ID: 924724522

View in Genome Browser
Species Human (GRCh38)
Location 1:246656814-246656836
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 658
Summary {0: 2, 1: 19, 2: 33, 3: 148, 4: 456}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924724522_924724528 1 Left 924724522 1:246656814-246656836 CCCAGCTACAGGAGGCTAAGGTG 0: 2
1: 19
2: 33
3: 148
4: 456
Right 924724528 1:246656838-246656860 GAGGATTGCTTGAGCCTAGGAGG 0: 390
1: 5963
2: 19283
3: 75879
4: 148306
924724522_924724527 -2 Left 924724522 1:246656814-246656836 CCCAGCTACAGGAGGCTAAGGTG 0: 2
1: 19
2: 33
3: 148
4: 456
Right 924724527 1:246656835-246656857 TGGGAGGATTGCTTGAGCCTAGG 0: 2279
1: 12576
2: 33112
3: 64184
4: 114286
924724522_924724529 7 Left 924724522 1:246656814-246656836 CCCAGCTACAGGAGGCTAAGGTG 0: 2
1: 19
2: 33
3: 148
4: 456
Right 924724529 1:246656844-246656866 TGCTTGAGCCTAGGAGGTTGAGG 0: 133
1: 2614
2: 10996
3: 42131
4: 112241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924724522 Original CRISPR CACCTTAGCCTCCTGTAGCT GGG (reversed) Intronic
900686404 1:3950954-3950976 CTGCTCAGCCTCTTGTAGCTGGG - Intergenic
901230549 1:7639655-7639677 CACTTCAGCCTCCTGAGGCTGGG - Intronic
901249060 1:7759033-7759055 CACCTCAGCCTCCAGTAGCTGGG - Intronic
901399781 1:9007848-9007870 TGCCTCCGCCTCCTGTAGCTGGG + Intronic
901503230 1:9666977-9666999 TGCCTCAGCCTCCTGTAGCTGGG + Intronic
901906438 1:12416067-12416089 TACCTCAGCCTCCCGTAGCTGGG - Intronic
902558932 1:17264893-17264915 CACTTCAGCCTCCTGAGGCTGGG - Intronic
902946038 1:19839910-19839932 CACCTTAGCCTCGAGTAGCTGGG - Intergenic
903014399 1:20352601-20352623 CACCTCAGCATGCTGTAGCAGGG + Intronic
903477677 1:23631048-23631070 CACCTCAGCCTCCTGAGTCTGGG - Intronic
903670576 1:25033214-25033236 CACCCTAGGCTCGTCTAGCTGGG + Intergenic
903790732 1:25891215-25891237 TGCCTTAGCCTCCTGCAGCTGGG - Intronic
903806825 1:26011613-26011635 CACCTCAGCCTCAAGCAGCTGGG + Intergenic
903941467 1:26934771-26934793 TGCCTCAGCCTCCAGTAGCTGGG + Intronic
904032830 1:27543827-27543849 TGCCTCAGCTTCCTGTAGCTGGG - Intronic
904306645 1:29594251-29594273 CACCATGGCCTCCTTTAGCTAGG - Intergenic
904744866 1:32704237-32704259 CACCCTTGCCGCCTGTTGCTTGG - Intergenic
904854316 1:33485521-33485543 TGCCTCAGCCCCCTGTAGCTGGG + Intronic
905147232 1:35896474-35896496 TGCCTCAGCCTCCAGTAGCTAGG + Intronic
906335937 1:44930958-44930980 TATCTTAGTCTCCTGTAACTGGG - Intronic
906382010 1:45338877-45338899 CACCTCAGCCTCCTGTAGCTGGG + Intronic
906413672 1:45601866-45601888 TGCCTCAGCCTCCCGTAGCTGGG + Intronic
906768145 1:48455494-48455516 TACCTCAGCCTCAAGTAGCTGGG + Intronic
906888659 1:49682288-49682310 TGCCTCAGCCTCCTGTACCTGGG - Intronic
906970067 1:50503503-50503525 CTCCTCAGGCTCCTATAGCTGGG - Intronic
906988565 1:50713044-50713066 CACCTCAGCCTCCTGTAGCTGGG - Intronic
907041542 1:51265208-51265230 CACCTCAACCTCGAGTAGCTGGG - Intronic
907054613 1:51353688-51353710 CACCTCAGCCCCCAGTAGCTGGG + Intergenic
907117280 1:51979925-51979947 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
907358528 1:53895936-53895958 CACCTCAGCTTCCTACAGCTAGG + Intronic
907409882 1:54276360-54276382 CACCTCAGCCTCCTCAGGCTGGG - Intronic
907885132 1:58585871-58585893 CACCTCAGCTTCAAGTAGCTAGG + Intergenic
908375976 1:63541676-63541698 TACCTCAGCCTCCTGAGGCTGGG + Intronic
909646496 1:77922709-77922731 TGCCTCAGCCTCCCGTAGCTGGG + Intronic
911199286 1:95028319-95028341 CACCTCAGCCTCCAGTAGCTGGG + Intronic
911498096 1:98654979-98655001 CACCTTAGCTTCCTGAATGTTGG + Intergenic
912355953 1:109054231-109054253 TGCCTCAGCCTCCTGTAGCTGGG - Intergenic
913523182 1:119665672-119665694 CACCTGAGCCTCTTGTATCCAGG - Intronic
914245287 1:145881169-145881191 TGCCTCAGTCTCCTGTAGCTGGG - Intronic
914789941 1:150868782-150868804 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
914883925 1:151569718-151569740 CCGCTTGGCCTCCTGAAGCTTGG - Exonic
915163757 1:153936915-153936937 CACCTCAGTCTCAAGTAGCTGGG + Intronic
915314552 1:155020935-155020957 CACCTTAGCCTCCTGAAAGCTGG + Intronic
916093075 1:161324217-161324239 AGCCTCAGCTTCCTGTAGCTGGG + Intronic
916532507 1:165670955-165670977 CACCTTAGCCTCCTATAGCTGGG - Intronic
917329085 1:173863136-173863158 CTCTTCAGCCTCTTGTAGCTAGG - Intergenic
917386049 1:174475655-174475677 CACCTCAGCCTCCCAGAGCTGGG - Intronic
918068276 1:181116663-181116685 CACCTCAGCCCCCTATAGCTGGG + Intergenic
918190571 1:182170178-182170200 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
919706420 1:200680622-200680644 CACCTCAGCCCCACGTAGCTGGG - Intergenic
919784201 1:201248851-201248873 CGCCTTAGGTTCCTGGAGCTTGG + Intergenic
920086855 1:203423738-203423760 CACCTCAGCCTCCCATAGGTGGG - Intergenic
920146359 1:203864527-203864549 CACCTCAGCCTCTAGTAGCTGGG + Intronic
920411615 1:205765950-205765972 CACCTCAGCCTCGAGTAGCTGGG - Intergenic
920422828 1:205847129-205847151 CACCTCAGCCTCCTGTAACTAGG + Intronic
920423628 1:205854608-205854630 CACCTCAGCCTCCTGTAACTAGG - Intergenic
921003712 1:211070706-211070728 TGTCTCAGCCTCCTGTAGCTGGG - Intronic
922222842 1:223621603-223621625 CACATGAGCCTCCTGTAGGAAGG - Intronic
922367448 1:224879069-224879091 CCACTCAGCCTCCAGTAGCTGGG - Intergenic
922416965 1:225431026-225431048 CACCTCAGCCCCGAGTAGCTGGG + Intergenic
922912396 1:229228592-229228614 CCCCTCAGTCTCCTGAAGCTGGG - Intergenic
923711424 1:236390437-236390459 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
923756123 1:236792729-236792751 CACCTCTGCCTCCAGTAGCTGGG + Intergenic
924060528 1:240169578-240169600 CGCCTCAGCCTCAAGTAGCTGGG + Intronic
924621029 1:245660927-245660949 TGCCTCAACCTCCTGTAGCTGGG + Intronic
924724522 1:246656814-246656836 CACCTTAGCCTCCTGTAGCTGGG - Intronic
1063126361 10:3139774-3139796 CGCCTTAGCCTCCTGTAGCTAGG + Intronic
1064112971 10:12554269-12554291 CGCCTCAGCCTCCCGAAGCTGGG + Intronic
1064178259 10:13094370-13094392 TACCTCAGCCTCTAGTAGCTGGG + Intronic
1064202499 10:13296709-13296731 CACCTCAGCCTCCCAAAGCTAGG - Intronic
