ID: 924736668

View in Genome Browser
Species Human (GRCh38)
Location 1:246763277-246763299
Sequence ACCCAGAGACTATGCTGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924736664_924736668 3 Left 924736664 1:246763251-246763273 CCAACTTTGATTAATTGATAGTA 0: 1
1: 0
2: 2
3: 29
4: 296
Right 924736668 1:246763277-246763299 ACCCAGAGACTATGCTGGGTCGG 0: 1
1: 0
2: 1
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924736668 Original CRISPR ACCCAGAGACTATGCTGGGT CGG Intronic
900731942 1:4267918-4267940 ACCCAGAGACCACGCAGGATGGG + Intergenic
902614466 1:17616280-17616302 CCCCAGAGGTCATGCTGGGTGGG + Intronic
903451207 1:23454990-23455012 AACCAGGGAGGATGCTGGGTAGG + Intronic
905326158 1:37153363-37153385 ACCCAGAGAACAAGATGGGTGGG - Intergenic
906809058 1:48807858-48807880 AGCCAGAGACTGGGCTGGGCAGG + Intronic
908143480 1:61212752-61212774 ACCCAGACACTGAGCAGGGTGGG - Intronic
910077426 1:83297753-83297775 AACCAGAGACGATGGTGGCTTGG + Intergenic
914237114 1:145822703-145822725 ACCCAGAAACTGTTTTGGGTTGG - Intronic
914879987 1:151539772-151539794 ACCCAGAGCCTAAGCTGACTGGG + Intergenic
921619294 1:217308676-217308698 ACTCAGTGACTCTGCTGGGTTGG - Intergenic
924736668 1:246763277-246763299 ACCCAGAGACTATGCTGGGTCGG + Intronic
1065995171 10:31052813-31052835 ACCCTGAGAAAAGGCTGGGTAGG - Intergenic
1069598479 10:69687853-69687875 ACCCAGAGAGGAGGCTGGCTGGG + Intronic
1074697137 10:116059686-116059708 TCCCAGAGACAATGCAGGGGTGG - Intronic
1076714666 10:132357610-132357632 ACCCAGTGACTTTGCGGGGAGGG + Intronic
1077835760 11:5926420-5926442 ACCCAGAGTCTATCCTTGATGGG - Intronic
1078436226 11:11328014-11328036 ACCCAGAGACTGTGATCAGTGGG + Intronic
1078858942 11:15229669-15229691 AACCAGAGACTGGGATGGGTCGG + Intronic
1079181666 11:18199102-18199124 ATCAAGACACTAGGCTGGGTGGG - Intronic
1079258488 11:18853348-18853370 AGGCAGAGACTAAGATGGGTGGG - Intergenic
1079629979 11:22662765-22662787 ACCCAGAAACTTTGGAGGGTTGG + Intronic
1082699221 11:56407373-56407395 ACCAAGAGACTCTGATGGCTTGG + Intergenic
1084430375 11:69107483-69107505 ATCCAGGGACTATGCTGTGAGGG + Intergenic
1084488154 11:69463222-69463244 ACCCAGAGGCAAAGCTGGGATGG + Intergenic
1084568967 11:69948379-69948401 TCCCAGAGCCTGTGCTGGGTGGG + Intergenic
1084726904 11:70947812-70947834 ACCCAGATGCTATCCTGGATGGG - Intronic
1088626382 11:111733309-111733331 TCCCAGACACTGTGCTGGCTCGG - Intronic
1090628483 11:128626041-128626063 TCCCAGATCCTGTGCTGGGTTGG - Intergenic
1092890910 12:12968493-12968515 TACCAGTGAGTATGCTGGGTGGG - Intergenic
1100285011 12:93157032-93157054 ACCCAGTGACTCTGCTTTGTAGG - Intergenic
1111792889 13:92881177-92881199 CCCCAGAGATTGTGCTGGGAAGG - Intergenic
1112474910 13:99722527-99722549 AACCAGTGACTGTTCTGGGTTGG - Intronic
