ID: 924743265

View in Genome Browser
Species Human (GRCh38)
Location 1:246810108-246810130
Sequence CTATTATTGAGCATCTATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924743265_924743268 7 Left 924743265 1:246810108-246810130 CCTATATAGATGCTCAATAATAG No data
Right 924743268 1:246810138-246810160 ATGAATGGATAAATTTCTGTAGG No data
924743265_924743267 -8 Left 924743265 1:246810108-246810130 CCTATATAGATGCTCAATAATAG No data
Right 924743267 1:246810123-246810145 AATAATAGTTATTGGATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924743265 Original CRISPR CTATTATTGAGCATCTATAT AGG (reversed) Intergenic
No off target data available for this crispr