1064310156 10:14205264-14205286 CTCCATAGCCACATGTAGCTGGG + Intronic
1065514119 10:26507381-26507403 CGCCTCAGCCACCTGTAGCTGGG - Intronic
1067407349 10:46034888-46034910 CACCTCAGCCCCAAGTAGCTGGG - Intronic
1067809350 10:49415286-49415308 CCCTTTAGTCTCCTGCAGCTGGG - Intergenic
1069108563 10:64414132-64414154 TGCCTCAGCCTCCTGTAGCTGGG - Intergenic
1069927526 10:71861207-71861229 CACCTAAGCCTCCTGTAGCTGGG - Intergenic
1070291667 10:75120383-75120405 TGCCTCAGCCTCCCGTAGCTGGG + Intronic
1070350824 10:75590859-75590881 TGCCTCAGCCTCCTGCAGCTGGG + Intronic
1070553360 10:77509232-77509254 TGCCTCAGCCTCCAGTAGCTGGG + Intronic
1070621638 10:78016759-78016781 CACCTCAGCCTACCGTAGCTAGG - Intronic
1071698728 10:87905589-87905611 TGCCTCAGCCTCCCGTAGCTGGG + Intronic
1071962571 10:90821500-90821522 CACCTTAGCCTGCAGTGGCAAGG - Intronic
1072138294 10:92567855-92567877 CACCTCAGCCTCCTGTAGCTAGG - Intronic
1072272438 10:93789756-93789778 TGCCTTAGCCTGCCGTAGCTGGG - Intronic
1072593201 10:96846366-96846388 CACCTGAGCCTCCTGAGGCTGGG + Intronic
1073181417 10:101585714-101585736 CACCTAAACCTCTTATAGCTGGG + Intronic
1073198727 10:101717303-101717325 CACCACAGCCTCCTGTAGCTGGG + Intergenic
1073246718 10:102095956-102095978 TGCCTCAGCCTCCCGTAGCTGGG + Intergenic
1074950694 10:118332056-118332078 TACCTCAGCTTCCTGTAGCTGGG - Intronic
1075152136 10:119943474-119943496 TGCCTCAGCCTCCTGTAGCTGGG - Exonic
1076338536 10:129727187-129727209 CTCCATATCCTGCTGTAGCTTGG - Intronic
1079036935 11:17028067-17028089 TGCCTCAGCCTCCTGTAGCTGGG - Intergenic
1079410886 11:20186460-20186482 CACCTTGGCCTCCTTTGGCTGGG - Intergenic
1080277095 11:30514849-30514871 CACCATGGCCTCCTGAAGTTGGG - Intronic
1080307604 11:30853636-30853658 CCCCTCACCCTCCTGTAGCTTGG - Intronic
1080511788 11:32982004-32982026 CACCTCAGACTCAAGTAGCTGGG + Intronic
1080692797 11:34572948-34572970 CACCTTGGCCTCCCAAAGCTGGG + Intergenic
1081328785 11:41778874-41778896 TGCCTCAGCCTCCCGTAGCTGGG + Intergenic
1081898445 11:46607147-46607169 TACCTCAGCCTCCTGTAGCTGGG - Intronic
1081926981 11:46838678-46838700 CACCTCAGCCTCTAGTGGCTGGG - Intronic
1082014271 11:47472666-47472688 CACCTCAGCCTCAAGTAGCTGGG + Intronic
1083283091 11:61639489-61639511 CGCCTCAGCCTCCTATAGGTGGG - Intergenic
1083734916 11:64674511-64674533 CACCTCAGCCTCAAGTAGCTGGG + Intronic
1084897673 11:72286341-72286363 CACCTCAGCCTCGAGTAGCTGGG + Intergenic
1085623442 11:78054467-78054489 CACCTTGGCCTCCCAAAGCTGGG - Intronic
1089530809 11:119127967-119127989 TGCCTCAGCCTCTTGTAGCTGGG + Intronic
1089544526 11:119212889-119212911 AACCTCTGCCTCCTGTAGCCAGG - Intronic
1090929556 11:131283348-131283370 CACCTCAGCCCCCAGTAGCCTGG - Intergenic
1091454514 12:596806-596828 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1092146343 12:6217271-6217293 CACCTTGGCCTCCCAAAGCTTGG - Intronic
1092349276 12:7742395-7742417 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
1092393249 12:8100524-8100546 TGCCTCAGCCTCCTGAAGCTGGG + Intergenic
1093533144 12:20191016-20191038 TGCCTCAGCCTCCTGTAGCTGGG + Intergenic
1093810974 12:23491673-23491695 CACCTCACCCTCCAGTAGCTGGG + Intergenic
1094035677 12:26067877-26067899 TACCTCAGCCTCCTGTAGCCGGG + Intronic
1095053286 12:37573213-37573235 AACCTCAGCCTCCCATAGCTGGG - Intergenic
1095208311 12:39463543-39463565 AACCTCAGCCTCCAGTAACTAGG + Intergenic
1095672473 12:44876656-44876678 CAGCCTTGCCTCCTGCAGCTGGG - Exonic
1096545282 12:52334770-52334792 TGCCTCAGCCTCCCGTAGCTGGG + Intergenic
1096805702 12:54139920-54139942 TGCCTCAGCCTCCCGTAGCTAGG - Intergenic
1097080572 12:56427822-56427844 CACCTTGGCCTCCTCAAGCGCGG + Intronic
1097810366 12:64012664-64012686 CACCTCAGCCTCTCATAGCTGGG + Intronic
1097947965 12:65393515-65393537 TGCCTCAGCCTCCCGTAGCTGGG - Intronic
1098009434 12:66034577-66034599 CACCTCAGCCTCAAGTAGCAGGG + Intergenic
1098301625 12:69060167-69060189 CACCTCAGCCTCCCAAAGCTGGG - Intergenic
1098415728 12:70232931-70232953 TGCCTTAGCCTCGAGTAGCTGGG + Intergenic
1098486139 12:71024160-71024182 CACCTCAGCCCCAAGTAGCTAGG + Intergenic
1098791334 12:74828024-74828046 CACCTCAGCCTCCTGAAGTGTGG - Intergenic
1099205644 12:79723121-79723143 CACCTCAACCTCCTGTAGCTGGG - Intergenic
1100266739 12:92984390-92984412 CACCTTACGTGCCTGTAGCTGGG - Intergenic
1100445723 12:94657751-94657773 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
1100802475 12:98247728-98247750 AACCTTAGGCTCCTATAGCAGGG + Intergenic
1101507558 12:105361142-105361164 CACCGCCACCTCCTGTAGCTGGG + Intronic
1101979396 12:109392604-109392626 CTCCTCAGCCTCCCATAGCTGGG - Intronic
1101999888 12:109550748-109550770 CACCTCAGTCTCGAGTAGCTGGG + Intergenic
1102232200 12:111270597-111270619 CAAGTTAGCCTTCTGAAGCTTGG - Intronic
1102479232 12:113209632-113209654 CACCTTAGCCTCCCAGTGCTGGG + Intronic
1102533721 12:113565723-113565745 CAGCTTCCCCTCCTGGAGCTGGG - Intergenic
1102922021 12:116798680-116798702 CGCCTCAGCCTCCTGAATCTGGG + Intronic
1103603829 12:122072017-122072039 TGCCTCAGCCTCCCGTAGCTGGG - Intergenic
1103739719 12:123083102-123083124 CACCACAGCCTCCTGTAGCTGGG - Intronic
1103789682 12:123460772-123460794 TGCCTCAGCCTTCTGTAGCTGGG + Intronic
1103939466 12:124494069-124494091 CACAGTGGCCTCCTGTAGGTTGG - Intronic
1104580348 12:130006876-130006898 CATCTTAGCCTCCTGAAGAAGGG - Intergenic
1105325154 13:19364174-19364196 CACCTCAGTCTCCTGAGGCTGGG - Intergenic
1105470741 13:20692478-20692500 CACCTTGGCCTCCCAGAGCTGGG + Intergenic
1105504712 13:20999580-20999602 CATCTCAGCCTCCTGTAGTCAGG + Intronic
1106244251 13:27933747-27933769 TGCCTTAGCCTCCTGTGGCTGGG + Intergenic
1106279941 13:28257924-28257946 CACCTCAGCCTCTAGTAGCTGGG + Intronic
1107512939 13:41103228-41103250 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
1107644626 13:42481003-42481025 TGCCTCAGCCTCCTGAAGCTGGG - Intergenic
1107680325 13:42841756-42841778 CACTTTAGCCCCAAGTAGCTGGG - Intergenic
