ID: 924727999

View in Genome Browser
Species Human (GRCh38)
Location 1:246687676-246687698
Sequence CCGTTGAGGGCTGTGTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924727992_924727999 17 Left 924727992 1:246687636-246687658 CCATCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 924727999 1:246687676-246687698 CCGTTGAGGGCTGTGTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924727999 Original CRISPR CCGTTGAGGGCTGTGTGGTG AGG Intergenic
No off target data available for this crispr