ID: 924743811

View in Genome Browser
Species Human (GRCh38)
Location 1:246814083-246814105
Sequence GACCTCACTCCCTTTACTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924743811_924743818 5 Left 924743811 1:246814083-246814105 CCGGTAGTAAAGGGAGTGAGGTC No data
Right 924743818 1:246814111-246814133 CTTCGGCAGTAAAGGGAGTGAGG No data
924743811_924743821 18 Left 924743811 1:246814083-246814105 CCGGTAGTAAAGGGAGTGAGGTC No data
Right 924743821 1:246814124-246814146 GGGAGTGAGGTCCAGGGCGTTGG No data
924743811_924743824 30 Left 924743811 1:246814083-246814105 CCGGTAGTAAAGGGAGTGAGGTC No data
Right 924743824 1:246814136-246814158 CAGGGCGTTGGATAGTTTCTGGG No data
924743811_924743816 -2 Left 924743811 1:246814083-246814105 CCGGTAGTAAAGGGAGTGAGGTC No data
Right 924743816 1:246814104-246814126 TCCAGGGCTTCGGCAGTAAAGGG No data
924743811_924743819 11 Left 924743811 1:246814083-246814105 CCGGTAGTAAAGGGAGTGAGGTC No data
Right 924743819 1:246814117-246814139 CAGTAAAGGGAGTGAGGTCCAGG No data
924743811_924743815 -3 Left 924743811 1:246814083-246814105 CCGGTAGTAAAGGGAGTGAGGTC No data
Right 924743815 1:246814103-246814125 GTCCAGGGCTTCGGCAGTAAAGG No data
924743811_924743823 29 Left 924743811 1:246814083-246814105 CCGGTAGTAAAGGGAGTGAGGTC No data
Right 924743823 1:246814135-246814157 CCAGGGCGTTGGATAGTTTCTGG No data
924743811_924743820 12 Left 924743811 1:246814083-246814105 CCGGTAGTAAAGGGAGTGAGGTC No data
Right 924743820 1:246814118-246814140 AGTAAAGGGAGTGAGGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924743811 Original CRISPR GACCTCACTCCCTTTACTAC CGG (reversed) Intergenic
No off target data available for this crispr