1109885334 13:68534790-68534812 CACCTTGGCCTCCCAAAGCTGGG - Intergenic
1110250861 13:73378858-73378880 CAACTCAGCCTCCTGTCTCTGGG + Intergenic
1110305104 13:73977292-73977314 CACCTCAGCCTCCCAGAGCTGGG + Intronic
1110332015 13:74283971-74283993 TACCTCAGCCTCCCGTAGCTGGG + Intergenic
1110574730 13:77042307-77042329 CACCTCAGCCCCAAGTAGCTGGG - Intergenic
1111154070 13:84298979-84299001 TTCCTCAGCCTCCTGTAGCTGGG + Intergenic
1111299688 13:86331760-86331782 TGTCTCAGCCTCCTGTAGCTGGG + Intergenic
1111924516 13:94448129-94448151 CATCTCAGCCTCAAGTAGCTGGG - Intronic
1112025624 13:95408355-95408377 CACCTCAGCCTCCCATAGCTGGG + Intergenic
1112148621 13:96730845-96730867 CACCTCAGCTTCCTGTAGCTAGG + Intronic
1112375432 13:98835851-98835873 TGCCTTAGCCTCCCGTAGCTGGG + Intronic
1112396413 13:99036653-99036675 TGCCTCAGCCTCCCGTAGCTGGG + Intronic
1112732998 13:102387843-102387865 TGCCTCAGCCTCCTGTAGCTGGG + Intronic
1112950721 13:104993136-104993158 CATCTCAGCCTCCAGTAGCTGGG - Intergenic
1113123664 13:106952838-106952860 CACCTCAGCCTTGAGTAGCTGGG - Intergenic
1113827169 13:113265298-113265320 CACCTTGCCCTCCCATAGCTGGG - Intronic
1114250817 14:20958942-20958964 CACTTTAGCCTACTGTGGCAAGG - Intergenic
1115209900 14:30956536-30956558 CTCCTCAGCCTCGAGTAGCTAGG - Intronic
1115591735 14:34872475-34872497 CACCTTAGCCTCCTGAGTGTGGG - Intronic
1116840277 14:49813717-49813739 CACCTCAGCTTTCTGTAGCTGGG + Intronic
1116899314 14:50346762-50346784 TGCCTCAGCCTCCAGTAGCTGGG + Intronic
1117090744 14:52247630-52247652 CACTTTATCCTGCTGTACCTTGG - Intergenic
1117171630 14:53106541-53106563 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
1118297967 14:64587857-64587879 CAAGTGATCCTCCTGTAGCTAGG + Intronic
1118368183 14:65113496-65113518 CACCTCAGCCTCTTGTGGCTGGG + Intergenic
1118934220 14:70271527-70271549 TACCTCAGCCTCGAGTAGCTGGG - Intergenic
1119043222 14:71294507-71294529 TGCCTCAGCCTCCAGTAGCTGGG + Intergenic
1119053627 14:71395545-71395567 CACCTCAGCCCCCAGTAGCTGGG - Intronic
1119807716 14:77493109-77493131 CACTTCAGCCCCCAGTAGCTGGG + Intronic
1120108263 14:80521087-80521109 CACCTCAGCCTCCAAGAGCTGGG + Intronic
1120610497 14:86635699-86635721 CACCTTGGCCTCCCAAAGCTCGG - Intergenic
1122496174 14:102157146-102157168 CACCTCAGCCTCTTGTAGCTGGG - Intronic
1122700944 14:103588726-103588748 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
1122730222 14:103791233-103791255 TGCCTCAGCCTACTGTAGCTGGG + Intronic
1124111370 15:26792081-26792103 TGCCTCAGCCTCATGTAGCTGGG - Intronic
1125445944 15:39756477-39756499 CACCTCAGCCTCCTGATGCTTGG + Intronic
1125636445 15:41192726-41192748 CACCTCAGCCTCGAGTAGCTAGG + Intronic
1126196473 15:45937221-45937243 CGCCTCGGCCTCCTGTAGTTTGG + Intergenic
1126473579 15:49042912-49042934 TGCCTCAGCCTCCTGAAGCTGGG - Intronic
1127495283 15:59505549-59505571 CATCTTAGCCACCTATAGCATGG + Intronic
1127895340 15:63293876-63293898 CACTTCAGCCTCAAGTAGCTGGG + Intronic
1128321383 15:66697123-66697145 CCCCTTAGACTCCTTGAGCTAGG + Intergenic
1129003625 15:72354281-72354303 CACCTCAGCTCCCTATAGCTGGG - Intronic
1129345851 15:74918219-74918241 CTCCTTCGCCTCCTGCAGTTTGG + Intergenic
1129614227 15:77085020-77085042 CACTTTATCCTCCTTTGGCTTGG - Intergenic
1129746714 15:78026968-78026990 TGCCTTAGCCTCCAATAGCTGGG - Intronic
1129795564 15:78373560-78373582 TGCCTCAGCCTCCTATAGCTGGG + Intergenic
1129972595 15:79792999-79793021 AACCTCCGCCTCCTGTAGCTGGG + Intergenic
1130608554 15:85339497-85339519 CAGGTGATCCTCCTGTAGCTGGG - Intergenic
1131154477 15:90066589-90066611 TGCCTCAGCCTCCTATAGCTGGG + Intronic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1131608761 15:93938578-93938600 CACCTCGGCCTCCAGAAGCTGGG - Intergenic
1132553524 16:563245-563267 CACCATGGCCACCTGTAGATGGG - Exonic
1132597694 16:760802-760824 CACCTGAGCCTCCTCTGCCTCGG - Intronic
1132890653 16:2202813-2202835 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
1133132056 16:3682745-3682767 CACATCAGCCCCCTGTAGCTAGG - Intronic
1133159538 16:3901283-3901305 AGCCTCAGCCTCCTGAAGCTGGG - Intergenic
1133778106 16:8913862-8913884 CACCTCAGCCTCAAGTAGCTGGG + Intronic
1135020465 16:18958535-18958557 TGCTTCAGCCTCCTGTAGCTGGG - Intergenic
1135223046 16:20630199-20630221 AACCTCCGCCTCCAGTAGCTGGG + Intronic
1135330883 16:21558612-21558634 TGCCTCAGCCTCCTGTAGCTGGG + Intergenic
1135720746 16:24815737-24815759 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
1137544264 16:49389305-49389327 CAGCCTAGCCTCCTGTAGCTGGG - Intronic
1137613610 16:49834839-49834861 CACTTTAGTCCCCTGTTGCTGGG - Intronic
1138558272 16:57785533-57785555 CACCAGCTCCTCCTGTAGCTGGG + Intronic
1139425471 16:66877250-66877272 TGCCTCAGCCTCCTGTAGCTGGG + Intergenic
1139825374 16:69752971-69752993 CACCTCAGCCTCCTGTAGTGAGG - Intronic
1140464337 16:75167711-75167733 CACCTCAGCCTGGAGTAGCTGGG + Intronic
1140521264 16:75584114-75584136 CACCTTGGCTTCCTGTAACTTGG + Intergenic
1142043908 16:87913092-87913114 TGCCTCAGCCTCCTGTAGCTGGG + Intronic
1142498722 17:320523-320545 CACCTCAGCCTTAAGTAGCTAGG - Intronic
1142556645 17:782673-782695 CACCTCAGCCTCCTGTCCCCGGG - Exonic
1142652920 17:1368260-1368282 CGCCTCAGCCTCGAGTAGCTGGG - Intronic
1143002614 17:3804430-3804452 CACCATAGCCTCCCGAAGCTGGG - Intergenic
1143098231 17:4489897-4489919 CACCTCAGCCTCCCAGAGCTGGG - Intergenic
1143314784 17:6024011-6024033 CACCTTGGCCTCCTGAAGTGTGG - Intronic
1144713956 17:17421506-17421528 CACCTGTGCCTCCTGCACCTGGG + Intergenic
1144847493 17:18227500-18227522 CATCTCAGCCTCCTGAAGCTGGG + Intronic
1145350793 17:22081301-22081323 CACCTCAGCCTCCTGAAGGCTGG - Intergenic
1145373810 17:22329232-22329254 AACCTCAGCCTCCCATAGCTGGG - Intergenic
1145721920 17:27081773-27081795 CATCTCAGCCTCCAATAGCTGGG - Intergenic
1147714573 17:42496723-42496745 TTCCACAGCCTCCTGTAGCTGGG - Intronic
1148326829 17:46788165-46788187 CAGCTTTTCCTCCTGGAGCTTGG + Intronic
1148599577 17:48884025-48884047 CACCTCAGCCTCCTGAGGCCCGG + Intergenic
