ID: 924748271

View in Genome Browser
Species Human (GRCh38)
Location 1:246859361-246859383
Sequence CCAGGGGAACACTAGTAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924748271_924748277 -2 Left 924748271 1:246859361-246859383 CCCATTTACTAGTGTTCCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 91
Right 924748277 1:246859382-246859404 GGCCCTCTTGTTAACCAAACTGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924748271 Original CRISPR CCAGGGGAACACTAGTAAAT GGG (reversed) Intronic
902646637 1:17804251-17804273 CCAGCTGAACACGAGCAAATGGG + Intronic
906012862 1:42545566-42545588 ACAGAGGAACTCTGGTAAATTGG + Exonic
906181246 1:43821518-43821540 CCAGGGGAGAAGTAGGAAATTGG + Intronic
910685492 1:89911943-89911965 CCAGGGGATCACTAGCATTTAGG - Intronic
915196711 1:154194941-154194963 TCAGGGGAAGACTAACAAATCGG + Intergenic
923327624 1:232894865-232894887 CCAATGGAACAGTAGAAAATGGG - Intergenic
924748271 1:246859361-246859383 CCAGGGGAACACTAGTAAATGGG - Intronic
1070034904 10:72712946-72712968 CAAGGGAAACACTAATAAATTGG + Intronic
1070932650 10:80272208-80272230 CCAGGGGAACACTGGGGACTTGG - Exonic
1075374457 10:121967109-121967131 CCAGGAGAGCACTGGTAAAGAGG + Intronic
1079145819 11:17850853-17850875 CCAGGGGGGCAATTGTAAATGGG + Intronic
1079934210 11:26597360-26597382 CCAGCTGAACACTAGTCACTGGG - Intronic
1080495149 11:32810475-32810497 ACAGAGCAAAACTAGTAAATTGG + Intergenic
1088484597 11:110328577-110328599 CCAGCTGAACACTAGTCACTGGG - Intergenic
1091195499 11:133727485-133727507 CCAGGTGAAAACCAGTGAATGGG - Intergenic
1093850844 12:24036006-24036028 CCAGGAGAACCCTAGAGAATGGG + Intergenic
1095695512 12:45139231-45139253 CCAGGGGAAGAAGAGGAAATGGG + Intergenic
1099292649 12:80790247-80790269 CCAGCTGAACACTAGTCACTGGG + Intergenic
1099437352 12:82659952-82659974 CCACGGGCACACAAGTAAAAGGG + Intergenic
1106199691 13:27526060-27526082 CCAGGGGCACAGAAGCAAATGGG - Intergenic
1109931328 13:69222185-69222207 CCAGCTGAACACTAGTCACTGGG + Intergenic
1111075031 13:83223281-83223303 CCATGGTTACACTAGTATATAGG + Intergenic
1111545824 13:89734650-89734672 CCAGGGGGACACAAGTCAATGGG - Intergenic
1112616197 13:101008209-101008231 TCAGGGGAAAAATAGTAAATCGG - Intergenic
1113243311 13:108364814-108364836 TCAGGGGGACACAAGGAAATTGG - Intergenic
1115199559 14:30838417-30838439 CCAGGGGAACCACAGTACATGGG + Intergenic
1118221878 14:63861863-63861885 ACAGTGGAGCAATAGTAAATTGG + Intronic
1122954522 14:105064357-105064379 CCTGGGCAACACTATCAAATTGG - Intronic
1124558015 15:30745888-30745910 GCAGGGGAACACAAGTGAGTGGG - Intronic
1129004552 15:72361355-72361377 CCTGGGTAACATTAGTACATTGG - Intronic
1131673881 15:94651312-94651334 CCAGCTGAACACTAGTCACTGGG + Intergenic
1133422353 16:5657160-5657182 CCAGAGAAAAACTAATAAATAGG - Intergenic
1139223091 16:65204679-65204701 CCTGGGGAACATTTTTAAATAGG - Intergenic
1143167536 17:4904636-4904658 CCAGGGTCACACAAGTAGATTGG + Intergenic
1143765668 17:9136019-9136041 CCAGGGGGACACGAGGAAATGGG - Intronic
1149488800 17:57066853-57066875 CCATAGGAAAACTAGTAAAACGG + Intergenic
1153381620 18:4446244-4446266 GCAGGGGAATACTAGCGAATGGG + Intronic
1156026196 18:32657428-32657450 CCAGGGTTAGCCTAGTAAATAGG - Intergenic
1158065745 18:53405930-53405952 CCAGTAGAATACTAATAAATTGG - Intronic
1159720494 18:71883917-71883939 CCCTCGGAAAACTAGTAAATAGG + Intergenic
1163760427 19:19133312-19133334 CCAGGGGAACACTGGGAGGTAGG + Intronic
926995254 2:18728342-18728364 CCAGGGGAAAACCAGAAATTAGG - Intergenic
930258755 2:49120933-49120955 CCAGGAGAACACTAGTGATTTGG + Intronic
930846343 2:55908910-55908932 CTAGAGGAAGACTAGTAATTGGG - Intronic
931874883 2:66501549-66501571 TCAGGGGAACAACAGCAAATTGG - Intronic
932799539 2:74728159-74728181 CGAGAGGGACACTAATAAATGGG - Intergenic