1113568554 13:111337246-111337268 ACTTAGAGGCTTTGCTGGGTGGG + Intronic
1113929938 13:113962943-113962965 AGGCAGAGACTCTGCTGAGTTGG + Intergenic
1114425037 14:22614412-22614434 ACCCAGAAACTGTGCTGATTGGG - Intergenic
1114696759 14:24633092-24633114 ACCCATGGAATCTGCTGGGTGGG + Intronic
1119196938 14:72724000-72724022 AACAAGAGACTATGCTGGTAGGG + Intronic
1121453360 14:94023404-94023426 ACCCAGACACCATCCTTGGTGGG + Intergenic
1121573084 14:94962124-94962146 ACGCAGAGGCTGAGCTGGGTGGG + Intergenic
1122236297 14:100332411-100332433 ACAGAGAGACTGAGCTGGGTTGG + Intergenic
1122812335 14:104295258-104295280 AGCCTGAGAGGATGCTGGGTTGG + Intergenic
1122901179 14:104782940-104782962 GCCCAGACAGGATGCTGGGTGGG + Intronic
1125828688 15:42695867-42695889 TCCCAGAGAATATGGTGAGTAGG + Exonic
1126209951 15:46090554-46090576 CCCCAGGGGCTATGGTGGGTTGG + Intergenic
1126513491 15:49507322-49507344 TCCCAAAGAGTAGGCTGGGTAGG + Intronic
1126805632 15:52345813-52345835 ACCAATAGACTTTGCTGGGAAGG + Intronic
1127358293 15:58222833-58222855 GCTCAGAGACTATGCTATGTAGG - Intronic
1129129365 15:73479056-73479078 TCCCACAGATTATGCTGGCTAGG + Intronic
1129482392 15:75838099-75838121 ACCGTGAGACTAGGATGGGTTGG - Intergenic
1133088424 16:3384113-3384135 AGCCTGAGCCTATGCTGGCTGGG - Intronic
1138334513 16:56242045-56242067 CCCCAGAGACTGTCCTGGGCTGG - Intronic
1140429864 16:74893214-74893236 ACAGAGAGACTATCCTGGGTGGG + Intronic
1141551407 16:84809009-84809031 ACCCAGAGGGGATGCTGGGAGGG + Intergenic
1141649478 16:85385434-85385456 ACACAGAGACCGGGCTGGGTGGG + Intergenic
1142299283 16:89247297-89247319 ACCCAGGGCCTAGGCGGGGTGGG + Intergenic
1142425341 16:89999580-89999602 CTCCAGAGACTCTGCAGGGTGGG + Intergenic
1143003473 17:3810998-3811020 AAGCAGAGACTGTGCTGGGATGG + Intergenic
1143544692 17:7589190-7589212 ACCCAAAGCCTCTGCTCGGTTGG + Exonic
1143772454 17:9177351-9177373 ACCCAGAGTCTGCTCTGGGTCGG + Intronic
1144650168 17:17002284-17002306 ATCCAGAGACTGTGCCGGGTGGG + Intergenic
1145102257 17:20086841-20086863 ACACAGAGGTTTTGCTGGGTGGG + Intronic
1146621149 17:34398964-34398986 GCCCAGAGGCCAGGCTGGGTTGG + Intergenic
1148331520 17:46816805-46816827 TCGCAGAGACTCTGGTGGGTTGG - Intronic
1148842146 17:50505923-50505945 GCCCAGAGGACATGCTGGGTTGG + Intergenic
1149581177 17:57751273-57751295 ACCCTGAGAGCATGCTGGGAAGG + Intergenic
1151474076 17:74335633-74335655 AGCCAGAGCCTCTGCTGAGTTGG + Intronic
1151732684 17:75920659-75920681 AGCCGGAGACCATGCTGGGGAGG - Intronic
1152844328 17:82590618-82590640 ACTCAGAGACATTGCAGGGTTGG + Intronic
1160871319 19:1279131-1279153 GCCCAGAGCCAAGGCTGGGTGGG + Exonic
1162128790 19:8513071-8513093 TCCCGGAGACTATGCTGGTCAGG + Exonic
1162762440 19:12896701-12896723 ACCCAGATGCCAGGCTGGGTGGG + Intronic