1148713951 17:49702232-49702254 CACCTCAGCCCCGAGTAGCTGGG + Intronic
1149006408 17:51810773-51810795 CCCCTTACCCTCCAGGAGCTGGG + Intronic
1149101415 17:52910870-52910892 CTCCTTAGCCTCTTGAAGTTGGG + Intergenic
1149249322 17:54749862-54749884 CACCTTAGCCTGCTATAGTGGGG + Intergenic
1149916720 17:60616117-60616139 AGCCTCAGCCTCCTGTAACTGGG + Intronic
1150151970 17:62817386-62817408 TGCCCTAGCCTCCTGTACCTGGG + Intergenic
1150195542 17:63294358-63294380 CATTTCAGCCTCCTGTAGCTGGG - Intronic
1150377413 17:64693337-64693359 TGCCTCAGCCTCCTCTAGCTGGG + Intergenic
1151337979 17:73451388-73451410 TGCCTCAGCCTCCAGTAGCTGGG - Intronic
1151464746 17:74277269-74277291 TGCCTCAGCCTCCCGTAGCTGGG - Intronic
1151761786 17:76108260-76108282 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1151856396 17:76725290-76725312 TGCCTCAGCCTCCTGTAACTGGG - Intronic
1152405236 17:80094462-80094484 CACCTTGGCCTCCCAAAGCTGGG - Intronic
1152550935 17:81029796-81029818 CACCTCAGCCTCTAGTGGCTAGG + Intergenic
1152699619 17:81812484-81812506 CACCTGACCCTCCTGCAGGTGGG - Intronic
1152778191 17:82214914-82214936 CACCTTGGCCTCAGGTAGCTGGG - Intergenic
1152778443 17:82215996-82216018 CACCTTGGCCTCAGGTAGCTGGG + Intergenic
1153569108 18:6450730-6450752 CACCTCAGCCTCCTATAGTTAGG - Intergenic
1154183512 18:12158637-12158659 TGCCTCAGCCTCCCGTAGCTGGG + Intergenic
1154222122 18:12465288-12465310 CACCTCAGACTCCAGTAGCCAGG + Intronic
1154329672 18:13419443-13419465 CACCCCAGCCTCCTGTAGCCTGG - Intronic
1155810141 18:30222293-30222315 TGCCTCAGCCTCCAGTAGCTGGG - Intergenic
1155974876 18:32118283-32118305 CACCTTGGCCTCCCAAAGCTGGG - Intronic
1156205701 18:34883423-34883445 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1156677015 18:39539610-39539632 TGCCTCAGCCTCCTGTAGCTAGG + Intergenic
1157627888 18:49066849-49066871 CAACATAGCCTCCTGTACTTTGG + Intronic
1158008497 18:52701268-52701290 CAGGTTAGGCTACTGTAGCTAGG - Intronic
1158907807 18:62030894-62030916 CACCTCAGCCTCGAGTAGCTGGG - Intergenic
1159063666 18:63543730-63543752 GATTATAGCCTCCTGTAGCTGGG + Intergenic
1159510071 18:69386513-69386535 CACCTCAGCCTCCTAAAGTTGGG - Intergenic
1161095425 19:2387629-2387651 CACCTCAGCCTCCCATAGCTGGG - Intergenic
1161383468 19:3978687-3978709 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
1161431623 19:4235811-4235833 CACCTCAGCCTCTTGTAACTGGG - Intronic
1161508013 19:4654455-4654477 CACCTCAGCCCCGGGTAGCTGGG + Exonic
1161867069 19:6840891-6840913 CACTTCAGCCTCGAGTAGCTGGG + Intronic
1161884435 19:6982912-6982934 CACCTCAGCCTTGAGTAGCTGGG - Intergenic
1161915322 19:7224057-7224079 CACCTCAGCCTCCAGTAGCTGGG + Intronic
1162089927 19:8272644-8272666 TGTCTCAGCCTCCTGTAGCTGGG - Intronic
1162092159 19:8287500-8287522 TGTCTCAGCCTCCTGTAGCTGGG - Intronic
1162563525 19:11431995-11432017 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
1162641642 19:12014820-12014842 CACCTCAGCCTCCTAAAGCCTGG + Exonic
1163103843 19:15112271-15112293 CACCTTAGTCTCTTGCAGGTAGG + Intronic
1163422457 19:17221572-17221594 CACCGTAGCCTCCAGTCCCTGGG - Intergenic
1163598128 19:18232247-18232269 CACCTCAGTCTCGAGTAGCTGGG - Intronic
1164145013 19:22506895-22506917 TTCCTCAGCCTCCCGTAGCTGGG + Intronic
1164876866 19:31697049-31697071 TGCCTCAGCCTCCTGTAGCTGGG - Intergenic
1165078500 19:33294151-33294173 CACCTGCGGCTCCTGCAGCTTGG + Intergenic
1165187918 19:34037982-34038004 CTCCTTAGCCTCCTGCAACTTGG + Intergenic
1165530084 19:36391578-36391600 CACCTCAGCCTCGAGTAGCTAGG + Intronic
1165569643 19:36764800-36764822 AACCTCAGCCTCCTTTAGCTGGG + Intronic
1166010415 19:39936951-39936973 CACCTTAGCCTCCTGAATGGTGG - Intergenic
1166098878 19:40559043-40559065 CACTTCAGCCTCGAGTAGCTGGG + Intronic
1166116828 19:40661463-40661485 CACCTCAGCTTCCTGTTACTGGG + Intergenic
1166168237 19:41007737-41007759 TGCCTCAGCCTCCTGTAGCTGGG + Intronic
1166181307 19:41111132-41111154 CACCTCAGCCTCCTATAGCTAGG + Intergenic
1166826782 19:45614787-45614809 GACCTTAGCCTCCTCTGTCTTGG - Intronic
1167291337 19:48626698-48626720 TGCCTCACCCTCCTGTAGCTGGG - Intronic
1167513113 19:49907260-49907282 CACCTGAGCTTCGGGTAGCTGGG + Intronic
1167561646 19:50229524-50229546 CACCTCAGCCTCAAGTAGCTGGG - Intronic
1168044835 19:53787149-53787171 CCTTTTAGCCTCCAGTAGCTGGG + Intergenic
1168080118 19:54003969-54003991 CACCTCATCCTCGAGTAGCTGGG + Intronic
1168382260 19:55933774-55933796 CACCTTGGCCTCCTAAAACTAGG - Intergenic
1168455391 19:56503797-56503819 CGCCTCAGCCTCCCATAGCTGGG + Intergenic
926024046 2:9524374-9524396 CACCTCAGCCTCCTCTAGCTGGG - Intronic
926181123 2:10644132-10644154 TACCTCAACCTCCTGTAGCTGGG - Intronic
926227211 2:10975850-10975872 TGCCTCAGCTTCCTGTAGCTGGG - Intergenic
926242893 2:11101667-11101689 CACCTAAGCCTCCAGCAGCCAGG + Intergenic
927153005 2:20206285-20206307 CCCCTTTGCCTCTTGGAGCTGGG - Intronic
927558959 2:24055456-24055478 CACCTTGGCCTCCTAGTGCTGGG + Intronic
927769208 2:25843686-25843708 CATCTCTGCCTCCTGAAGCTGGG - Intronic
928834827 2:35530891-35530913 CACATTAGCCTACTGTGGCAAGG + Intergenic
928903814 2:36350283-36350305 CACCTTAGCCTCCTGAATACAGG + Intergenic
929100921 2:38312593-38312615 TGCCTCAGCCTCCCGTAGCTGGG - Intronic
929525050 2:42693824-42693846 CACCATAGCCACCTATAGCTGGG + Intronic
929585139 2:43108945-43108967 TACCTCAGCCTCCCATAGCTGGG - Intergenic
929836767 2:45409106-45409128 CACCTCAGCCCCAAGTAGCTGGG - Intronic
930060702 2:47286098-47286120 TGCCTCAGCCTCCTGTAGCTGGG - Intergenic
930291019 2:49492378-49492400 TGCCTCAGCCTCCCGTAGCTGGG - Intergenic
931682327 2:64761270-64761292 TGCCTCAGCTTCCTGTAGCTGGG - Intergenic
932262213 2:70336519-70336541 CCCTTCAGCCTCCAGTAGCTGGG - Intergenic
932427952 2:71654975-71654997 CACCTTAGCCTCCTGTAGCTGGG - Intronic
932615581 2:73229231-73229253 CACCTCAGCCTCGAGTAGCTGGG + Intronic
932629539 2:73327441-73327463 CACCTCAGCCTCCTGTAGCTGGG + Intergenic
932769531 2:74492814-74492836 CTCCTTAGCCACCTGAGGCTTGG - Intronic
933789863 2:85875171-85875193 TGCCTCAGCCTCCCGTAGCTAGG + Intronic
