCGTCCTGG + Intronic
1019180816 6:170186494-170186516 GTGTGCACACAGGTGTGTGTGGG - Intergenic
1019664615 7:2245491-2245513 GTGTACACACTCAGGTGTGCAGG + Intronic
1020405462 7:7828561-7828583 GTGTACACACAGAAGTCAGCAGG - Intronic
1022003575 7:26247375-26247397 GTGTTCACACAGATATGTGTAGG - Intergenic
1022516551 7:30978340-30978362 GTTTCCACAGAGAGGTGTGAAGG + Intronic
1022800276 7:33770121-33770143 GTGTACACACAGGTGTGTTCTGG + Intergenic
1024200898 7:47104358-47104380 GTGTTCACACGGCAGAGTGCTGG - Intergenic
1024685323 7:51738387-51738409 CTGTGCAGACAGAAGTGTCCAGG + Intergenic
1025564461 7:62415813-62415835 GTTTCTACACAGAAGTCTGTTGG - Intergenic
1028641975 7:93052548-93052570 GTGTCCACAAAAATATGTGCAGG + Intergenic
1030112553 7:106039033-106039055 GTGTGCACACATAGGTGTGTGGG + Intergenic
1032433059 7:131878644-131878666 CTGTCCTCACAGAAGTTTGGGGG - Intergenic
1033176989 7:139133925-139133947 GACTTCACACAGAAGTGTGCTGG - Intronic
1033647532 7:143316711-143316733 GAGCCCACACTGCAGTGTGCTGG + Intronic
1034727400 7:153350483-153350505 GTGTCCCCACAGCAGTGTCATGG - Intergenic
1035041090 7:155927757-155927779 GTGGCCACACAGACCTGTGACGG + Intergenic
1036101308 8:5788788-5788810 GTCTCCACAAGGAAGTGGGCAGG + Intergenic
1036752270 8:11450869-11450891 GTGTCCAGACATAGGTGTGCAGG + Intronic
1037721155 8:21445147-21445169 GTGTGCACACACATGTGTCCAGG - Intergenic
1038195351 8:25361885-25361907 GTGTCCAGGCAGAACTGTGTAGG + Intronic
1038697416 8:29818621-29818643 GGGCCCACACAGCTGTGTGCTGG + Intergenic
1042158356 8:65867604-65867626 GTGTTCACACAGAAGTGTATAGG - Intergenic
1043687183 8:83101626-83101648 GTTTCCACAAAGAAGCTTGCTGG + Intergenic
1043823639 8:84898870-84898892 GTGTCCTAACAGAGGTTTGCAGG - Intronic
1044851445 8:96432708-96432730 ATGTCCAGGCAGAAGTCTGCAGG + Intergenic
1045500741 8:102742717-102742739 GTTTCCCCTCAGTAGTGTGCAGG - Intergenic
1047209789 8:122832099-122832121 GTGTTTACACAGAAATGTGTAGG + Intronic
1048355995 8:133654586-133654608 GTTTCCACCCAGAAGGCTGCAGG + Intergenic
1048839369 8:138551504-138551526 ATGTCCAGGCAGAAGTCTGCTGG + Intergenic
1049543133 8:143217679-143217701 CTGTCCACTCAGAGCTGTGCAGG - Intergenic
1049599015 8:143498652-143498674 TGGTCCACACAGCAGTGTGGGGG - Intronic
1050809291 9:9723550-9723572 GTTTCTACAAAGAAGTGAGCTGG + Intronic
1051767438 9:20540371-20540393 ATGTCCAGGCAGAAGTCTGCTGG - Intronic
1052127589 9:24796922-24796944 GTCTCCACTCAGAAGGGTGAAGG + Intergenic
1054832435 9:69641370-69641392 GTTTCTACAGAGAAGTCTGCTGG - Intronic
1056092226 9:83216575-83216597 ACGTCCACGCAGAAGTTTGCTGG + Intergenic
1056151565 9:83795370-83795392 TTTTCCACAATGAAGTGTGCTGG + Intronic
1056826404 9:89879206-89879228 GTGGCCACACACAGGTGTGATGG + Intergenic
1056976543 9:91261445-91261467 GAGTTCACACAGAAGTGAACTGG - Intronic
1057123951 9:92601667-92601689 GTGCCCACAGAGGAGTGGGCTGG + Intronic
1061506479 9:131034516-131034538 GTGGCCACAGAGGAGTGTCCAGG + Intronic
1187623770 X:21087585-21087607 GTTTCCACTGAGAAGTCTGCTGG - Intergenic
1191151277 X:57222761-57222783 GTGTTTACACAGAAGTGTGTAGG - Intergenic
1191675859 X:63791767-63791789 GTGTTATCACAGAAGTGTTCCGG + Intergenic
1192945924 X:75965575-75965597 GTGTCCACGAAGAAGTGTGCAGG + Intergenic
1194679820 X:96838768-96838790 GTTTCCACACAGAAATGAGCAGG - Intronic
1195121854 X:101762438-101762460 CTGTCCCCACAGAATTGTGTAGG + Intergenic
1195536317 X:106012874-106012896 ATGTCCAGGCAGAAGTTTGCTGG + Intergenic
1199702609 X:150394468-150394490 GTGTCCACAAAAGAATGTGCTGG + Intronic
1199931826 X:152530891-152530913 ATGTCCAGGCAGAAGTCTGCAGG - Intergenic
1201926464 Y:19293350-19293372 ATGTCCACACTGAAGGTTGCAGG + Intergenic