1166683288 19:44781146-44781168 TCCCAGAGCCTATGATGGGAGGG - Intronic
927173836 2:20391774-20391796 ACCCAGGAACTAGGCAGGGTTGG + Intergenic
927202097 2:20584221-20584243 TCCCAGAGGCTGTGCTGGGGAGG + Intronic
928391822 2:30916449-30916471 ACCCAGAGACTGTCCTTAGTTGG + Intronic
929319177 2:40520875-40520897 ACCCAGAGATTTTGCCTGGTAGG - Intronic
931012067 2:57928979-57929001 ACACTGGGACTGTGCTGGGTCGG + Intronic
932616252 2:73233449-73233471 ACCCGGAGAGTATGCTGGGGCGG - Intronic
935629110 2:105197328-105197350 ATCCAGAGGCTAAGATGGGTTGG + Intergenic
937080062 2:119134513-119134535 TCCCAGAGTCTATGCTGGGAGGG - Intergenic
944499614 2:200345611-200345633 ACCCAGAGAAACTGCTGAGTGGG + Intronic
946114573 2:217450262-217450284 ACCTCGAGTCTATGCTAGGTAGG + Intronic
947325714 2:228974357-228974379 ACCCACAGAGTTGGCTGGGTTGG - Intronic
1170972143 20:21126078-21126100 ACCCAGAGGCTGTGCTGAGCTGG + Exonic
1178527848 21:33347605-33347627 AATGAGAGACTATTCTGGGTGGG - Intronic
1179277914 21:39908626-39908648 ATCCAGAGACTCTGCTCAGTGGG - Intronic
1180629211 22:17215779-17215801 CACCAGAGACTATGAAGGGTTGG + Intronic
1183060667 22:35334635-35334657 CCCCACAGGCCATGCTGGGTGGG + Intronic
1183618695 22:38960220-38960242 AGACAGAGGCTGTGCTGGGTAGG - Intronic
1183623898 22:38990165-38990187 AGACAGAGGCTGTGCTGGGTAGG - Intronic
949220983 3:1633563-1633585 ACCCAGAGTAAATGCTCGGTAGG - Intergenic
951365566 3:21777835-21777857 ACCAAGAGACTCAGCAGGGTAGG - Intronic
955473734 3:59313797-59313819 ACCCTGACACTAGGATGGGTGGG + Intergenic
955920004 3:63945778-63945800 CCCCAGAGACTTGGCTAGGTAGG - Intronic
956401367 3:68883402-68883424 AAAGAGAGACTATCCTGGGTGGG - Intronic
964877272 3:161382044-161382066 ACCCAGACACTAAGCTTGGTAGG - Intergenic
965079212 3:164017485-164017507 ATTCTGAGTCTATGCTGGGTTGG - Intergenic
968231738 3:197008571-197008593 ATCCAGACACCATGCTGGGCTGG - Intronic
968963411 4:3757324-3757346 ATCCAGAGAATGTTCTGGGTAGG - Intergenic
973744537 4:53950423-53950445 AACCAGAGACAATGTTTGGTGGG + Intronic
975106494 4:70573426-70573448 AACCAGAGACTCAGCTGGGCTGG + Intergenic
978555224 4:109972727-109972749 GCTCAGTGACTATGCTGGGTTGG - Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979975982 4:127196851-127196873 ACACAGAGCCTTTGCTGGGATGG - Intergenic
980247896 4:130271126-130271148 ACCCAGAGACAATGGCGGGGAGG - Intergenic
983168457 4:164508477-164508499 TCCCAGAGGCTATGCTTGGGAGG - Intergenic
983382660 4:167017380-167017402 AGTTAGTGACTATGCTGGGTAGG - Intronic
983970345 4:173863902-173863924 CCCCACAGACTATGCTGGTGAGG + Intergenic
984529613 4:180901053-180901075 ACCCTGGGACTGTGGTGGGTCGG + Intergenic
986180262 5:5386470-5386492 ATACAGAGATTATCCTGGGTGGG + Intergenic