933867416 2:86534310-86534332 TACCTCAGCCTCCCGTACCTGGG + Intronic
935071331 2:99696757-99696779 CGCCATAGCCTAGTGTAGCTAGG + Intronic
935574847 2:104698675-104698697 CAACTTAACCTCATGTAGCTTGG - Intergenic
935647245 2:105349343-105349365 TGCTTCAGCCTCCTGTAGCTGGG + Intergenic
936046132 2:109189201-109189223 CACCAGAGCCTCCTCTATCTCGG - Intronic
936789356 2:116132908-116132930 TACCTCAGCCTCCCATAGCTGGG + Intergenic
937043764 2:118840051-118840073 CACCTTCTCCTCCTCTCGCTGGG + Intergenic
937922762 2:127143522-127143544 CACCTCAGCCTCCCGGTGCTGGG - Intergenic
938710871 2:133975381-133975403 CACCTCAGCCTCCTGTTTCCAGG - Intergenic
938743356 2:134253606-134253628 TACCTTTTCCTCATGTAGCTGGG + Intronic
938846050 2:135210445-135210467 TGCCTCAGCCTCCCGTAGCTGGG + Intronic
939153635 2:138500779-138500801 CAACTCAGCCTCCCGTAGCTGGG - Intergenic
939734983 2:145833086-145833108 TGCCTCAGCCTCCTGAAGCTGGG + Intergenic
939751401 2:146051650-146051672 TACCTCAGCCTCCAGTAGCTGGG - Intergenic
940214560 2:151290827-151290849 CACCTCAGCCTCCTGTAAAATGG + Intergenic
940898268 2:159102391-159102413 CACCTCAGCCTCAAGTAGCTGGG + Intronic
940898525 2:159104660-159104682 CACCTCAGCCTCAAGTAGCTGGG + Intronic
941282933 2:163575358-163575380 CATCTCAGCCTCCCGTAGCTGGG + Intergenic
941968961 2:171329144-171329166 AACCTCTGCCTCCTGTAGCCAGG - Intronic
942383258 2:175415619-175415641 CACCTCAGCCTCAAGTAGCTGGG + Intergenic
943145879 2:184044277-184044299 CACCTCAGCCTCCTATAGCTGGG + Intergenic
943369478 2:187000639-187000661 CACCTTTGCCTCATGGAGCATGG + Intergenic
944229423 2:197377950-197377972 TGCCTCAGCCTCCTGTAGCTGGG + Intergenic
944486399 2:200210991-200211013 CAACTTTGCTTCCTGTATCTTGG - Intergenic
944581206 2:201134192-201134214 TGCCTTCACCTCCTGTAGCTGGG - Intronic
944771623 2:202920266-202920288 TGCCTCAGACTCCTGTAGCTGGG + Intronic
945588790 2:211701640-211701662 TGCCTCAGCCTCCGGTAGCTGGG - Intronic
946522283 2:220479429-220479451 CACCTCAGCCTCCCTCAGCTGGG - Intergenic
946906317 2:224419758-224419780 TGCCTCAGCCTCCCGTAGCTGGG - Intergenic
947314376 2:228839531-228839553 AACCTTGGCCTCCTGTTCCTGGG - Intergenic
947507059 2:230715814-230715836 CACCTCAGCCTCCTGTAGACGGG + Intronic
1169133697 20:3182685-3182707 CACCTCAGCTTCCTGTAGCTGGG + Intergenic
1169377776 20:5080788-5080810 CACCTTGGCCTCCCAAAGCTGGG + Intronic
1169420499 20:5455213-5455235 CACCTCAGCCTCGAGTAGCTAGG + Intergenic
1171528989 20:25839175-25839197 AACCTCAGCCTCCCATAGCTGGG + Intronic
1171547837 20:26016710-26016732 AACCTCAGCCTCCCATAGCTGGG - Intergenic
1171796831 20:29572968-29572990 CACTTGAGCCTTTTGTAGCTTGG + Intergenic
1173470080 20:43316674-43316696 CACCTAAAACTCCTGTTGCTGGG - Intergenic
1174169644 20:48607994-48608016 TGCCTCAGCCTCCGGTAGCTGGG - Intergenic
1174436875 20:50514612-50514634 CACCTTGGCCTCCTGAAGTTGGG + Intronic
1175346486 20:58281094-58281116 CACCTTGGCCTCCCAAAGCTGGG - Intergenic
1175424173 20:58853814-58853836 CACCTGGGCCTCCTGGAGCAAGG - Exonic
1175510577 20:59521846-59521868 CACCTTGGCCTCCCAAAGCTGGG - Intergenic
1175767600 20:61601998-61602020 TACCTTGGCGTCCTGCAGCTTGG - Intronic
1178041341 21:28643562-28643584 CACCTAAGCCTCCAGTAGCTGGG - Intergenic
1178590736 21:33907588-33907610 CACCTCAGCCTCCAGTAGTTGGG - Intronic
1178985980 21:37303515-37303537 CACCTTGGCCTCCTGAAGCTGGG + Intergenic
1179480218 21:41672222-41672244 CACCTTAGCCACCTGTGGCCTGG + Intergenic
1179680910 21:43020769-43020791 CACCTGTGCCTCCTGCAGCGAGG - Intronic
1180576976 22:16786159-16786181 CACCTCAGCCTCCTAAAGGTAGG - Intronic
1180853157 22:19031487-19031509 GACCTTAGCCTAATGTAGCCTGG - Intergenic
1181455601 22:23058657-23058679 CCCCATAGCCCCCTGAAGCTGGG + Intergenic
1181461284 22:23087348-23087370 CACCTGAGCCTCGAGTAGCTGGG - Intronic
1181510748 22:23387705-23387727 CACCTCAGCCTCCTGTGTATTGG - Intergenic
1182197887 22:28537880-28537902 CACCTCAGCCTCCCATAGCTGGG - Intronic
1182625322 22:31641564-31641586 CACCTCAGCCTCCCAAAGCTGGG - Intronic
1182637475 22:31740172-31740194 TGCCTCAGCTTCCTGTAGCTGGG + Intronic
1183439187 22:37813590-37813612 CACCTGGGCCTCCTGCAGCTTGG - Exonic
1183516429 22:38269462-38269484 CACCTCAGCCTCCCAAAGCTTGG + Intronic
1183593787 22:38797448-38797470 TGTCTCAGCCTCCTGTAGCTGGG + Intergenic
1183754461 22:39747235-39747257 CTCCTCAGCCTCCCGAAGCTGGG + Intronic
1183769545 22:39912302-39912324 TGCCTCAGCCTCCTGTAGCTAGG - Intronic
1184199253 22:42954507-42954529 CACTTGAGCCTTCTGAAGCTTGG + Intronic
1184733640 22:46385206-46385228 CACCTCAGCCTCAAGTAGCTGGG + Intronic
1185078567 22:48696463-48696485 CACCTTCACCTCCTGTCCCTGGG - Intronic
949898448 3:8790076-8790098 CACTTCAGTCTCCCGTAGCTGGG - Intronic
950065286 3:10107399-10107421 TGCCTCAGCCTCCCGTAGCTGGG + Intronic
950743489 3:15068294-15068316 CACCTCAGCCCCGAGTAGCTTGG + Intergenic
950864721 3:16179921-16179943 CCATTTAGCCTCCTGTAGCACGG + Intronic
950948429 3:16974994-16975016 CACCTTAGAAGCCTGTAACTGGG - Intronic
951965674 3:28381912-28381934 CACCTTGGCCTCCTATTGCTGGG - Intronic
952282178 3:31934520-31934542 TGCCTCAGCCTCCTGAAGCTGGG + Intronic
952282833 3:31939847-31939869 TGCCTCAGCCTCCTGTAGCTGGG + Intronic
952309086 3:32170856-32170878 CACCTCAGCCCCGAGTAGCTGGG - Intergenic
952509771 3:34041363-34041385 TGCCTCAGCCTCCTGAAGCTGGG - Intergenic
952960693 3:38587446-38587468 ATCCTTAGCCTCATGGAGCTGGG - Exonic
953044859 3:39285264-39285286 CATCTCAGCCTCCCATAGCTGGG - Intergenic
953135047 3:40175025-40175047 TGCCTCAGCCTCCAGTAGCTGGG - Intronic
953720757 3:45352892-45352914 GTCCTTAGCCTCCTTTAGCCTGG + Intergenic
953756938 3:45654716-45654738 CACCTCAGCCTTGAGTAGCTGGG - Intronic
953792401 3:45958405-45958427 GACCTTGGCCTCCTGTGGCCTGG + Exonic
954173984 3:48828604-48828626 CACCTCAGCCTGGAGTAGCTGGG - Intronic
954567822 3:51613649-51613671 TGCCTCAGCCTCCCGTAGCTGGG - Intronic
954618675 3:51983570-51983592 CACCTCACTCTCCTGTCGCTGGG - Exonic
955079787 3:55648069-55648091 CAGCTGAGCTTCCTGAAGCTGGG + Intronic
