ID: 924732911

View in Genome Browser
Species Human (GRCh38)
Location 1:246728485-246728507
Sequence AAATGTATCCCCCTGCTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924732908_924732911 10 Left 924732908 1:246728452-246728474 CCTGAACATGAGTAACACAGTGT 0: 1
1: 0
2: 0
3: 14
4: 119
Right 924732911 1:246728485-246728507 AAATGTATCCCCCTGCTAACTGG 0: 1
1: 0
2: 0
3: 6
4: 91
924732907_924732911 21 Left 924732907 1:246728441-246728463 CCTGCTCTTCACCTGAACATGAG 0: 1
1: 0
2: 0
3: 9
4: 149
Right 924732911 1:246728485-246728507 AAATGTATCCCCCTGCTAACTGG 0: 1
1: 0
2: 0
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924732911 Original CRISPR AAATGTATCCCCCTGCTAAC TGG Intronic
905268962 1:36774193-36774215 AAATGCTTCTCCCTGCGAACCGG - Intergenic
905971264 1:42144193-42144215 AATTGCATCCCCCTCCTCACGGG - Intergenic
907030104 1:51162632-51162654 AAAAGTATTCCCCTGAGAACTGG + Intergenic
916339255 1:163710687-163710709 AAATGTATCTCCTTACTACCTGG + Intergenic
924732911 1:246728485-246728507 AAATGTATCCCCCTGCTAACTGG + Intronic
1080858672 11:36134212-36134234 CAATGTATCCCCCTGCTTTCTGG - Intronic
1084353165 11:68618249-68618271 AAATGTCCCCCCCTGGTCACGGG - Intergenic
1086326366 11:85704960-85704982 AAATGTATCCCGATGCCAAATGG + Exonic
1086371542 11:86160210-86160232 AACTGTAGCCTCCTGCCAACAGG + Intergenic
1088440785 11:109867713-109867735 AAATGTAACTCCCTGCTTGCAGG - Intergenic
1088943211 11:114481767-114481789 AAATCTATCTCCCTTCTAAAGGG + Intergenic
1090544841 11:127753374-127753396 TAATGTATCCCACTGCTTTCTGG + Intergenic
1091037315 11:132245672-132245694 AAATGTTTCCCACTGCCAGCTGG + Intronic
1097684585 12:62679498-62679520 ACATGTATCCCCCTGCAAAAAGG - Intronic
1101752983 12:107598442-107598464 AAATGTATTCCCTAGCTAAGTGG + Intronic
1106036366 13:26048879-26048901 AAATGTTTCTACCTGCTAAAGGG - Intronic
1107864472 13:44690381-44690403 AAATGTATCCACTTACTAAGTGG + Intergenic
1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG + Intergenic
1111993895 13:95143797-95143819 AAACGTATGCCCATGATAACAGG + Intronic
1115309112 14:31961611-31961633 AAATGTATCCCCCTGATCTTTGG - Intergenic
1115862363 14:37701424-37701446 GAGTGTATCACACTGCTAACAGG + Intronic
1119170751 14:72534728-72534750 AAATGTGTCCCCCAGCTGATGGG + Intronic
1120020471 14:79524572-79524594 AAATGGATTCCACTGCAAACAGG + Intronic
1121192581 14:92043347-92043369 ACATGTGTCTACCTGCTAACTGG - Exonic
1124614625 15:31232565-31232587 AAATGTCTCCCCCTTGTATCTGG - Intergenic
1134340510 16:13340801-13340823 AAATGTGTCCTCTTGCTACCGGG + Intergenic
1135678560 16:24438023-24438045 ACATGTATCCTGCTGATAACAGG - Intergenic
1140343566 16:74189822-74189844 GAATGTCTCCCACTGCAAACTGG - Intergenic
1147799077 17:43069715-43069737 AGATGTATCCCACTACTAAAAGG - Intronic
1158997867 18:62941836-62941858 AAATGTGTGCCCTTGTTAACGGG + Exonic
1159165814 18:64698336-64698358 AAATGTATCCATCTGCTTTCTGG - Intergenic
1162372852 19:10289574-10289596 AAATGTATCCCCGCCCTAAGGGG + Intergenic
1164729438 19:30491435-30491457 ACATGTATCGACCTGATAACTGG - Intronic
930159697 2:48142212-48142234 AAAGCATTCCCCCTGCTAACTGG - Intergenic
934878274 2:97948585-97948607 AACTGTAATACCCTGCTAACGGG + Intronic
937529924 2:122815765-122815787 AAATGAATCCCCCAGCTTCCTGG - Intergenic
942087566 2:172457736-172457758 AAAGGCATCCCCCTTCAAACTGG + Intronic
942620711 2:177842747-177842769 AAATGTAAGCCACTGCTATCTGG - Intronic
942636337 2:178010894-178010916 AAATATATTCCCCTTTTAACTGG + Intronic
945121596 2:206462969-206462991 AAATGTAAACCCCTCCCAACTGG - Intronic
945167951 2:206966329-206966351 AAATGGAACTCCATGCTAACTGG - Intronic
1171169123 20:22999882-22999904 AAATGGATCCTCCTGCTGCCTGG + Intergenic
958638184 3:96772396-96772418 AAATTTATCCCTCTGCTCACTGG - Intergenic
963302576 3:143615573-143615595 AAAAGCATCCCCCTGCAACCTGG + Intronic
