ID: 924724048

View in Genome Browser
Species Human (GRCh38)
Location 1:246651269-246651291
Sequence CCACGCTGCTGTGCTATCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924724039_924724048 -9 Left 924724039 1:246651255-246651277 CCCCCTCCACCCCTCCACGCTGC 0: 1
1: 0
2: 10
3: 128
4: 1353
Right 924724048 1:246651269-246651291 CCACGCTGCTGTGCTATCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 84
924724040_924724048 -10 Left 924724040 1:246651256-246651278 CCCCTCCACCCCTCCACGCTGCT 0: 1
1: 0
2: 7
3: 95
4: 885
Right 924724048 1:246651269-246651291 CCACGCTGCTGTGCTATCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 84
924724036_924724048 10 Left 924724036 1:246651236-246651258 CCCCGAGGCAATGAGTCTGCCCC 0: 1
1: 0
2: 0
3: 4
4: 89
Right 924724048 1:246651269-246651291 CCACGCTGCTGTGCTATCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 84
924724038_924724048 8 Left 924724038 1:246651238-246651260 CCGAGGCAATGAGTCTGCCCCCT 0: 1
1: 0
2: 0
3: 11
4: 152
Right 924724048 1:246651269-246651291 CCACGCTGCTGTGCTATCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 84
924724037_924724048 9 Left 924724037 1:246651237-246651259 CCCGAGGCAATGAGTCTGCCCCC 0: 1
1: 0
2: 0
3: 9
4: 126
Right 924724048 1:246651269-246651291 CCACGCTGCTGTGCTATCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924724048 Original CRISPR CCACGCTGCTGTGCTATCGC AGG Intronic