955554155 3:60118180-60118202 CACCGTAGCCTCCAGTTTCTGGG + Intronic
956118450 3:65941903-65941925 CACCTCAGCCTCCTGAAGCTGGG + Intronic
956506940 3:69951209-69951231 CACCTCAGCCTCCCGTAGCTGGG + Intronic
957565286 3:81877456-81877478 TGCCTCAGCCTCCTGTAGCTAGG + Intergenic
959466008 3:106688546-106688568 CACTTTAGCCTCTTGGAGCCAGG + Intergenic
960299373 3:115983405-115983427 CACCTCAGCCTCAAGTAGCTGGG - Intronic
960467427 3:118014459-118014481 TGCCTCAGCCTCCTGTAGCTGGG + Intergenic
960521009 3:118655171-118655193 CACCTTGGCCTCCTGAAGTGCGG + Intergenic
960805788 3:121582817-121582839 CACCTCAGCCTCCCATAGCTGGG + Intronic
961790907 3:129376145-129376167 CACCTTCCCCTCCTTTAGCCGGG - Intergenic
961843045 3:129734567-129734589 CACCTCAGCCTCAAGTAGCTGGG - Intronic
962400524 3:135055472-135055494 CACCTTATCTTCCTGTACCTTGG - Intronic
962552797 3:136512190-136512212 TGCCTTAGCCTCCTGAAGCTGGG - Intronic
963757007 3:149245230-149245252 TACCTCAGCCTCCCGTAGCTAGG + Intergenic
963896245 3:150688004-150688026 CACCTTAGCCCCCACTAACTGGG - Intronic
963916392 3:150862437-150862459 CACCTCAGCATCCTGGAACTGGG - Intergenic
964031168 3:152140633-152140655 CACCTTAGACTCCAAGAGCTGGG - Intergenic
964821605 3:160776714-160776736 TGCCTCAGCCTCCTGTAACTGGG + Intronic
965096346 3:164232145-164232167 TGCCTCAGCCTCCTGAAGCTGGG + Intergenic
965179369 3:165382238-165382260 TTCCTTAGCCTCCTGTAGCTGGG + Intergenic
965280215 3:166740952-166740974 CACCTTTCCCTCATGTAGATTGG - Intergenic
965815130 3:172628401-172628423 TGCCTCAGCCTCCAGTAGCTGGG - Intergenic
966810867 3:183843399-183843421 CACCTCAGCCCCCAGGAGCTGGG - Intronic
966964677 3:184978646-184978668 CACCTCAGCCTCCCAAAGCTGGG + Intronic
967307248 3:188070828-188070850 TGCCTCAGCCTCCTGTAGCTGGG - Intergenic
967743950 3:193033858-193033880 TGCCTTAGCCTCGAGTAGCTGGG + Intergenic
968110704 3:196044476-196044498 CACCTCAGCCTCGAGTTGCTGGG - Intronic
968564582 4:1304380-1304402 CACCTTAGCCTCCCAAAGCACGG + Intronic
968811645 4:2802278-2802300 TGCCTCAGCCTCCTATAGCTGGG - Intronic
968860874 4:3168760-3168782 CACCTCAGCCCCGAGTAGCTGGG - Intronic
969357058 4:6634734-6634756 TGCTTCAGCCTCCTGTAGCTGGG - Intergenic
969431066 4:7154608-7154630 CACCTTGGCTTCCTCGAGCTGGG + Intergenic
969907424 4:10410319-10410341 CTGCTTAGCATCCTGTAGCCAGG + Intergenic
970423518 4:15926429-15926451 CACCTTGGCCTCCCAAAGCTGGG + Intergenic
970447902 4:16139556-16139578 CACCTTGGCCTCCTGAACTTTGG + Intergenic
970585897 4:17513936-17513958 AGCCTCAGCCTCCAGTAGCTGGG + Intergenic
970888660 4:21016724-21016746 TGCCTCAGCCTCCAGTAGCTGGG + Intronic
971910385 4:32788693-32788715 CACCTTGGCCTCCCAAAGCTTGG - Intergenic
974060322 4:57027419-57027441 CATCTCAGCCTCAAGTAGCTGGG + Intronic
974625745 4:64427383-64427405 CACCTCGGCCTCCTGTAACTGGG + Intergenic
974717713 4:65691857-65691879 TGCCTCAACCTCCTGTAGCTGGG - Intergenic
975236585 4:72004608-72004630 CACATTTGCCTCTTGAAGCTAGG - Intergenic
976240656 4:82953102-82953124 CATCTCAGCCTCCTGTAGGTGGG + Intronic
976413894 4:84749003-84749025 CACCTTAGCCTCCAGTAGGTAGG + Intronic
976725290 4:88210301-88210323 CACCTCAGCCTCCAGTGGCTGGG + Intronic
976753220 4:88471587-88471609 CACCTCAGCCTCCTGGTGTTGGG + Intronic
976790980 4:88878172-88878194 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
977087537 4:92621545-92621567 CACCTCAGCTTCCTATAGCTGGG - Intronic
977199276 4:94096756-94096778 CACCTCAGCCTCCTGGGGCCTGG + Intergenic
977900624 4:102418120-102418142 CACCCTAGCCTCCTGAGGCTGGG - Intronic
978234951 4:106446904-106446926 TACCTTAGCCCCTTTTAGCTAGG + Intergenic
978335014 4:107657605-107657627 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
979187962 4:117822585-117822607 TGCCTTAGCCTCGAGTAGCTGGG - Intergenic
980066317 4:128192944-128192966 CACCTTAACCTCAAGTATCTGGG + Intronic
980416590 4:132496452-132496474 CACAATGGCCTCCTGGAGCTTGG + Intergenic
980843301 4:138293120-138293142 TGCCTCAGCCTCCTGTAGCTGGG + Intergenic
982027371 4:151264180-151264202 CACCTCAGCCTCCCAAAGCTGGG - Intronic
983249859 4:165331188-165331210 CACCTCAGCCCCTCGTAGCTGGG - Intronic
983265375 4:165502291-165502313 CACCTCAGCCTCCTGTAGCTAGG + Intergenic
983281815 4:165690391-165690413 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
983510070 4:168599648-168599670 TGCCTCAGCCTCCAGTAGCTAGG - Intronic
983556672 4:169065252-169065274 AGCCTCAGCCTCCTGTAGCTGGG - Intergenic
983946762 4:173594947-173594969 TGCCTCATCCTCCTGTAGCTGGG + Intergenic
984612673 4:181858198-181858220 CACCTCAGCCTCCTGAATTTTGG + Intergenic
984686567 4:182675291-182675313 CACCTTGGCCTCCTGGTGCTGGG - Intronic
984799115 4:183696643-183696665 CACCTCAGCCTCCCAAAGCTGGG + Intronic
984978733 4:185256737-185256759 CACCTCAGCCCCAAGTAGCTGGG + Intronic
986296533 5:6443902-6443924 GATCCTAGCCTCCTGCAGCTGGG - Intergenic
986378498 5:7159415-7159437 TGCCTCAGCCTCCTGAAGCTGGG + Intergenic
987124657 5:14800838-14800860 CACCTCAGCCTCGGGTAGCTGGG + Intronic
988578743 5:32450685-32450707 TACCTCAGCCTCCTGTAGCTGGG - Intergenic
989047283 5:37285204-37285226 CGCCTCAGCTCCCTGTAGCTGGG - Intergenic
991685121 5:69174631-69174653 AACCTCCGCCTCCAGTAGCTGGG - Intronic
991907517 5:71526799-71526821 TGCCTCAGCCTCCTGTAGCTGGG + Intronic
991979926 5:72220181-72220203 CACCTTGGCCTCATGTACCTGGG + Intronic
992759288 5:79937409-79937431 TGCCTCAGCCTCCTGTAGATGGG + Intergenic
992798414 5:80273844-80273866 CACCTCAGTCTCCTGTAGCTGGG + Intergenic
992810972 5:80388191-80388213 CACCTCAGCCTCCTGTAGCTAGG - Intergenic
994092309 5:95820235-95820257 CACCTCAGCCTCCCGTGGCTGGG - Intronic
995171890 5:109124111-109124133 CACCTCAGCCTTTTGTAGCTGGG - Intronic
995234968 5:109818252-109818274 TGCCTCAGCCTCCTGTAACTGGG + Intronic
995340998 5:111059403-111059425 TGCCTCAGCCTCCTGTAGCTGGG + Intergenic
996728376 5:126692862-126692884 CACCTCAGCCCCAAGTAGCTGGG + Intergenic
997326184 5:133023655-133023677 TGCCTCAGCCTCCTTTAGCTGGG - Intronic
998221017 5:140279575-140279597 CGCTTCAGCCTCCCGTAGCTGGG + Intronic
