ID: 924742430

View in Genome Browser
Species Human (GRCh38)
Location 1:246802884-246802906
Sequence AATTATAACCACAAACAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924742425_924742430 -10 Left 924742425 1:246802871-246802893 CCCACCCGTGAGAAATTATAACC No data
Right 924742430 1:246802884-246802906 AATTATAACCACAAACAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924742430 Original CRISPR AATTATAACCACAAACAGGA CGG Intergenic
No off target data available for this crispr