963875062 3:150466449-150466471 TAATGTTTCCCCCTGGTACCTGG + Intergenic
964397164 3:156257648-156257670 TAATGTATCCCCATGATCACAGG + Intronic
964745580 3:160009145-160009167 AAATTTAGCCCCCTTCTGACAGG + Intergenic
964937287 3:162105816-162105838 AATTGTCTCACCCTGCCAACTGG + Intergenic
966067531 3:175834893-175834915 ACATGTATCTACCTGCTAATTGG + Intergenic
971354882 4:25886485-25886507 AAATCATTCCCTCTGCTAACAGG - Intronic
973634957 4:52853277-52853299 ATGTGTACCCCCATGCTAACTGG - Intergenic
976093460 4:81481516-81481538 AAAAATAGCTCCCTGCTAACAGG - Intronic
979679797 4:123447037-123447059 AGAAGTACGCCCCTGCTAACAGG - Intergenic
982416199 4:155135307-155135329 AAATGGATACCACTGCTAAATGG + Intergenic
984794613 4:183647422-183647444 AATCGTATCCCCCTGGTTACTGG + Intronic
985081571 4:186270606-186270628 GAATATATCCCCCTCCTAATTGG - Intronic
986067370 5:4247819-4247841 AAATATTTCTCCCTACTAACTGG - Intergenic
987002818 5:13677850-13677872 AAAGTTATCCCCCTTCTAACAGG + Intergenic
987694473 5:21310294-21310316 AAAAGGATCTCCCTGCTTACTGG - Intergenic
991745768 5:69739177-69739199 AAAAGGATCTCCCTGCTTACTGG + Intergenic
991751938 5:69816056-69816078 AAAAGGATCTCCCTGCTTACTGG - Intergenic
991797368 5:70319135-70319157 AAAAGGATCTCCCTGCTTACTGG + Intergenic
991825146 5:70614491-70614513 AAAAGGATCTCCCTGCTTACTGG + Intergenic
991831225 5:70690957-70690979 AAAAGGATCTCCCTGCTTACTGG - Intergenic
991889711 5:71318462-71318484 AAAAGGATCTCCCTGCTTACTGG + Intergenic
1004815990 6:19312298-19312320 AAATGTATCACCCTTCCACCTGG + Intergenic
1005556431 6:26989641-26989663 AAAAGGATCTCCCTGCTTACTGG + Intergenic
1010931306 6:81807061-81807083 ACATGTATCCACCTGCCAACGGG + Intergenic
1011466608 6:87664319-87664341 AAATTTATACCCCTGGTAAGTGG + Intronic
1012143666 6:95654596-95654618 AAAAGTATCCACCTGATAATTGG + Intergenic
1015261649 6:131244525-131244547 AAATTTATCTCCCTGCTTAGAGG - Intronic
1015507102 6:133999946-133999968 CAATGTATCCACCTGTAAACTGG - Intronic
1017918513 6:158852096-158852118 AAATGTATCCCCCCAAGAACAGG + Intergenic
1019402149 7:861505-861527 AAGTGCACACCCCTGCTAACAGG - Intronic
1025002836 7:55331622-55331644 AAGTTTATCCCCCAACTAACTGG - Intergenic
1027964278 7:84985576-84985598 AAATGTCTCCCCCTGCCTACAGG + Intergenic
1034091470 7:148368211-148368233 AGATGTGTCCCCCTGCGAATTGG - Intronic
1035482179 7:159196213-159196235 AAATGTATCCCCTCGCTAGGAGG - Intergenic
1035901133 8:3459565-3459587 AAATGCATCCCTTTGCCAACAGG + Intronic
1039979378 8:42394109-42394131 AACTGTATACCCCTTCTCACAGG + Intronic
1041599257 8:59696474-59696496 TAATTTATCCCCATGATAACTGG + Intergenic
1043519926 8:81033946-81033968 GAGTGTATCTCCCTGCTATCTGG + Intronic
1044994794 8:97828984-97829006 ACATGTGCCTCCCTGCTAACCGG - Intronic
1045681681 8:104667338-104667360 AAATGAACCCTCCTGTTAACCGG - Intronic
1049366296 8:142238443-142238465 GAATGTGTCTCCCTGCTGACTGG - Intronic
1055249563 9:74286732-74286754 ACATGCATCAGCCTGCTAACAGG + Intergenic
1055665296 9:78546908-78546930 AAATGGATTCCCCGGCAAACAGG + Intergenic
1056775756 9:89511412-89511434 AAGTGTAGCCACCTGCTAATTGG - Intergenic
1057793347 9:98138703-98138725 TAATGCATCCCCCTGGTACCTGG + Intronic
1058121273 9:101141931-101141953 AAATGCATAACCCTGCTAATTGG + Intronic
1186067720 X:5784093-5784115 AAATGTATCCTCCTGGCAAAAGG - Intergenic
1190139513 X:47830263-47830285 AAATGTTTTCCCCTACTAAAGGG + Intergenic
1193350445 X:80457582-80457604 AAATGAAACCCCCTGCATACAGG + Intergenic
1193937541 X:87641422-87641444 AAATGTATCCCTGTGGTACCAGG - Intronic
1196226792 X:113177428-113177450 ACATGTATCTACCTGCTAATTGG - Intergenic
1198122281 X:133606091-133606113 AAATATGTCCCCCTGTTAAATGG + Intronic
1199643767 X:149885820-149885842 AAATAAGTCCCCCTGCTCACTGG + Exonic
1201522528 Y:14891713-14891735 AAATATATCCCCTAGCTAAAAGG - Intergenic