ID: 924739717

View in Genome Browser
Species Human (GRCh38)
Location 1:246787978-246788000
Sequence GACCCAAGGTGGCTCCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924739709_924739717 7 Left 924739709 1:246787948-246787970 CCAGTTCCCATTCTTGGTCTCAG No data
Right 924739717 1:246787978-246788000 GACCCAAGGTGGCTCCAGACTGG No data
924739708_924739717 8 Left 924739708 1:246787947-246787969 CCCAGTTCCCATTCTTGGTCTCA No data
Right 924739717 1:246787978-246788000 GACCCAAGGTGGCTCCAGACTGG No data
924739707_924739717 9 Left 924739707 1:246787946-246787968 CCCCAGTTCCCATTCTTGGTCTC No data
Right 924739717 1:246787978-246788000 GACCCAAGGTGGCTCCAGACTGG No data
924739712_924739717 1 Left 924739712 1:246787954-246787976 CCCATTCTTGGTCTCAGGGTCCT No data
Right 924739717 1:246787978-246788000 GACCCAAGGTGGCTCCAGACTGG No data
924739706_924739717 10 Left 924739706 1:246787945-246787967 CCCCCAGTTCCCATTCTTGGTCT No data
Right 924739717 1:246787978-246788000 GACCCAAGGTGGCTCCAGACTGG No data
924739713_924739717 0 Left 924739713 1:246787955-246787977 CCATTCTTGGTCTCAGGGTCCTT No data
Right 924739717 1:246787978-246788000 GACCCAAGGTGGCTCCAGACTGG No data
924739704_924739717 16 Left 924739704 1:246787939-246787961 CCTCTGCCCCCAGTTCCCATTCT No data
Right 924739717 1:246787978-246788000 GACCCAAGGTGGCTCCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924739717 Original CRISPR GACCCAAGGTGGCTCCAGAC TGG Intergenic
No off target data available for this crispr