986879550 5:12153530-12153552 ACCCAGAGCCTTTGTTGTGTAGG - Intergenic
988604614 5:32668722-32668744 ACCCAAAGACCATGGCGGGTGGG - Intergenic
988703642 5:33701503-33701525 TCCCAGGAACTATGCTGGGGTGG - Intronic
990504749 5:56433187-56433209 AGCCAGAGACCAGGCTGGGTAGG - Intergenic
993539839 5:89135167-89135189 TCCCAGAGACTATGCTGTGTTGG - Intergenic
1000026912 5:157367175-157367197 CCCCAGAGACCATCCAGGGTTGG + Intronic
1000140432 5:158397971-158397993 AGCCAGAGCCTATGCTGAGCAGG - Intergenic
1000149487 5:158485646-158485668 GCCCCGAGAATATGCTGGGCAGG + Intergenic
1002543117 5:179919494-179919516 GCCCAGAGACACTGCTGGGCTGG + Intronic
1004456270 6:15794496-15794518 ACGCAGAGGCTGTGCTGGATAGG - Intergenic
1007115253 6:39338893-39338915 GCTCAGAGACCATCCTGGGTGGG - Intronic
1007410023 6:41656129-41656151 CCCTAGAGGCTAAGCTGGGTTGG + Intergenic
1012866206 6:104621160-104621182 ACCCAGAAACAAGGCTGGGTAGG - Intergenic
1014526786 6:122510769-122510791 ACCCAGATAAGGTGCTGGGTCGG + Intronic
1017122408 6:151037072-151037094 ACCCAGCGCCTATGCTGGCCCGG - Exonic
1019285315 7:220310-220332 GCCCAGCGACTCTGCTGGGCAGG - Intronic
1021043378 7:15890910-15890932 GCCAGGAGGCTATGCTGGGTAGG + Intergenic
1023469296 7:40496693-40496715 ACTCAGAGACTATTCTTTGTAGG + Intronic
1024663144 7:51519098-51519120 ACCCAGAGGCTATTCTGTGATGG - Intergenic
1025844588 7:65184945-65184967 AGCACGAGACTATGCTGGCTGGG - Intergenic
1027295202 7:76762957-76762979 AACCAGAGACGATGGTGGCTTGG + Intergenic
1033457735 7:141517781-141517803 ACCCAGAGAAGATGCTGAGAGGG + Intergenic
1037527012 8:19735176-19735198 ACCCAGAGCCAATGCTGAGATGG - Intronic
1037879013 8:22564082-22564104 GACCAGGGACTATGCTGGGTGGG - Intronic
1047976000 8:130131466-130131488 ACCCAGAGAGAATGCAGGCTGGG + Intronic
1048706128 8:137155630-137155652 CCACAGGGATTATGCTGGGTCGG + Intergenic
1056310731 9:85338507-85338529 AGCCAAAGACTCTACTGGGTGGG + Intergenic
1056380470 9:86052896-86052918 GCCCAGAGCCTCTGCTGTGTCGG - Intronic
1058852791 9:109028636-109028658 AAAAAGAGATTATGCTGGGTGGG + Intronic
1060777079 9:126382737-126382759 CCCCAGAGACTATGGGGTGTTGG + Intronic
1062139367 9:134947422-134947444 GGCCAGAGCCTCTGCTGGGTGGG - Intergenic
1062284445 9:135766776-135766798 AGACAGAGACTTAGCTGGGTTGG - Intronic
1187284947 X:17896299-17896321 AGCCAGAGATTATGGTGGCTTGG + Intergenic
1189047369 X:37607668-37607690 ACCAATAGAATATGCTAGGTTGG + Intronic
1194241174 X:91451211-91451233 ACTCTGAGACTATTCTGGCTTGG - Intergenic
1196845379 X:119892972-119892994 ACCCAGAGATCATGCTGTGGAGG - Intergenic
1199545834 X:149006658-149006680 ACACAGAGATTATTCTGGGTGGG - Intergenic
1199653360 X:149970174-149970196 ACCCTGAGATTATCCTGGGGAGG - Intergenic
1199850774 X:151723712-151723734 ACCCAGAGTGTGTGGTGGGTAGG - Intergenic