998235679 5:140396748-140396770 CACCTTAGCTTCCCAAAGCTGGG - Intergenic
998444671 5:142189322-142189344 CGCCTCAGCCTCTAGTAGCTGGG - Intergenic
998555939 5:143123740-143123762 CACCTCAGCCTCCCATAGCTAGG - Intronic
1000069860 5:157730390-157730412 CACCTCATCCTCCCATAGCTAGG + Intergenic
1000079417 5:157830910-157830932 CACCCTCACCTCCAGTAGCTGGG - Intronic
1000445210 5:161310874-161310896 TGCCTCAGCCTCCAGTAGCTGGG + Intronic
1000567934 5:162874335-162874357 TTCCTTGGCCTCCTGTAGTTGGG + Intergenic
1001069248 5:168569934-168569956 TGCCTCAGCCTCCTGTAACTGGG - Intronic
1001605119 5:172954317-172954339 CACCTCAGCCTCCCGGTGCTGGG - Intergenic
1001745253 5:174087672-174087694 CACCTCAGCCTCCTGCAAGTAGG - Intronic
1001819938 5:174702567-174702589 CACCTCAGCCTCCTGTAGCTGGG + Intergenic
1002065189 5:176648172-176648194 CACCTTAGGCTCCTGCAGAGTGG + Intronic
1003400978 6:5790537-5790559 CACCTCTGCCTCCTGGAGCAAGG - Intergenic
1003573366 6:7270514-7270536 TGCCTCAGCCTCCCGTAGCTGGG - Intronic
1003678044 6:8225195-8225217 CACCTCAGCCTCCCATTGCTGGG + Intergenic
1004415277 6:15417626-15417648 CATCTCACCCTCCTGTAACTGGG - Intronic
1004420516 6:15465335-15465357 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1004516062 6:16323268-16323290 CGCCTCAGCCTCCTAAAGCTGGG - Intronic
1004573196 6:16867901-16867923 TACCTCAGCGTCCTGGAGCTGGG - Intergenic
1005082468 6:21970561-21970583 CGTCTCAGCCTCCTGTAGCTGGG + Intergenic
1005103735 6:22200972-22200994 CACCTCAGCCTCCCAAAGCTAGG + Intergenic
1005287731 6:24346637-24346659 TGCCTTAGCCTCCAGTAGCTGGG - Intronic
1005636969 6:27762042-27762064 TGCCTCAGCCTCCCGTAGCTGGG + Intergenic
1006543594 6:34760796-34760818 CACCTTGGCCTCCTAGTGCTGGG - Intronic
1006626099 6:35398997-35399019 CACCTCAGACTCCCATAGCTGGG - Intronic
1007011741 6:38424950-38424972 TGCCTCAGCCTCCCGTAGCTGGG + Intronic
1007409425 6:41653395-41653417 CACCTGTGGCTCCTGCAGCTCGG + Exonic
1007485900 6:42180459-42180481 CACCTTAGCCTCCTGAGTATTGG - Intergenic
1007595529 6:43048879-43048901 TGCCTCAGCCTCCAGTAGCTGGG + Intronic
1007670845 6:43552304-43552326 CACCTTAGCCTCCACGTGCTAGG + Intronic
1008633884 6:53390196-53390218 TTCCTTAGCCCCCTGTAGTTGGG + Intergenic
1010100991 6:72108198-72108220 CATCTTCGCTTCCTGCAGCTGGG + Intronic
1011012836 6:82721544-82721566 CATCTCAGCATCCCGTAGCTAGG - Intergenic
1012316997 6:97793021-97793043 CACCTTAGCCGCTAGTAGGTGGG + Intergenic
1013272300 6:108556581-108556603 CACCTCGGCCTCCCATAGCTGGG + Intergenic
1013354285 6:109333581-109333603 AACCTCAGCCTCCTGAAGCTAGG + Intergenic
1013860313 6:114627823-114627845 CACATTAGCCTCATGTGTCTTGG + Intergenic
1014282737 6:119459756-119459778 CACCTTCGTCTACTGTAGCAAGG + Intergenic
1016203348 6:141441226-141441248 CACCTTAGTCTCCTCTGGTTTGG + Intergenic
1017438087 6:154436599-154436621 CATCTCAGCCTCTAGTAGCTGGG + Intronic
1017450343 6:154548984-154549006 TGCCTCAGCCTCCTGTAGCTGGG + Intergenic
1017941638 6:159058394-159058416 TTCCTCAGCCTCCTATAGCTGGG + Intergenic
1018046632 6:159970962-159970984 CACCTCAGCCTCCCTTAACTGGG - Intronic
1019207271 6:170372714-170372736 CTCCTCAGCCTCCTTTAGCAGGG - Intronic
1019767043 7:2859139-2859161 AGCCTCAGCCTCCTGTAGCTGGG - Intergenic
1019807879 7:3141931-3141953 CACCTCAGCCTCCTGAGGCTGGG - Intronic
1019890471 7:3942020-3942042 TGCCTCAGCCTCCCGTAGCTGGG + Intronic
1021090619 7:16478498-16478520 CACCTTGGCCTCCTAAAGTTAGG + Intronic
1021884962 7:25129267-25129289 CACTTTAGCCCACGGTAGCTGGG + Intergenic
1022943874 7:35262982-35263004 CAAGTTATTCTCCTGTAGCTGGG + Intergenic
1025040781 7:55643547-55643569 TGCCTCAGCCTCCTATAGCTGGG + Intergenic
1025070264 7:55892162-55892184 AGCCTCAGCCTCCTGTAGCTGGG - Intronic
1025619714 7:63157447-63157469 CACCTCAGCCTCAAGTAGCTGGG - Intergenic
1025762207 7:64405344-64405366 TGCCTCAGGCTCCTGTAGCTGGG + Intergenic
1025970029 7:66314397-66314419 CACCTCAGCCTCCTGCAGCTGGG - Intronic
1026104146 7:67407811-67407833 CACCTTAGCCTCAGGCAACTGGG + Intergenic
1026150011 7:67779971-67779993 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
1026530755 7:71195327-71195349 CGCCTCAGTCTCCTATAGCTGGG + Intronic
1026530779 7:71195493-71195515 TACCTGAGTCTCCTATAGCTGGG + Intronic
1026818685 7:73531893-73531915 TGCCTCAGCCTCCCGTAGCTGGG - Intergenic
1027249415 7:76389697-76389719 CCCCTGAGCCTCCTGGATCTAGG + Exonic
1027493086 7:78855200-78855222 CACCTCAGCCCCAAGTAGCTGGG + Intronic
1028569294 7:92268589-92268611 CACCTCAGGCTCCCGTAGCTGGG + Intronic
1028926016 7:96357870-96357892 CACCTCAGCCTCCGGAAGCTGGG + Intergenic
1029247088 7:99209890-99209912 CACCTCAGCCTCAAGTAGCTGGG - Intergenic
1029793293 7:102867814-102867836 TGCCTCAGCCTCCTGTAGCTGGG + Intronic
1030117099 7:106070331-106070353 CACCTTTGCATCCTGGAGTTAGG + Intergenic
1030186746 7:106769856-106769878 CACCTCAGCCCCGAGTAGCTGGG - Intergenic
1030683042 7:112452274-112452296 CTCCTCAGCCTCCTGTAGCTAGG + Intronic
1030940746 7:115646114-115646136 CACCTCAGCCTCTTGAAGCTGGG - Intergenic
1031999007 7:128252615-128252637 CATCTCAGCCTCCCCTAGCTGGG - Intronic
1032380394 7:131473898-131473920 CACCTCAGCCTCCTGAAGTGCGG - Intronic
1032881778 7:136098611-136098633 CTTCTTTGCCTCCCGTAGCTCGG + Intergenic
1034151829 7:148922779-148922801 TGCCTTAGCCTCCAGTAGCTGGG - Intergenic
1035012042 7:155727877-155727899 CACCGCAGCCTCAAGTAGCTGGG + Intronic
1035190573 7:157164270-157164292 TGCTCTAGCCTCCTGTAGCTGGG + Intronic
1036147746 8:6270226-6270248 TGCCTCAGCCTCCAGTAGCTGGG - Intergenic
1036388857 8:8307274-8307296 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
1036467418 8:9013718-9013740 ATCTTTAGCCTCCTGTAGCCTGG + Intronic
1036652163 8:10651609-10651631 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
1037312514 8:17571761-17571783 CACCTTAGCCCCGAGTAGCTGGG - Intergenic
1038290989 8:26249761-26249783 TGCCTCAGCCTCCTGTAGCTGGG - Intergenic
1038469938 8:27806730-27806752 TGCCTCAGCCTCCAGTAGCTGGG + Intronic