932918212 2:75879265-75879287 CCAGCTGAACACTAGTCACTGGG + Intergenic
937662076 2:124442402-124442424 GCAGGAGAACGCTAGTAAATTGG - Intronic
939824495 2:146998674-146998696 CAAGCTGAACACTAGTCAATGGG + Intergenic
941583279 2:167326657-167326679 GCAGGGGAAAACTAGGAAACTGG - Intergenic
942818734 2:180084495-180084517 CCTGGGGTGCCCTAGTAAATGGG + Intergenic
948981907 2:241498795-241498817 TCAGGGGAACACTAGTCACTGGG + Intronic
1173354201 20:42271527-42271549 ACATGAGTACACTAGTAAATGGG - Intronic
1175111972 20:56654796-56654818 ACAGGGGACCACTTGTAAGTAGG - Intergenic
1179316842 21:40251477-40251499 ACAAGGGAAGACTAGGAAATAGG - Intronic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
953513990 3:43572194-43572216 CCAGGGGAGCCCTGCTAAATTGG + Intronic
954709596 3:52498817-52498839 CCAGGGAGAGACTAGGAAATTGG - Intronic
955617745 3:60826700-60826722 CCAGGGGAACACCAGAACACCGG + Intronic
957972234 3:87397068-87397090 GCAGGGGATCTCTACTAAATGGG - Intergenic
964823236 3:160796694-160796716 CCAGGAGAAAGCTAGTAAAGGGG - Intronic
965250618 3:166339409-166339431 ATAGAGGAACACTAGAAAATGGG - Intergenic
966148478 3:176839643-176839665 GCAGGGGAACACTTGGAAAATGG + Intergenic
970984287 4:22137855-22137877 CTACGGCATCACTAGTAAATAGG + Intergenic
971455519 4:26840539-26840561 CCAGGGGAACAGCAGAAAAATGG - Intergenic
976942877 4:90728084-90728106 CCAGGGAAGCAGTAGTCAATGGG - Intronic
978775539 4:112502856-112502878 CTAAGGGAACACTAGTTCATAGG + Intergenic
979083497 4:116374565-116374587 CAAGGGGAACAATAGTACATTGG - Intergenic
983259574 4:165441142-165441164 CCAGGGAAACAGTCATAAATGGG - Intronic
985840012 5:2298988-2299010 CCAGGGGAACAATAGGCACTGGG + Intergenic
991878685 5:71200809-71200831 CCTGGGAAACAATAATAAATAGG + Intergenic
992889736 5:81193167-81193189 CCAAGGGAACTCTAGGACATTGG - Intronic
994302209 5:98159448-98159470 CCAGGGAAAGATTGGTAAATCGG + Intergenic
995678065 5:114685690-114685712 CCAGGAGAGCAGTAGTAATTTGG - Intergenic
999932009 5:156443789-156443811 CCAGTGGAACACTGGCACATGGG - Intronic
1000961386 5:167605501-167605523 CCAGGGGAACACTTCTCACTGGG - Intronic
1009725462 6:67531557-67531579 ACAGGGGAAACCTAGAAAATAGG + Intergenic
1014526910 6:122511635-122511657 CCAGGGGGCCACTTGTAAAATGG + Intronic
1014999061 6:128191957-128191979 CCAGGGAAACACAGGGAAATGGG + Intronic
1015713778 6:136169387-136169409 CCAGGGAAATGCTAGAAAATTGG - Intronic
1015937872 6:138420725-138420747 CCAGGGGAACTCTGGGAAAAAGG - Exonic
1019345642 7:529140-529162 CTATGGGAAAACTAGGAAATAGG - Intergenic
1027868332 7:83674902-83674924 CAAGGTGAACACTAGTCACTGGG - Intergenic
1030535687 7:110763553-110763575 CCACCTGAACACTACTAAATGGG + Intronic
1034133567 7:148743446-148743468 CCAGTGGTATACTGGTAAATTGG - Intronic
1035790363 8:2298486-2298508 GCAGGAGAACACTGGTAAAGTGG + Intergenic
1035802442 8:2423219-2423241 GCAGGAGAACACTGGTAAAGTGG - Intergenic
1037349828 8:17940641-17940663 CGAGAGAAAGACTAGTAAATGGG + Intronic
1043215351 8:77579387-77579409 AAAAGGGAACACTAGTATATTGG + Intergenic
1043251133 8:78074645-78074667 CAAGGGGAACACAAGGAAGTGGG - Intergenic
1047190807 8:122677628-122677650 CCAGAGGAACATAAATAAATGGG - Intergenic
1047235619 8:123039725-123039747 ACTGGGGTACAATAGTAAATAGG - Intronic
1048839641 8:138553717-138553739 TCACAGGAACACTAGGAAATTGG + Intergenic
1049542540 8:143215113-143215135 CCACGGGAACACCGGTAAGTGGG + Intergenic
1050116025 9:2264433-2264455 CCAGCTGAACACTAGTCACTAGG - Intergenic
1187613851 X:20972028-20972050 CCAGCTGAACACTAGTCACTGGG + Intergenic
1190634985 X:52424679-52424701 CCAGAGGAACCCTAACAAATAGG + Intergenic
1192253213 X:69430966-69430988 CCAGGGAAACTCTGGGAAATGGG + Intergenic
1192373946 X:70539930-70539952 CCAAGGGACCAGTAGTAAAAAGG + Intronic
1196287246 X:113897297-113897319 CCAGCTGAACACTAGTCACTGGG - Intergenic