1038576711 8:28710674-28710696 CACCTCAGCCTCTAGTAGCTGGG + Intronic
1038917472 8:32039906-32039928 CACCTCAGCCCCAAGTAGCTTGG - Intronic
1039323348 8:36457408-36457430 TGCCTCAGCCTCCCGTAGCTGGG - Intergenic
1039966154 8:42285439-42285461 CACCTCAGCTTCAAGTAGCTGGG - Intronic
1040563109 8:48542149-48542171 TGCCTTGGCCTCCTGTAACTGGG - Intergenic
1040743056 8:50604300-50604322 CACCTCAGCCCCCTGTAGCTGGG - Intronic
1041236251 8:55805766-55805788 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
1041646384 8:60257091-60257113 TGCCTTAGTCTCCGGTAGCTGGG + Intronic
1041686495 8:60649486-60649508 TGCATCAGCCTCCTGTAGCTGGG - Intergenic
1041926144 8:63238638-63238660 TGCCTTAGCCTCCTGAGGCTGGG + Intergenic
1042251906 8:66764582-66764604 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1042598481 8:70474237-70474259 TGCCTCAGCTTCCTGTAGCTGGG + Intergenic
1042649876 8:71027883-71027905 CACCTCGGCCTTCAGTAGCTGGG + Intergenic
1042778528 8:72464157-72464179 TGCCTCAGCCTCCAGTAGCTGGG + Intergenic
1042829954 8:73016002-73016024 CACCTCAGCCTCCCAGAGCTGGG - Intronic
1043475343 8:80600338-80600360 CACCTCAGTCCCCTGTAGCTGGG + Intergenic
1043975768 8:86583015-86583037 AACCTCTGCTTCCTGTAGCTGGG + Intronic
1044860615 8:96519747-96519769 TGCCTCAACCTCCTGTAGCTGGG + Intronic
1044963830 8:97556664-97556686 TGCCTCAGCCTCATGTAGCTGGG - Intergenic
1045252064 8:100490640-100490662 CAGCTTTGCATCCTGGAGCTTGG + Intergenic
1045400318 8:101809658-101809680 TGCCTCAGCCTCCTGTAGCTGGG + Intronic
1045516202 8:102863342-102863364 CACCTTTGCCTCCCGAAGCCCGG - Intronic
1046275904 8:111959315-111959337 CACTTCAGCCTCCTGTAGCTGGG + Intergenic
1046652840 8:116857857-116857879 CACTTCAGCCTCAAGTAGCTGGG - Intronic
1046997660 8:120542403-120542425 CACCTCAGCCTCCAAAAGCTGGG - Intronic
1047742461 8:127817776-127817798 CATCTCAGCCTCTAGTAGCTGGG - Intergenic
1049871565 8:144982694-144982716 TTCCTCAGCCTCCAGTAGCTGGG - Intergenic
1051142127 9:13988800-13988822 CATCTTTGTCTCCTGTACCTGGG - Intergenic
1051670664 9:19506602-19506624 TGCCTCAGCCTCCAGTAGCTGGG + Intergenic
1052456414 9:28705028-28705050 CACCTCAGCCTCCTGTATCTGGG + Intergenic
1052976086 9:34411297-34411319 TGCCTCAGCCTCATGTAGCTAGG - Intronic
1053201685 9:36156271-36156293 CACGTCAGCCTCCTGTAACCAGG - Intronic
1053707921 9:40773710-40773732 CACCTCAGCCTAGAGTAGCTGGG + Intergenic
1054148222 9:61579447-61579469 AACCTCAGCCTCCCATAGCTGGG - Intergenic
1054185383 9:61947491-61947513 AACCTCAGCCTCCCATAGCTGGG + Intergenic
1054467966 9:65510555-65510577 AACCTCAGCCTCCCATAGCTGGG - Intergenic
1054653126 9:67641007-67641029 AACCTCAGCCTCCCATAGCTGGG - Intergenic
1054887589 9:70215635-70215657 CACCATAGGCTCCACTAGCTGGG - Intronic
1055151761 9:73009221-73009243 CACCTCAGCCTCGAGTAGTTGGG + Intronic
1055660501 9:78498809-78498831 TGCCTCAGCCTCCAGTAGCTGGG - Intergenic
1056103651 9:83325438-83325460 CACCTCAGCCTCCTATAGCTAGG + Intronic
1056162604 9:83911655-83911677 CGCCTCAGCCTCCAGTAGCTGGG + Intronic
1056357744 9:85819873-85819895 CGCCTCAGCCTCCAGCAGCTGGG - Intergenic
1057616625 9:96596743-96596765 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1057757688 9:97851198-97851220 TGCCTTAACCTCCAGTAGCTGGG + Intergenic
1057825195 9:98367752-98367774 TACCTTACCCTCCTGTAATTTGG - Intronic
1058436127 9:104965120-104965142 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
1058789669 9:108430121-108430143 CACCTCAGCCTCCAGTAGCTTGG - Intergenic
1059637211 9:116182774-116182796 CACCCTATCTTCCTGCAGCTAGG - Intronic
1060580910 9:124745730-124745752 CGCCTTAGCCTCCCAAAGCTAGG - Intronic
1060746512 9:126137292-126137314 CACCTCAGCCTCCTATAACTGGG + Intergenic
1060989545 9:127840478-127840500 TGCCTCAGACTCCTGTAGCTGGG - Intronic
1062453332 9:136624624-136624646 CTCCTCAGCCCCCTGGAGCTGGG + Intergenic
1185850750 X:3484169-3484191 CACCTCAGCCTCCCATAACTGGG + Intergenic
1186622914 X:11260416-11260438 CACCTTAGCATCAGGTAGCAGGG - Intronic
1187525592 X:20051434-20051456 CACTTCAGCCTCAAGTAGCTGGG - Intronic
1188077305 X:25794034-25794056 TGCCTCAGCCTCCCGTAGCTGGG - Intergenic
1188331843 X:28882392-28882414 CACCTCAGCCTCCCAAAGCTGGG - Intronic
1189481442 X:41395089-41395111 CACCTCATCCTCAAGTAGCTGGG + Intergenic
1190198310 X:48338912-48338934 TTCTTTTGCCTCCTGTAGCTGGG - Intergenic
1190665073 X:52689374-52689396 TTCTTTTGCCTCCTGTAGCTGGG - Intronic
1190674349 X:52769045-52769067 TTCTTTTGCCTCCTGTAGCTGGG + Intronic
1190824165 X:54001664-54001686 CACCTCAGACTCCTTTTGCTGGG - Intronic
1192153468 X:68726225-68726247 CCCCTAAGCCTCCTGGGGCTGGG - Intergenic
1192154207 X:68731696-68731718 CATCTCAGCCTCCTGTAGCTAGG + Intergenic
1192977919 X:76306116-76306138 CTCCTGAGCCACCTATAGCTTGG + Intergenic
1193379301 X:80800424-80800446 CACCTCAGCCTCTGATAGCTGGG - Intronic
1193473768 X:81939262-81939284 CACCTTAGGCTGCTGTAACAAGG - Intergenic
1194730017 X:97441698-97441720 TGCCTCAGCCTCCAGTAGCTGGG - Intronic
1195892459 X:109710822-109710844 TGCCTTAGCCTCCTATAACTAGG + Intronic
1196428281 X:115594938-115594960 TACCTTAGCTTTCTGAAGCTAGG + Intronic
1196754056 X:119142659-119142681 TGCCTCAGCCTCCTGTAGCTGGG - Intronic
1197927438 X:131661860-131661882 CACCTCAGCCTCAAGTATCTGGG + Intergenic
1198025957 X:132707465-132707487 CAGTTTAGCTTTCTGTAGCTGGG - Intronic
1198134386 X:133732976-133732998 CACCTCAGCCTCGTAAAGCTGGG + Intronic
1198312511 X:135436042-135436064 CACATCAGCCTCCTCCAGCTGGG - Intergenic
1198459991 X:136853888-136853910 TACCTCAGCCTCCCGTAGCTGGG - Intronic
1198720795 X:139617419-139617441 CACCTTGCCCTCCTGTCGCATGG - Intronic
1199769516 X:150965536-150965558 CACCTTAGCCTCCTAATGCTGGG + Intergenic
1200098536 X:153675639-153675661 CGCCTCAGCCTCGAGTAGCTGGG + Intronic
1200234847 X:154463343-154463365 CACCACAGCCTCCTGCACCTGGG - Intronic
1200420777 Y:2964913-2964935 CACCTCAGCCTCAAGTAGTTGGG - Intronic
1202343999 Y:23902323-23902345 CACCTCAGCTCCCTGTACCTGGG + Intergenic
1202526769 Y:25767760-25767782 CACCTCAGCTCCCTGTACCTGGG - Intergenic